PDB_ID PUBMED_CID STRUCTURE TITLE DEPOSITION DATE RELEASE DATE AUTHORS CITATION TITLE JOURNAL YEAR VOLUME FIRST PAGE LAST PAGE 1U74 15339156 Electron Transfer Complex between cytochrome C and cytochrome C peroxidase 2004-08-02 2004-09-28 Kang, S.A.,Marjavaara, P.J.,Crane, B.R. Electron transfer between cytochrome c and cytochome c peroxidase in single crystals. J.Am.Chem.Soc. 2004 126 10836 10837 1ZXN 16100112 Human DNA topoisomerase IIa ATPase/ADP 2005-06-08 2005-08-23 Wei, H.,Ruthenburg, A.J.,Bechis, S.K.,Verdine, G.L. Nucleotide-dependent Domain Movement in the ATPase Domain of a Human Type IIA DNA Topoisomerase. J.Biol.Chem. 2005 280 37041 37047 2AST 16209941 Crystal structure of Skp1-Skp2-Cks1 in complex with a p27 peptide 2005-08-24 2005-10-18 Hao, B.,Zheng, N.,Schulman, B.A.,Wu, G.,Miller, J.J.,Pagano, M.,Pavletich, N.P. Structural Basis of the Cks1-Dependent Recognition of p27(Kip1) by the SCF(Skp2) Ubiquitin Ligase. Mol.Cell 2005 20 9 19 2A7Q 16421443 Crystal structure of human dCK complexed with clofarabine and ADP 2005-07-05 2006-01-24 Zhang, Y.,Secrist, J.A.,Ealick, S.E. The structure of human deoxycytidine kinase in complex with clofarabine reveals key interactions for prodrug activation. Acta Crystallogr.,Sect.D 2006 62 133 139 2AZE 16360038 Structure of the Rb C-terminal domain bound to an E2F1-DP1 heterodimer 2005-09-10 2006-01-31 Rubin, S.M.,Gall, A.L.,Zheng, N.,Pavletich, N.P. Structure of the Rb C-terminal domain bound to E2F1-DP1: a mechanism for phosphorylation-induced E2F release. Cell(Cambridge,Mass.) 2005 123 1093 1106 2GRR 16732283 Crystal Structure of human RanGAP1-Ubc9-D127S 2006-04-24 2006-05-30 Yunus, A.A.,Lima, C.D. Lysine activation and functional analysis of E2-mediated conjugation in the SUMO pathway. Nat.Struct.Mol.Biol. 2006 13 491 499 2CNX 16829959 WDR5 and Histone H3 Lysine 4 dimethyl complex at 2.1 angstrom 2006-05-25 2006-07-03 Ruthenburg, A.J.,Wang, W.,Graybosch, D.M.,Li, H.,Allis, C.D.,Patel, D.J.,Verdine, G.L. Histone H3 Recognition and Presentation by the Wdr5 Module of the Mll1 Complex Nat.Struct.Mol.Biol. 2006 13 704 0 2H6Q 16829959 Histone H3 recognition and presentation by the WDR5 module of the MLL1 complex 2006-06-01 2006-07-04 Ruthenburg, A.J.,Wang, W.-K.,Graybosch, D.M.,Li, H.,Allis, C.D.,Patel, D.J.,Verdine, G.L. Histone H3 recognition and presentation by the WDR5 module of the MLL1 complex. Nat.Struct.Mol.Biol. 2006 13 704 712 2FSA 16728978 Crystal structure of PHD finger-linker-bromodomain fragment of human BPTF in the H3(1-15)K4ME2 bound state 2006-01-21 2006-07-11 Li, H.,Ilin, S.,Wang, W.,Duncan, E.M.,Wysocka, J.,Allis, C.D.,Patel, D.J. Molecular basis for site-specific read-out of histone H3K4me3 by the BPTF PHD finger of NURF. Nature 2006 442 91 95 2GUM 16840698 Crystal structure of the extracellular domain of glycoprotein B from Herpes Simplex Virus type I 2006-05-01 2006-07-25 Heldwein, E.E.,Lou, H.,Bender, F.C.,Cohen, G.H.,Eisenberg, R.J.,Harrison, S.C. Crystal structure of glycoprotein B from herpes simplex virus 1. Science 2006 313 217 220 2H4F 16905097 Sir2-p53 peptide-NAD+ 2006-05-24 2006-09-05 Hoff, K.G.,Avalos, J.L.,Sens, K.,Wolberger, C. Insights into the Sirtuin Mechanism from Ternary Complexes Containing NAD(+) and Acetylated Peptide. Structure 2006 14 1231 1240 2H59 16905097 Sir2 H116A-deacetylated p53 peptide-3'-o-acetyl ADP ribose 2006-05-25 2006-09-05 Hoff, K.G.,Avalos, J.L.,Sens, K.,Wolberger, C. Insights into the Sirtuin Mechanism from Ternary Complexes Containing NAD(+) and Acetylated Peptide. Structure 2006 14 1231 1240 2HPI 16959569 Eubacterial and Eukaryotic Replicative DNA Polymerases are not Homologous: X-ray Structure of DNA Polymerase III 2006-07-17 2006-09-19 Bailey, S.,Wing, R.A.,Steitz, T.A. The Structure of T. aquaticus DNA Polymerase III Is Distinct from Eukaryotic Replicative DNA Polymerases. Cell(Cambridge,Mass.) 2006 126 893 904 2ICT 20696400 Crystal structure of the bacterial antitoxin HigA from Escherichia coli at pH 8.5. Northeast Structural Genomics TARGET ER390. 2006-09-13 2006-09-26 Arbing, M.A.,Handelman, S.K.,Kuzin, A.P.,Verdon, G.,Wang, C.,Su, M.,Rothenbacher, F.P.,Abashidze, M.,Liu, M.,Hurley, J.M.,Xiao, R.,Acton, T.,Inouye, M.,Montelione, G.T.,Woychik, N.A.,Hunt, J.F. Crystal Structures of Phd-Doc, HigA, and YeeU Establish Multiple Evolutionary Links between Microbial Growth-Regulating Toxin-Antitoxin Systems. Structure 2010 18 996 1010 2HVR 17018278 Structure of T4 RNA Ligase 2 with Nicked 5'-Adenylated nucleic acid duplex containing a 3'-deoxyribonucleotide at the nick 2006-07-30 2006-10-17 Nandakumar, J.,Shuman, S.,Lima, C.D. RNA Ligase Structures Reveal the Basis for RNA Specificity and Conformational Changes that Drive Ligation Forward. Cell(Cambridge,Mass.) 2006 127 71 84 2HVS 17018278 Structure of T4 RNA Ligase 2 with Nicked 5'-Adenylated nucleic acid duplex containing a 2'-deoxyribonucleotide at the nick 2006-07-30 2006-10-17 Nandakumar, J.,Shuman, S.,Lima, C.D. RNA Ligase Structures Reveal the Basis for RNA Specificity and Conformational Changes that Drive Ligation Forward. Cell(Cambridge,Mass.) 2006 127 71 84 2IO0 17099700 Crystal structure of human Senp2 in complex with preSUMO-2 2006-10-09 2006-11-14 Reverter, D.,Lima, C.D. Structural basis for SENP2 protease interactions with SUMO precursors and conjugated substrates. Nat.Struct.Mol.Biol. 2006 13 1060 1068 2IO1 17099700 Crystal structure of human Senp2 in complex with preSUMO-3 2006-10-09 2006-11-14 Reverter, D.,Lima, C.D. Structural basis for SENP2 protease interactions with SUMO precursors and conjugated substrates. Nat.Struct.Mol.Biol. 2006 13 1060 1068 2NWD 17360367 Structure of chemically synthesized human lysozyme at 1 Angstrom resolution 2006-11-14 2006-12-19 Durek, T.,Torbeev, V.Y.,Kent, S.B. Convergent chemical synthesis and high-resolution x-ray structure of human lysozyme. Proc.Natl.Acad.Sci.Usa 2007 104 4846 4851 2NN6 17174896 Structure of the human RNA exosome composed of Rrp41, Rrp45, Rrp46, Rrp43, Mtr3, Rrp42, Csl4, Rrp4, and Rrp40 2006-10-23 2006-12-26 Liu, Q.,Greimann, J.C.,Lima, C.D. Reconstitution, activities, and structure of the eukaryotic RNA exosome. Cell(Cambridge,Mass.) 2006 127 1223 1237 2ISS 17144654 Structure of the PLP synthase Holoenzyme from Thermotoga maritima 2006-10-18 2007-01-02 Zein, F.,Zhang, Y.,Kang, Y.N.,Burns, K.,Begley, T.P.,Ealick, S.E. Structural Insights into the Mechanism of the PLP Synthase Holoenzyme from Thermotoga maritima Biochemistry 2006 45 14609 14620 2OAS Crystal Structure of 4-hydroxybutyrate coenzyme A transferase (AtoA) in complex with CoA from Shewanella oneidensis, Northeast Structural Genomics Target SoR119. 2006-12-17 2007-01-23 Forouhar, F.,Neely, H.,Hussain, M.,Benach, J.,Seetharaman, J.,Cunningham, K.,Ma, L.C.,Owen, L.,Fang, Y.,Xiao, R.,Liu, J.,Baran, M.C.,Acton, T.B.,Montelione, G.T.,Hunt, J.F.,Tong, L. Crystal Structure of 4-hydroxybutyrate coenzyme A transferase (AtoA) from Shewanella oneidensis in complex with CoA, Northeast Structural Genomics Target SoR119. To be Published 0 0 0 0 2OJL Crystal structure of Q7WAF1_BORPA from Bordetella parapertussis. Northeast Structural Genomics target BpR68. 2007-01-12 2007-01-23 Benach, J.,Neely, H.,Seetharaman, J.,Wang, H.,Fang, Y.,Cunningham, K.,Ma, L.C.,Xiao, R.,Liu, J.,Baran, M.C.,Acton, T.B.,Rost, B.,Montelione, G.T.,Hunt, J.F.,Tong, L. Crystal structure of Q7WAF1_BORPA from Bordetella parapertussis To be Published 0 0 0 0 2OKA Crystal structure of Q9HYQ7_PSEAE from Pseudomonas aeruginosa. Northeast Structural Genomics Consortium target PaR82 2007-01-16 2007-01-23 Benach, J.,Neely, H.,Seetharaman, J.,Chen, X.C.,Fang, Y.,Cunningham, K.,Owens, L.,Ma, L.C.,Xiao, R.,Liu, J.,Baran, M.C.,Acton, T.B.,Rost, B.,Montelione, G.T.,Hunt, J.F.,Tong, L. Crystal structure of Q9HYQ7_PSEAE from Pseudomonas aeruginosa To be Published 0 0 0 0 2OCY 17289591 Complex of the guanine exchange factor Sec2p and the Rab GTPase Sec4p 2006-12-21 2007-02-27 Dong, G.,Medkova, M.,Novick, P.,Reinisch, K.M. A Catalytic Coiled Coil: Structural Insights into the Activation of the Rab GTPase Sec4p by Sec2p. Mol.Cell 2007 25 455 462 2OQO 17360321 Crystal structure of a peptidoglycan glycosyltransferase from a class A PBP: insight into bacterial cell wall synthesis 2007-01-31 2007-03-13 Yuan, Y.,Barrett, D.,Zhang, Y.,Kahne, D.,Sliz, P.,Walker, S. Crystal structure of a peptidoglycan glycosyltransferase suggests a model for processive glycan chain synthesis. Proc.Natl.Acad.Sci.Usa 2007 104 5348 5353 2J7Q 17349955 Crystal structure of the ubiquitin-specific protease encoded by murine cytomegalovirus tegument protein M48 in complex with a ubquitin-based suicide substrate 2006-10-16 2007-03-20 Schlieker, C.,Weihofen, W.A.,Frijns, E.,Kattenhorn, L.M.,Gaudet, R.,Ploegh, H.L. Structure of a Herpesvirus-Encoded Cysteine Protease Reveals a Unique Class of Deubiquitinating Enzymes Mol.Cell 2007 25 677 0 2OBG 17420456 Crystal Structure of Monobody MBP-74/Maltose Binding Protein Fusion Complex 2006-12-19 2007-03-27 Koide, A.,Gilbreth, R.N.,Esaki, K.,Tereshko, V.,Koide, S. High-affinity single-domain binding proteins with a binary-code interface. Proc.Natl.Acad.Sci.Usa 2007 104 6632 6637 2ITZ 17349580 Crystal structure of EGFR kinase domain L858R mutation in complex with Iressa 2006-05-25 2007-04-03 Yun, C.-H.,Boggon, T.J.,Li, Y.,Woo, S.,Greulich, H.,Meyerson, M.,Eck, M.J. Structures of Lung Cancer-Derived Egfr Mutants and Inhibitor Complexes: Mechanism of Activation and Insights Into Differential Inhibitor Sensitivity Cancer Cell 2007 11 217 0 2J6M 17349580 Crystal structure of EGFR kinase domain in complex with AEE788 2006-09-29 2007-04-03 Yun, C.-H.,Boggon, T.J.,Li, Y.,Woo, S.,Greulich, H.,Meyerson, M.,Eck, M.J. Structures of Lung Cancer-Derived Egfr Mutants and Inhibitor Complexes: Mechanism of Activation and Insights Into Differential Inhibitor Sensitivity Cancer Cell 2007 11 217 0 2OF5 17289572 Oligomeric Death Domain complex 2007-01-02 2007-04-17 Park, H.H.,Logette, E.,Raunser, S.,Cuenin, S.,Walz, T.,Tschopp, J.,Wu, H. Death domain assembly mechanism revealed by crystal structure of the oligomeric PIDDosome core complex. Cell(Cambridge,Mass.) 2007 128 533 546 2PE6 17466333 Non-covalent complex between human SUMO-1 and human Ubc9 2007-04-02 2007-04-17 Capili, A.D.,Lima, C.D. Structure and Analysis of a Complex between SUMO and Ubc9 Illustrates Features of a Conserved E2-Ubl Interaction. J.Mol.Biol. 2007 369 608 618 2NSH 17298082 E. coli PurE H45Q mutant complexed with nitro-AIR 2006-11-04 2007-04-24 Hoskins, A.A.,Morar, M.,Kappock, T.J.,Mathews, I.I.,Zaugg, J.B.,Barder, T.E.,Peng, P.,Okamoto, A.,Ealick, S.E.,Stubbe, J. N(5)-CAIR Mutase: Role of a CO(2) Binding Site and Substrate Movement in Catalysis. Biochemistry 2007 46 2842 2855 2NSJ 17298082 E. coli PurE H45Q mutant complexed with CAIR 2006-11-04 2007-04-24 Hoskins, A.A.,Morar, M.,Kappock, T.J.,Mathews, I.I.,Zaugg, J.B.,Barder, T.E.,Peng, P.,Okamoto, A.,Ealick, S.E.,Stubbe, J. N(5)-CAIR Mutase: Role of a CO(2) Binding Site and Substrate Movement in Catalysis. Biochemistry 2007 46 2842 2855 2J1D 17482208 Crystallization of hDaam1 C-terminal Fragment 2006-08-10 2007-05-15 Lu, J.,Meng, W.,Poy, F.,Maiti, S.,Goode, B.L.,Eck, M.J. Structure of the Fh2 Domain of Daam1: Implications for Formin Regulation of Actin Assembly. J.Mol.Biol. 2007 369 1258 0 2OWO 17466627 Last Stop on the Road to Repair: Structure of E.coli DNA Ligase Bound to Nicked DNA-Adenylate 2007-02-16 2007-05-15 Nandakumar, J.,Nair, P.A.,Shuman, S. Last Stop on the Road to Repair: Structure of E. coli DNA Ligase Bound to Nicked DNA-Adenylate. Mol.Cell 2007 26 257 271 2PQK 20066663 X-ray crystal structure of human Mcl-1 in complex with Bim BH3 2007-05-02 2007-06-19 Fire, E.,Gulla, S.V.,Grant, R.A.,Keating, A.E. Mcl-1-Bim complexes accommodate surprising point mutations via minor structural changes. Protein Sci. 2010 19 507 519 2J0J 17574028 Crystal structure of a fragment of focal adhesion kinase containing the FERM and kinase domains. 2006-08-03 2007-06-26 Lietha, D.,Cai, X.,Ceccarelli, D.F.J.,Li, Y.,Schaller, M.D.,Eck, M.J. Structural Basis for the Autoinhibition of Focal Adhesion Kinase Cell(Cambridge,Mass.) 2007 129 1177 0 2J0K 17574028 Crystal structure of a fragment of focal adhesion kinase containing the FERM and kinase domains. 2006-08-03 2007-07-03 Lietha, D.,Cai, X.,Li, Y.,Schaller, M.D.,Eck, M.J. Structural Basis for the Autoinhibition of Focal Adhesion Kinase. Cell(Cambridge,Mass.) 2007 129 1177 0 2PM9 17604721 Crystal structure of yeast Sec13/31 vertex element of the COPII vesicular coat 2007-04-20 2007-07-03 Fath, S.,Mancias, J.D.,Bi, X.,Goldberg, J. Structure and Organization of Coat Proteins in the COPII Cage. Cell(Cambridge,Mass.) 2007 129 1325 1336 2PFF 17448991 Structural Insights of Yeast Fatty Acid Synthase 2007-04-04 2007-07-10 Xiong, Y.,Lomakin, I.B.,Steitz, T.A. Structural Insights of Yeast Fatty Acid Synthase Cell(Cambridge,Mass.) 2007 129 319 332 2Q2T 17618295 Structure of Chlorella virus DNA ligase-adenylate bound to a 5' phosphorylated nick 2007-05-29 2007-07-10 Nair, P.A.,Nandakumar, J.,Smith, P.,Odell, M.,Lima, C.D.,Shuman, S. Structural basis for nick recognition by a minimal pluripotent DNA ligase. Nat.Struct.Mol.Biol. 2007 14 770 778 2PY5 17611604 Phi29 DNA polymerase complexed with single-stranded DNA 2007-05-15 2007-07-17 Berman, A.J.,Kamtekar, S.,Goodman, J.L.,Lazaro, J.M.,de Vega, M.,Blanco, L.,Salas, M.,Steitz, T.A. Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases Embo J. 2007 26 3494 3505 2PYJ 17611604 Phi29 DNA polymerase complexed with primer-template DNA and incoming nucleotide substrates (ternary complex) 2007-05-16 2007-07-17 Berman, A.J.,Kamtekar, S.,Goodman, J.L.,Lazaro, J.M.,de Vega, M.,Blanco, L.,Salas, M.,Steitz, T.A. Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases Embo J. 2007 26 3494 3505 2Q7E 17592110 The structure of pyrrolysyl-tRNA synthetase bound to an ATP analogue 2007-06-06 2007-07-24 Kavran, J.M.,Gundllapalli, S.,O'donoghue, P.,Englert, M.,Soll, D.,Steitz, T.A. Structure of pyrrolysyl-tRNA synthetase, an archaeal enzyme for genetic code innovation. Proc.Natl.Acad.Sci.Usa 2007 104 11268 11273 2QV2 17765681 A role of the Lowe syndrome protein OCRL in early steps of the endocytic pathway 2007-08-07 2007-08-21 Erdmann, K.S.,Mao, Y.,McCrea, H.J.,Zoncu, R.,Lee, S.,Paradise, S.,Modregger, J.,Biemesderfer, D.,Toomre, D.,De Camilli, P. A role of the Lowe syndrome protein OCRL in early steps of the endocytic pathway Dev.Cell 2007 13 377 390 2QAS Crystal structure of Caulobacter crescentus SspB ortholog 2007-06-15 2007-09-04 Chien, P.,Grant, R.A.,Sauer, R.T.,Baker, T.A. Crystal structure of Caulobacter crescentus SspB ortholog To be Published 0 0 0 0 2QAZ Structure of C. crescentus SspB ortholog 2007-06-15 2007-09-04 Chien, P.,Grant, R.A.,Sauer, R.T.,Baker, T.A. Structure of C. crescentus SspB ortholog To be Published 0 0 0 0 2QX5 17897938 Structure of nucleoporin Nic96 2007-08-10 2007-09-25 Jeudy, S.,Schwartz, T.U. Crystal structure of nucleoporin Nic96 reveals a novel, intricate helical domain architecture J.Biol.Chem. 2007 282 34904 0 2R0G 17873060 Chromopyrrolic acid-soaked RebC with bound 7-carboxy-K252c 2007-08-19 2007-09-25 Ryan, K.S.,Howard-Jones, A.R.,Hamill, M.J.,Elliott, S.J.,Walsh, C.T.,Drennan, C.L. Crystallographic trapping in the rebeccamycin biosynthetic enzyme RebC Proc.Natl.Acad.Sci.Usa 2007 104 15311 15316 2R0P 17873060 K252c-soaked RebC 2007-08-20 2007-09-25 Ryan, K.S.,Howard-Jones, A.R.,Hamill, M.J.,Elliott, S.J.,Walsh, C.T.,Drennan, C.L. Crystallographic trapping in the rebeccamycin biosynthetic enzyme RebC Proc.Natl.Acad.Sci.Usa 2007 104 15311 15316 2QSF 17882165 Crystal structure of the Rad4-Rad23 complex 2007-07-31 2007-10-02 Min, J.-H.,Pavletich, N.P. Recognition of DNA damage by the Rad4 nucleotide excision repair protein Nature 2007 449 570 575 2QSG 17882165 Crystal structure of Rad4-Rad23 bound to a UV-damaged DNA 2007-07-31 2007-10-02 Min, J.-H.,Pavletich, N.P. Recognition of DNA damage by the Rad4 nucleotide excision repair protein Nature 2007 449 570 575 2QSH 17882165 Crystal structure of Rad4-Rad23 bound to a mismatch DNA 2007-07-31 2007-10-02 Min, J.-H.,Pavletich, N.P. Recognition of DNA damage by the Rad4 nucleotide excision repair protein Nature 2007 449 570 575 2QCX 18054064 Crystal structure of Bacillus subtilis TenA Y112F mutant complexed with formyl aminomethyl pyrimidine 2007-06-19 2007-10-23 Jenkins, A.L.,Zhang, Y.,Ealick, S.E.,Begley, T.P. Mutagenesis studies on TenA: A thiamin salvage enzyme from Bacillus subtilis Bioorg.Chem. 2008 36 29 32 2QR1 17937917 Crystal structure of the adenylate sensor from AMP-activated protein kinase in complex with ADP 2007-07-27 2007-10-23 Jin, X.,Townley, R.,Shapiro, L. Structural Insight into AMPK Regulation: ADP Comes into Play. Structure 2007 15 1285 1295 2QRC 17937917 Crystal structure of the adenylate sensor from AMP-activated protein kinase in complex with ADP and AMP 2007-07-28 2007-10-23 Jin, X.,Townley, R.,Shapiro, L. Structural Insight into AMPK Regulation: ADP Comes into Play. Structure 2007 15 1285 1295 2QRD 17937917 Crystal Structure of the Adenylate Sensor from AMP-activated Protein Kinase in complex with ADP and ATP 2007-07-28 2007-10-23 Jin, X.,Townley, R.,Shapiro, L. Structural Insight into AMPK Regulation: ADP Comes into Play. Structure 2007 15 1285 1295 2QRE 17937917 Crystal structure of the adenylate sensor from AMP-activated protein kinase in complex with 5-aminoimidazole-4-carboxamide 1-beta-D-ribofuranotide (ZMP) 2007-07-28 2007-10-23 Jin, X.,Townley, R.,Shapiro, L. Structural Insight into AMPK Regulation: ADP Comes into Play. Structure 2007 15 1285 1295 2OP2 17937908 Crystal structure of RNase double-mutant V43C R85C with extra disulphide bond 2007-01-26 2007-10-30 Pradeep, L.,Kurinov, I.,Ealick, S.E.,Scheraga, H.A. Implementation of a k/k(0) Method to Identify Long-Range Structure in Transition States during Conformational Folding/Unfolding of Proteins. Structure 2007 15 1178 1189 2QJG 17713928 M. jannaschii ADH synthase complexed with F1,6P 2007-07-07 2007-10-30 Morar, M.,White, R.H.,Ealick, S.E. Structure of 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonic acid synthase, a catalyst in the archaeal pathway for the biosynthesis of aromatic amino acids. Biochemistry 2007 46 10562 10571 2QJH 17713928 M. jannaschii ADH synthase covalently bound to dihydroxyacetone phosphate 2007-07-07 2007-10-30 Morar, M.,White, R.H.,Ealick, S.E. Structure of 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonic acid synthase, a catalyst in the archaeal pathway for the biosynthesis of aromatic amino acids. Biochemistry 2007 46 10562 10571 2QJI 17713928 M. jannaschii ADH synthase complexed with dihydroxyacetone phosphate and glycerol 2007-07-07 2007-10-30 Morar, M.,White, R.H.,Ealick, S.E. Structure of 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonic acid synthase, a catalyst in the archaeal pathway for the biosynthesis of aromatic amino acids. Biochemistry 2007 46 10562 10571 2R6A 17947583 Crystal Form BH1 2007-09-05 2007-11-06 Bailey, S.,Eliason, W.K.,Steitz, T.A. Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase Science 2007 318 459 463 2R6E 17947583 Crystal Form B2 2007-09-05 2007-11-06 Bailey, S.,Eliason, W.K.,Steitz, T.A. Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase Science 2007 318 459 463 2QUQ 17997968 Crystal Structure of the Essential Inner Kinetochore Protein Cep3p 2007-08-06 2007-11-13 Bellizzi, J.J.,Sorger, P.K.,Harrison, S.C. Crystal structure of the yeast inner kinetochore subunit Cep3p. Structure 2007 15 1422 1430 2QUQ 17997968 Crystal Structure of the Essential Inner Kinetochore Protein Cep3p 2007-08-06 2007-11-13 Bellizzi, J.J.,Sorger, P.K.,Harrison, S.C. Crystal structure of the yeast inner kinetochore subunit Cep3p. Structure 2007 15 1422 1430 2QUQ 17997968 Crystal Structure of the Essential Inner Kinetochore Protein Cep3p 2007-08-06 2007-11-13 Bellizzi, J.J.,Sorger, P.K.,Harrison, S.C. Crystal structure of the yeast inner kinetochore subunit Cep3p. Structure 2007 15 1422 1430 2Z7B 17973403 Crystal Structure of Mesorhizobium loti 3-hydroxy-2-methylpyridine-4,5-dicarboxylate decarboxylase 2007-08-17 2007-11-13 Mukherjee, T.,McCulloch, K.M.,Ealick, S.E.,Begley, T.P. Gene Identification and Structural Characterization of the Pyridoxal 5'-Phosphate Degradative Protein 3-Hydroxy-2-methylpyridine-4,5-dicarboxylate Decarboxylase from Mesorhizobium loti MAFF303099 Biochemistry 2007 46 13606 13615 2R7K 18069798 Crystal structure of FAICAR synthetase (PurP) from M. jannaschii complexed with AMPPCP and AICAR 2007-09-09 2007-12-04 Zhang, Y.,White, R.H.,Ealick, S.E. Crystal structure and function of 5-formaminoimidazole-4-carboxamide ribonucleotide synthetase from Methanocaldococcus jannaschii. Biochemistry 2008 47 205 217 2R7L 18069798 Crystal structure of FAICAR synthetase (PurP) from M. jannaschii complexed with ATP and AICAR 2007-09-09 2007-12-04 Zhang, Y.,White, R.H.,Ealick, S.E. Crystal structure and function of 5-formaminoimidazole-4-carboxamide ribonucleotide synthetase from Methanocaldococcus jannaschii. Biochemistry 2008 47 205 217 2R7M 18069798 Crystal structure of FAICAR synthetase (PurP) from M. jannaschii complexed with AMP 2007-09-09 2007-12-04 Zhang, Y.,White, R.H.,Ealick, S.E. Crystal structure and function of 5-formaminoimidazole-4-carboxamide ribonucleotide synthetase from Methanocaldococcus jannaschii. Biochemistry 2008 47 205 217 2R7N 18069798 Crystal structure of FAICAR synthetase (PurP) from M. jannaschii complexed with ADP and FAICAR 2007-09-09 2007-12-04 Zhang, Y.,White, R.H.,Ealick, S.E. Crystal structure and function of 5-formaminoimidazole-4-carboxamide ribonucleotide synthetase from Methanocaldococcus jannaschii. Biochemistry 2008 47 205 217 2R84 18069798 Crystal structure of PurP from Pyrococcus furiosus complexed with AMP and AICAR 2007-09-10 2007-12-04 Zhang, Y.,White, R.H.,Ealick, S.E. Crystal structure and function of 5-formaminoimidazole-4-carboxamide ribonucleotide synthetase from Methanocaldococcus jannaschii. Biochemistry 2008 47 205 217 2R85 18069798 Crystal structure of PurP from Pyrococcus furiosus complexed with AMP 2007-09-10 2007-12-04 Zhang, Y.,White, R.H.,Ealick, S.E. Crystal structure and function of 5-formaminoimidazole-4-carboxamide ribonucleotide synthetase from Methanocaldococcus jannaschii. Biochemistry 2008 47 205 217 2R86 18069798 Crystal structure of PurP from Pyrococcus furiosus complexed with ATP 2007-09-10 2007-12-04 Zhang, Y.,White, R.H.,Ealick, S.E. Crystal structure and function of 5-formaminoimidazole-4-carboxamide ribonucleotide synthetase from Methanocaldococcus jannaschii. Biochemistry 2008 47 205 217 2QF0 17981123 Structure of the delta PDZ truncation of the DegS protease 2007-06-26 2007-12-11 Sohn, J.,Grant, R.A.,Sauer, R.T. Allosteric activation of DegS, a stress sensor PDZ protease. Cell(Cambridge,Mass.) 2007 131 572 583 2QR8 18084304 2.0A X-ray structure of C-terminal kinase domain of p90 ribosomal S6 kinase 2 (RSK2) 2007-07-27 2007-12-11 Malakhova, M.,Tereshko, V.,Lee, S.Y.,Yao, K.,Cho, Y.-Y.,Bode, A.,Dong, Z. Structural basis for activation of the autoinhibitory C-terminal kinase domain of p90 RSK2. Nat.Struct.Mol.Biol. 2008 15 112 113 2QRO 18084067 Human Deoxycytidine kinase dAMP, UDP, Mg ion product complex 2007-07-28 2007-12-11 Soriano, E.V.,Clark, V.C.,Ealick, S.E. Structures of human deoxycytidine kinase product complexes. Acta Crystallogr.,Sect.D 2007 63 1201 1207 2RCE DFP modified DegS delta PDZ 2007-09-19 2007-12-11 Sohn, J.,Grant, R.A.,Sauer, R.T. DFP modified DegS delta PDZ To be Published 0 0 0 0 2RHI 18042461 Crystal structure of the 3-MBT domain from human L3MBTL1 in complex with H1.5K27me2 at 1.66 angstrom 2007-10-09 2007-12-11 Li, H.,Fischle, W.,Wang, W.,Duncan, E.M.,Liang, L.,Murakami-Ishibe, S.,Allis, C.D.,Patel, D.J. Structural Basis for Lower Lysine Methylation State-Specific Readout by MBT Repeats of L3MBTL1 and an Engineered PHD Finger. Mol.Cell 2007 28 677 691 2RHX 18042461 Crystal structure of the 3-MBT repeats from human L3MBTL1 bound to dimethyl-lysine 2007-10-09 2007-12-11 Li, H.,Fischle, W.,Wang, W.,Duncan, E.M.,Liang, L.,Murakami-Ishibe, S.,Allis, C.D.,Patel, D.J. Structural Basis for Lower Lysine Methylation State-Specific Readout by MBT Repeats of L3MBTL1 and an Engineered PHD Finger. Mol.Cell 2007 28 677 691 2RI7 18042461 Crystal structure of PHD finger-linker-bromodomain Y17E mutant from human BPTF in the H3(1-9)K4ME2 bound state 2007-10-10 2007-12-11 Li, H.,Fischle, W.,Wang, W.,Duncan, E.M.,Liang, L.,Murakami-Ishibe, S.,Allis, C.D.,Patel, D.J. Structural Basis for Lower Lysine Methylation State-Specific Readout by MBT Repeats of L3MBTL1 and an Engineered PHD Finger. Mol.Cell 2007 28 677 691 3BMZ 18171675 Violacein biosynthetic enzyme VioE 2007-12-13 2008-01-01 Ryan, K.S.,Balibar, C.J.,Turo, K.E.,Walsh, C.T.,Drennan, C.L. The Violacein Biosynthetic Enzyme VioE Shares a Fold with Lipoprotein Transporter Proteins J.Biol.Chem. 2008 283 6467 6475 2R6F 18158267 Crystal Structure of Bacillus stearothermophilus UvrA 2007-09-05 2008-01-08 Pakotiprapha, D.,Inuzuka, Y.,Bowman, B.R.,Moolenaar, G.F.,Goosen, N.,Jeruzalmi, D.,Verdine, G.L. Crystal Structure of Bacillus stearothermophilus UvrA Provides Insight into ATP-Modulated Dimerization, UvrB Interaction, and DNA Binding. Mol.Cell 2008 29 122 133 2R6F 18158267 Crystal Structure of Bacillus stearothermophilus UvrA 2007-09-05 2008-01-08 Pakotiprapha, D.,Inuzuka, Y.,Bowman, B.R.,Moolenaar, G.F.,Goosen, N.,Jeruzalmi, D.,Verdine, G.L. Crystal Structure of Bacillus stearothermophilus UvrA Provides Insight into ATP-Modulated Dimerization, UvrB Interaction, and DNA Binding. Mol.Cell 2008 29 122 133 2JIU 18227510 Crystal structure of EGFR kinase domain T790M mutation in complex with AEE788 2007-07-01 2008-01-22 Yun, C.-H.,Mengwasser, K.E.,Toms, A.V.,Woo, M.S.,Greulich, H.,Wong, K.-K.,Meyerson, M.,Eck, M.J. The T790M Mutation in Egfr Kinase Causes Drug Resistance by Increasing the Affinity for ATP. Proc.Natl.Acad.Sci.USA 2008 105 2070 0 2JIV 18227510 Crystal structure of EGFR kinase domain T790M mutation in compex with HKI-272 2007-07-02 2008-01-22 Yun, C.-H.,Mengwasser, K.E.,Toms, A.V.,Woo, M.S.,Greulich, H.,Wong, K.-K.,Meyerson, M.,Eck, M.J. The T790M Mutation in Egfr Kinase Causes Drug Resistance by Increasing the Affinity for ATP. Proc.Natl.Acad.Sci.USA 2008 105 2070 0 2RFA 18232717 Crystal structure of the mouse TRPV6 ankyrin repeat domain 2007-09-28 2008-02-19 Phelps, C.B.,Huang, R.J.,Lishko, P.V.,Wang, R.R.,Gaudet, R. Structural analyses of the ankyrin repeat domain of TRPV6 and related TRPV ion channels. Biochemistry 2008 47 2476 2484 3BCG 18607081 Conformational changes of the AcrR regulator reveal a mechanism of induction 2007-11-12 2008-02-26 Gu, R.,Li, M.,Su, C.C.,Long, F.,Routh, M.D.,Yang, F.,McDermott, G.,Yu, E.W. Conformational change of the AcrR regulator reveals a possible mechanism of induction. Acta Crystallogr.,Sect.F 2008 64 584 588 3BS5 18287031 Crystal Structure of hCNK2-SAM/dHYP-SAM Complex 2007-12-22 2008-02-26 Rajakulendran, T.,Sahmi, M.,Kurinov, I.,Tyers, M.,Therrien, M.,Sicheri, F. CNK and HYP form a discrete dimer by their SAM domains to mediate RAF kinase signaling. Proc.Natl.Acad.Sci.USA 2008 105 2836 2841 3C4N Crystal structure of DR_0571 protein from Deinococcus radiodurans in complex with ADP. Northeast Structural Genomics Consortium Target DrR125 2008-01-30 2008-02-26 Forouhar, F.,Chen, Y.,Seetharaman, J.,Mao, L.,Xiao, R.,Cunningham, K.,Owen, L.A.,Maglaqui, M.,Baran, M.C.,Acton, T.B.,Montelione, G.T.,Hunt, J.F.,Tong, L. Crystal structure of DR_0571 protein from Deinococcus radiodurans in complex with ADP. To be Published 0 0 0 0 3C5M Crystal structure of oligogalacturonate lyase (VPA0088) from Vibrio parahaemolyticus. Northeast Structural Genomics Consortium Target VpR199 2008-01-31 2008-02-26 Forouhar, F.,Abashidze, M.,Seetharaman, J.,Janjua, H.,Mao, L.,Xiao, R.,Owens, L.A.,Wang, D.,Baran, M.C.,Acton, T.B.,Montelione, G.T.,Hunt, J.F.,Tong, L. Crystal structure of oligogalacturonate lyase (VPA0088) from Vibrio parahaemolyticus. To be Published 0 0 0 0 2RG8 18296639 Crystal Structure of Programmed for Cell Death 4 Middle MA3 domain 2007-10-03 2008-03-04 Suzuki, C.,Garces, R.G.,Edmonds, K.A.,Hiller, S.,Hyberts, S.G.,Marintchev, A.,Wagner, G. PDCD4 inhibits translation initiation by binding to eIF4A using both its MA3 domains. Proc.Natl.Acad.Sci.Usa 2008 105 3274 3279 2RG8 18296639 Crystal Structure of Programmed for Cell Death 4 Middle MA3 domain 2007-10-03 2008-03-04 Suzuki, C.,Garces, R.G.,Edmonds, K.A.,Hiller, S.,Hyberts, S.G.,Marintchev, A.,Wagner, G. PDCD4 inhibits translation initiation by binding to eIF4A using both its MA3 domains. Proc.Natl.Acad.Sci.Usa 2008 105 3274 3279 3BJF 18337815 Pyruvate kinase M2 is a phosphotyrosine binding protein 2007-12-03 2008-03-04 Christofk, H.R.,Vander Heiden, M.G.,Wu, N.,Asara, J.M.,Cantley, L.C. Pyruvate kinase M2 is a phosphotyrosine-binding protein. Nature 2008 452 181 186 3BJT 18337815 Pyruvate kinase M2 is a phosphotyrosine binding protein 2007-12-04 2008-03-04 Christofk, H.R.,Vander Heiden, M.G.,Wu, N.,Asara, J.M.,Cantley, L.C. Pyruvate kinase M2 is a phosphotyrosine-binding protein. Nature 2008 452 181 186 3BN4 18292340 Carboxysome Subunit, CcmK1 2007-12-13 2008-03-04 Tanaka, S.,Kerfeld, C.A.,Sawaya, M.R.,Cai, F.,Heinhorst, S.,Cannon, G.C.,Yeates, T.O. Atomic-level models of the bacterial carboxysome shell. Science 2008 319 1083 1086 3C9R 18311927 AaThiL complexed with ATP 2008-02-18 2008-03-18 McCulloch, K.M.,Kinsland, C.,Begley, T.P.,Ealick, S.E. Structural studies of thiamin monophosphate kinase in complex with substrates and products. Biochemistry 2008 47 3810 3821 3C9S 18311927 AaThiL complexed with AMPPCP 2008-02-18 2008-03-18 McCulloch, K.M.,Kinsland, C.,Begley, T.P.,Ealick, S.E. Structural studies of thiamin monophosphate kinase in complex with substrates and products. Biochemistry 2008 47 3810 3821 3C9T 18311927 AaThiL complexed with AMPPCP and TMP 2008-02-18 2008-03-18 McCulloch, K.M.,Kinsland, C.,Begley, T.P.,Ealick, S.E. Structural studies of thiamin monophosphate kinase in complex with substrates and products. Biochemistry 2008 47 3810 3821 3C9U 18311927 AaThiL complexed with ADP and TPP 2008-02-18 2008-03-18 McCulloch, K.M.,Kinsland, C.,Begley, T.P.,Ealick, S.E. Structural studies of thiamin monophosphate kinase in complex with substrates and products. Biochemistry 2008 47 3810 3821 3BT2 18376415 Structure of urokinase receptor, urokinase and vitronectin complex 2007-12-27 2008-03-25 Huai, Q.,Zhou, A.,Lin, L.,Mazar, A.P.,Parry, G.C.,Callahan, J.,Shaw, D.E.,Furie, B.,Furie, B.C.,Huang, M. Crystal structures of two human vitronectin, urokinase and urokinase receptor complexes Nat.Struct.Mol.Biol. 2008 15 422 423 2QA4 17599351 A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit 2007-06-14 2008-04-01 Kavran, J.M.,Steitz, T.A. Structure of the base of the L7/L12 stalk of the Haloarcula marismortui large ribosomal subunit: Analysis of L11 movements J.Mol.Biol. 2007 371 1047 1059 3CDZ 18400180 Crystal structure of human factor VIII 2008-02-27 2008-04-01 Ngo, J.C.,Huang, M.,Roth, D.A.,Furie, B.C.,Furie, B. Crystal structure of human factor VIII: implications for the formation of the factor IXa-factor VIIIa complex. Structure 2008 16 597 606 3BWP 18388288 Crystal structure of a self-spliced group II intron 2008-01-10 2008-04-15 Toor, N.,Keating, K.S.,Taylor, S.D.,Pyle, A.M. Crystal structure of a self-spliced group II intron Science 2008 320 77 82 3CNQ 18507395 Prosubtilisin Substrate Complex of Subtilisin SUBT_BACAM 2008-03-26 2008-05-06 Ruan, B.,London, V.,Fisher, K.E.,Gallagher, D.T.,Bryan, P.N. Engineering substrate preference in subtilisin: structural and kinetic analysis of a specificity mutant. Biochemistry 2008 47 6628 6636 3CWV Crystal structure of B-subunit of the DNA gyrase from Myxococcus xanthus 2008-04-22 2008-05-06 Ramagopal, U.A.,Toro, R.,Meyer, A.J.,Burley, S.K.,Almo, S.C. Crystal structure of B-subunit of the DNA gyrase from Myxococcus xanthus. To be published 0 0 0 0 3CCU 18455733 Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C 2008-02-26 2008-05-20 Blaha, G.,Gurel, G.,Schroeder, S.J.,Moore, P.B.,Steitz, T.A. Mutations outside the anisomycin-binding site can make ribosomes drug-resistant. J.Mol.Biol. 2008 379 505 519 3CCV 18455733 Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A 2008-02-26 2008-05-20 Blaha, G.,Gurel, G.,Schroeder, S.J.,Moore, P.B.,Steitz, T.A. Mutations outside the anisomycin-binding site can make ribosomes drug-resistant. J.Mol.Biol. 2008 379 505 519 3CD6 18455733 Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin 2008-02-26 2008-05-20 Blaha, G.,Gurel, G.,Schroeder, S.J.,Moore, P.B.,Steitz, T.A. Mutations outside the anisomycin-binding site can make ribosomes drug-resistant. J.Mol.Biol. 2008 379 505 519 3CMT 18497818 Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures 2008-03-24 2008-05-20 Chen, Z.,Yang, H.,Pavletich, N.P. Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures. Nature 2008 453 489 494 3CMU 18497818 Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures 2008-03-24 2008-05-20 Chen, Z.,Yang, H.,Pavletich, N.P. Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures. Nature 2008 453 489 494 3CMV 18497818 Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures 2008-03-24 2008-05-20 Chen, Z.,Yang, H.,Pavletich, N.P. Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures. Nature 2008 453 489 494 3CMW 18497818 Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures 2008-03-24 2008-05-20 Chen, Z.,Yang, H.,Pavletich, N.P. Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures. Nature 2008 453 489 494 3CMX 18497818 Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures 2008-03-24 2008-05-20 Chen, Z.,Yang, H.,Pavletich, N.P. Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures. Nature 2008 453 489 494 2R6C 17947583 Crystal Form BH2 2007-09-05 2008-06-10 Bailey, S.,Eliason, W.K.,Steitz, T.A. Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase Science 2007 318 459 463 3CO3 18579768 X-Ray Crystal Structure of a Monofunctional Platinum-DNA Adduct, cis-{Pt(NH3)2(pyridine)}2+ Bound to Deoxyguanosine in a Dodecamer Duplex 2008-03-27 2008-06-10 Lovejoy, K.S.,Todd, R.C.,Zhang, S.,McCormick, M.S.,D'Aquino, J.A.,Reardon, J.T.,Sancar, A.,Giacomini, K.M.,Lippard, S.J. cis-Diammine(pyridine)chloroplatinum(II), a monofunctional platinum(II) antitumor agent: Uptake, structure, function, and prospects. Proc.Natl.Acad.Sci.Usa 2008 105 8902 8907 3CZB Crystal structure of putative transglycosylase from Caulobacter crescentus 2008-04-28 2008-06-10 Ramagopal, U.A.,Chattopadhyay, K.,Toro, R.,Wasserman, S.,Freeman, J.,Logan, C.,Bain, K.,Gheyi, T.,Sauder, J.M.,Burley, S.K.,Almo, S.C. Crystal structure of putative transglycosylase from Caulobacter crescentus. To be Published 0 0 0 0 3CQC 18570875 Nucleoporin Nup107/Nup133 interaction complex 2008-04-02 2008-07-01 Boehmer, T.,Jeudy, S.,Berke, I.C.,Schwartz, T.U. Structural and functional studies of Nup107/Nup133 interaction and its implications for the architecture of the nuclear pore complex. Mol.Cell 2008 30 721 731 3CQG 18570875 Nucleoporin Nup107/Nup133 interaction complex, delta finger mutant 2008-04-02 2008-07-01 Boehmer, T.,Jeudy, S.,Berke, I.C.,Schwartz, T.U. Structural and functional studies of Nup107/Nup133 interaction and its implications for the architecture of the nuclear pore complex. Mol.Cell 2008 30 721 731 3CUE 18585354 Crystal structure of a TRAPP subassembly activating the Rab Ypt1p 2008-04-16 2008-07-08 Cai, Y.,Chin, H.F.,Lazarova, D.,Menon, S.,Fu, C.,Cai, H.,Sclafani, A.,Rodgers, D.W.,De La Cruz, E.M.,Ferro-Novick, S.,Reinisch, K.M. The structural basis for activation of the Rab Ypt1p by the TRAPP membrane-tethering complexes. Cell(Cambridge,Mass.) 2008 133 1202 1213 3DCG 18562529 Crystal Structure of the HIV Vif BC-box in Complex with Human ElonginB and ElonginC 2008-06-03 2008-07-08 Stanley, B.J.,Ehrlich, E.S.,Short, L.,Yu, Y.,Xiao, Z.,Yu, X.-F.,Xiong, Y. Structural insight into the human immunodeficiency virus Vif SOCS box and its role in human E3 ubiquitin ligase assembly J.Virol. 2008 82 8656 8663 3DKB 18164316 Crystal Structure of A20, 2.5 angstrom 2008-06-24 2008-07-08 Lin, S.-C.,Chung, J.Y.,Lamothe, B.,Rajashankar, K.,Lu, M.,Lo, Y.-C.,Lam, A.Y.,Darnay, B.G.,Wu, H. Molecular basis for the unique deubiquitinating activity of the NF-kappaB inhibitor A20 J.Mol.Biol. 2008 376 526 540 3DBO 18952600 Crystal structure of a member of the VapBC family of toxin-antitoxin systems, VapBC-5, from Mycobacterium tuberculosis 2008-06-02 2008-07-15 Miallau, L.,Faller, M.,Chiang, J.,Arbing, M.,Guo, F.,Cascio, D.,Eisenberg, D. Structure and Proposed Activity of a Member of the VapBC Family of Toxin-Antitoxin Systems: VapBC-5 FROM MYCOBACTERIUM TUBERCULOSIS. J.Biol.Chem. 2009 284 276 283 3D3H 18642800 Crystal structure of a complex of the peptidoglycan glycosyltransferase domain from Aquifex aeolicus and neryl moenomycin A 2008-05-11 2008-07-22 Yuan, Y.,Fuse, S.,Ostash, B.,Sliz, P.,Kahne, D.,Walker, S. Structural analysis of the contacts anchoring moenomycin to peptidoglycan glycosyltransferases and implications for antibiotic design. Acs Chem.Biol. 2008 3 429 436 3D54 18597481 Structure of PurLQS from Thermotoga maritima 2008-05-15 2008-07-22 Morar, M.,Hoskins, A.A.,Stubbe, J.,Ealick, S.E. Formylglycinamide ribonucleotide amidotransferase from Thermotoga maritima: structural insights into complex formation. Biochemistry 2008 47 7816 7830 2R7S 19000820 Crystal Structure of Rotavirus SA11 VP1 / RNA (UGUGCC) complex 2007-09-10 2008-07-29 Lu, X.,McDonald, S.M.,Tortorici, M.A.,Tao, Y.J.,Vasquez-Del Carpio, R.,Nibert, M.L.,Patton, J.T.,Harrison, S.C. Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure 2008 16 1678 1688 2R7T 19000820 Crystal Structure of Rotavirus SA11 VP1/RNA (UGUGAACC) Complex 2007-09-10 2008-07-29 Lu, X.,McDonald, S.M.,Tortorici, M.A.,Tao, Y.J.,Vasquez-Del Carpio, R.,Nibert, M.L.,Patton, J.T.,Harrison, S.C. Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure 2008 16 1678 1688 2R7U 19000820 Crystal Structure of Rotavirus SA11 VP1/RNA (AAAAGCC) Complex 2007-09-10 2008-07-29 Lu, X.,McDonald, S.M.,Tortorici, M.A.,Tao, Y.J.,Vasquez-Del Carpio, R.,Nibert, M.L.,Patton, J.T.,Harrison, S.C. Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure 2008 16 1678 1688 2R7X 19000820 Crystal Structure of Rotavirus SA11 VP1/RNA (UGUGACC)/GTP complex 2007-09-10 2008-07-29 Lu, X.,McDonald, S.M.,Tortorici, M.A.,Tao, Y.J.,Vasquez-Del Carpio, R.,Nibert, M.L.,Patton, J.T.,Harrison, S.C. Mechanism for coordinated RNA packaging and genome replication by rotavirus polymerase VP1. Structure 2008 16 1678 1688 3DP7 CRYSTAL STRUCTURE OF SAM-dependent methyltransferase from Bacteroides vulgatus ATCC 8482 2008-07-07 2008-07-29 MALASHKEVICH, V.N.,TORO, R.,Ramagopal, U.,MEYER, A.J.,SAUDER, J.M.,BURLEY, S.K.,ALMO, S.C. CRYSTAL STRUCTURE OF SAM-dependent methyltransferase from Bacteroides vulgatus ATCC 8482 To be Published 0 0 0 0 3D11 18632560 Crystal Structures of the Nipah G Attachment Glycoprotein 2008-05-02 2008-08-19 Xu, K.,Rajashankar, K.R.,Chan, Y.P.,Himanen, J.P.,Broder, C.C.,Nikolov, D.B. Host cell recognition by the henipaviruses: crystal structures of the Nipah G attachment glycoprotein and its complex with ephrin-B3. Proc.Natl.Acad.Sci.USA 2008 105 9953 9958 3D12 18632560 Crystal Structures of Nipah Virus G Attachment Glycoprotein in Complex with its Receptor Ephrin-B3 2008-05-02 2008-08-19 Xu, K.,Rajashankar, K.R.,Chan, Y.P.,Himanen, J.P.,Broder, C.C.,Nikolov, D.B. Host cell recognition by the henipaviruses: crystal structures of the Nipah G attachment glycoprotein and its complex with ephrin-B3. Proc.Natl.Acad.Sci.USA 2008 105 9953 9958 3E5B 2.4 A crystal structure of isocitrate lyase from brucella melitensis 2008-08-13 2008-08-26 Seattle Structural Genomics Center for Infectious Disease (SSGCID) 2.4 A crystal structure of isocitrate lyase from brucella melitensis To be Published 0 0 0 0 3CVS 18682218 Crystal Structure of an AlkA Host/Guest Complex 8oxoGuanine:Adenine Base Pair 2008-04-19 2008-09-02 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of the E. coli DNA Glycosylase AlkA Bound to the Ends of Duplex DNA: A System for the Structure Determination of Lesion-Containing DNA. Structure 2008 16 1166 1174 3CVT 18682218 Crystal Structure of an AlkA Host/Guest Complex 8oxoGuanine:Cytosine Base Pair 2008-04-19 2008-09-02 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of the E. coli DNA Glycosylase AlkA Bound to the Ends of Duplex DNA: A System for the Structure Determination of Lesion-Containing DNA. Structure 2008 16 1166 1174 3CW7 18682218 Crystal Structure of an AlkA Host/Guest Complex 8oxoGuanine:Cytosine Base Pair 2008-04-21 2008-09-02 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of the E. coli DNA Glycosylase AlkA Bound to the Ends of Duplex DNA: A System for the Structure Determination of Lesion-Containing DNA. Structure 2008 16 1166 1174 3CWA 18682218 Crystal Structure of an AlkA Host/Guest Complex 8oxoGuanine:Cytosine Base Pair 2008-04-21 2008-09-02 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of the E. coli DNA Glycosylase AlkA Bound to the Ends of Duplex DNA: A System for the Structure Determination of Lesion-Containing DNA. Structure 2008 16 1166 1174 3CWU 18682218 Crystal Structure of an AlkA Host/Guest Complex 2'-fluoro-2'-deoxy-1,N6-ethenoadenine:Thymine Base Pair 2008-04-22 2008-09-02 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of the E. coli DNA Glycosylase AlkA Bound to the Ends of Duplex DNA: A System for the Structure Determination of Lesion-Containing DNA. Structure 2008 16 1166 1174 3DLB 18754009 Crystal structure of the guide-strand-containing Argonaute protein silencing complex 2008-06-26 2008-09-02 Wang, Y.,Sheng, G.,Juranek, S.,Tuschl, T.,Patel, D.J. Structure of the guide-strand-containing argonaute silencing complex. Nature 2008 456 209 213 3DLH 18754009 Crystal structure of the guide-strand-containing Argonaute protein silencing complex 2008-06-27 2008-09-02 Wang, Y.,Sheng, G.,Juranek, S.,Tuschl, T.,Patel, D.J. Structure of the guide-strand-containing argonaute silencing complex. Nature 2008 456 209 213 3D4V 18686953 Crystal Structure of an AlkA Host/Guest Complex N7MethylGuanine:Cytosine Base Pair 2008-05-15 2008-09-09 Lee, S.,Bowman, B.R.,Ueno, Y.,Wang, S.,Verdine, G.L. Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine. J.Am.Chem.Soc. 2008 130 11570 11571 3DTN Crystal structure of putative Methyltransferase-MM_2633 from Methanosarcina mazei . 2008-07-15 2008-09-09 Ramagopal, U.A.,Toro, R.,Meyer, A.J.,Burley, S.K.,Almo, S.C. Crystal structure of putative Methyltransferase-MM_2633 from Methanosarcina mazei To be published 0 0 0 0 3B8J Q191A mutant of DegS-deltaPDZ 2007-11-01 2008-09-16 Sohn, J.,Grant, R.A.,Sauer, R.T. biochemical characterization of DegS-deltaPDZ q191A mutant To be Published 0 0 0 0 3DIG 18784651 CRYSTAL STRUCTURE OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH BOUND TO S-(2-aminoethyl)-L-cysteine 2008-06-20 2008-09-16 Serganov, A.,Huang, L.,Patel, D.J. Structural insights into amino acid binding and gene control by a lysine riboswitch. Nature 2008 455 1263 1267 3DIM 18784651 Crystallization of the Thermotoga maritima lysine riboswitch bound to lysine, Cs+ Soak 2008-06-20 2008-09-16 Serganov, A.,Huang, L.,Patel, D.J. Structural insights into amino acid binding and gene control by a lysine riboswitch. Nature 2008 455 1263 1267 3DIX 18784651 Crystallization of the Thermotoga maritima lysine riboswitch bound to lysine, K+ anomalous data 2008-06-21 2008-09-16 Serganov, A.,Huang, L.,Patel, D.J. Structural insights into amino acid binding and gene control by a lysine riboswitch. Nature 2008 455 1263 1267 3DIY 18784651 Crystallization of the Thermotoga maritima lysine riboswitch bound to lysine, Mn2+ soak 2008-06-21 2008-09-16 Serganov, A.,Huang, L.,Patel, D.J. Structural insights into amino acid binding and gene control by a lysine riboswitch. Nature 2008 455 1263 1267 3DJ0 18784651 Crystallization of the Thermotoga maritima lysine riboswitch bound to L-4-oxalysine 2008-06-21 2008-09-16 Serganov, A.,Huang, L.,Patel, D.J. Structural insights into amino acid binding and gene control by a lysine riboswitch. Nature 2008 455 1263 1267 3DYU 18940612 Crystal structure of Snx9PX-BAR (230-595), H32 2008-07-28 2008-09-16 Wang, Q.,Kaan, H.Y.,Hooda, R.N.,Goh, S.L.,Sondermann, H. Structure and plasticity of endophilin and sorting nexin 9. Structure 2008 16 1574 1587 3EAY 18799455 Crystal structure of the human SENP7 catalytic domain 2008-08-26 2008-09-16 Lima, C.D.,Reverter, D. Structure of the Human SENP7 Catalytic Domain and Poly-SUMO Deconjugation Activities for SENP6 and SENP7. J.Biol.Chem. 2008 283 32045 32055 3CMA 18818369 The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui 2008-03-21 2008-09-23 Simonovic, M.,Steitz, T.A. Peptidyl-CCA deacylation on the ribosome promoted by induced fit and the O3'-hydroxyl group of A76 of the unacylated A-site tRNA. Rna 2008 14 2372 2378 3CME 18818369 The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui 2008-03-21 2008-09-23 Simonovic, M.,Steitz, T.A. Peptidyl-CCA deacylation on the ribosome promoted by induced fit and the O3'-hydroxyl group of A76 of the unacylated A-site tRNA. Rna 2008 14 2372 2378 3DWG 18771296 Crystal structure of a sulfur carrier protein complex found in the cysteine biosynthetic pathway of Mycobacterium tuberculosis 2008-07-22 2008-09-23 Jurgenson, C.T.,Burns, K.E.,Begley, T.P.,Ealick, S.E. Crystal structure of a sulfur carrier protein complex found in the cysteine biosynthetic pathway of Mycobacterium tuberculosis. Biochemistry 2008 47 10354 10364 3DWI 18771296 Crystal structure of Mycobacterium tuberculosis CysM, the cysteine synthase B 2008-07-22 2008-09-23 Jurgenson, C.T.,Burns, K.E.,Begley, T.P.,Ealick, S.E. Crystal structure of a sulfur carrier protein complex found in the cysteine biosynthetic pathway of Mycobacterium tuberculosis. Biochemistry 2008 47 10354 10364 3E0D 18691598 Insights into the Replisome from the Crystral Structure of the Ternary Complex of the Eubacterial DNA Polymerase III alpha-subunit 2008-07-31 2008-09-23 Wing, R.A.,Bailey, S.,Steitz, T.A. Insights into the Replisome from the Structure of a Ternary Complex of the DNA Polymerase III alpha-Subunit. J.Mol.Biol. 2008 382 859 869 2R9E The structure of the binary complex of citryl dethia COA and citrate synthase from the thermophilic archaeonthermoplasma acidophilum 2007-09-12 2008-09-30 Lehmann, C.,Kurz, L.C.,Ellenberger, T.E. Snapshots of Intermediates in the Condensation Reaction Catalyzed by Citrate Synthase To be Published 0 0 0 0 3D4B 18786399 Crystal structure of Sir2Tm in complex with Acetyl p53 peptide and DADMe-NAD+ 2008-05-14 2008-09-30 Hawse, W.F.,Hoff, K.G.,Fatkins, D.G.,Daines, A.,Zubkova, O.V.,Schramm, V.L.,Zheng, W.,Wolberger, C. Structural insights into intermediate steps in the Sir2 deacetylation reaction. Structure 2008 16 1368 1377 3EB8 18763811 VirA 2008-08-27 2008-09-30 Germane, K.L.,Ohi, R.,Goldberg, M.B.,Spiller, B.W. Structural and functional studies indicate that Shigella VirA is not a protease and does not directly destabilize microtubules. Biochemistry 2008 47 10241 10243 3DIN 18923516 Crystal structure of the protein-translocation complex formed by the SecY channel and the SecA ATPase 2008-06-20 2008-10-07 Zimmer, J.,Nam, Y.,Rapoport, T.A. Structure of a complex of the ATPase SecA and the protein-translocation channel. Nature 2008 455 936 943 3EOL 2.0A crystal structure of isocitrate lyase from Brucella melitensis (P43212) 2008-09-28 2008-10-21 SSGCID Crystal structures of isocitrate lyase from Brucella melitensis To be Published 0 0 0 0 3ENH 18951093 Crystal structure of Cgi121/Bud32/Kae1 complex 2008-09-25 2008-10-28 Mao, D.Y.L.,Neculai, D.,Downey, M.,Orlicky, S.,Haffani, Y.Z.,Ceccarelli, D.F.,Ho, J.S.L.,Szilard, R.K.,Zhang, W.,Ho, C.S.,Wan, L.,Fares, C.,Rumpel, S.,Kurinov, I.,Arrowsmith, C.H.,Durocher, D.,Sicheri, F. Atomic Structure of the KEOPS Complex: An Ancient Protein Kinase-Containing Molecular Machine Mol.Cell 2008 32 259 275 3EOG 18953333 Co-crystallization showing exon recognition by a group II intron 2008-09-26 2008-10-28 Toor, N.,Rajashankar, K.,Keating, K.S.,Pyle, A.M. Structural basis for exon recognition by a group II intron. Nat.Struct.Mol.Biol. 2008 15 1221 1222 3EOH 18953333 Refined group II intron structure 2008-09-26 2008-10-28 Toor, N.,Rajashankar, K.,Keating, K.S.,Pyle, A.M. Structural basis for exon recognition by a group II intron. Nat.Struct.Mol.Biol. 2008 15 1221 1222 3EPM 18953358 Crystal structure of Caulobacter crescentus ThiC 2008-09-29 2008-10-28 Chatterjee, A.,Li, Y.,Zhang, Y.,Grove, T.L.,Lee, M.,Krebs, C.,Booker, S.J.,Begley, T.P.,Ealick, S.E. Reconstitution of ThiC in thiamine pyrimidine biosynthesis expands the radical SAM superfamily Nat.Chem.Biol. 2008 4 758 765 3EPN 18953358 Crystal structure of Caulobacter crescentus ThiC complexed with imidazole ribonucleotide 2008-09-29 2008-10-28 Chatterjee, A.,Li, Y.,Zhang, Y.,Grove, T.L.,Lee, M.,Krebs, C.,Booker, S.J.,Begley, T.P.,Ealick, S.E. Reconstitution of ThiC in thiamine pyrimidine biosynthesis expands the radical SAM superfamily Nat.Chem.Biol. 2008 4 758 765 3E2E 18948533 Crystal Structure of an Intermediate Complex of T7 RNAP and 7nt of RNA 2008-08-05 2008-11-04 Durniak, K.J.,Bailey, S.,Steitz, T.A. The structure of a transcribing t7 RNA polymerase in transition from initiation to elongation Science 2008 322 553 557 3E3J 18948533 Crystal Structure of an Intermediate Complex of T7 RNAP and 8nt of RNA 2008-08-07 2008-11-04 Durniak, K.J.,Bailey, S.,Steitz, T.A. The structure of a transcribing t7 RNA polymerase in transition from initiation to elongation Science 2008 322 553 557 3EN9 18951093 Structure of the Methanococcus jannaschii KAE1-BUD32 fusion protein 2008-09-25 2008-11-04 Mao, D.Y.,Neculai, D.,Downey, M.,Orlicky, S.,Haffani, Y.Z.,Ceccarelli, D.F.,Ho, J.S.,Szilard, R.K.,Zhang, W.,Ho, C.S.,Wan, L.,Fares, C.,Rumpel, S.,Kurinov, I.,Arrowsmith, C.H.,Durocher, D.,Sicheri, F. Atomic structure of the KEOPS complex: an ancient protein kinase-containing molecular machine. Mol.Cell 2008 32 259 275 3EWE 18974315 Crystal Structure of the Nup85/Seh1 Complex 2008-10-14 2008-11-11 Brohawn, S.G.,Leksa, N.C.,Spear, E.D.,Rajashankar, K.R.,Schwartz, T.U. Structural evidence for common ancestry of the nuclear pore complex and vesicle coats. Science 2008 322 1369 1373 3DNJ 18995838 The structure of the Caulobacter crescentus ClpS protease adaptor protein in complex with a N-end rule peptide 2008-07-02 2008-11-18 Wang, K.H.,Roman-Hernandez, G.,Grant, R.A.,Sauer, R.T.,Baker, T.A. The molecular basis of N-end rule recognition. Mol.Cell 2008 32 406 414 3EUD 19019820 Structure of the CS domain of the essential H/ACA RNP assembly protein Shq1p 2008-10-09 2008-11-18 Singh, M.,Gonzales, F.A.,Cascio, D.,Heckmann, N.,Chanfreau, G.,Feigon, J. Structure and Functional Studies of the CS Domain of the Essential H/ACA Ribonucleoparticle Assembly Protein SHQ1. J.Biol.Chem. 2009 284 1906 1916 3D2N 19043415 Crystal structure of MBNL1 tandem zinc finger 1 and 2 domain 2008-05-08 2008-12-02 Teplova, M.,Patel, D.J. Structural insights into RNA recognition by the alternative-splicing regulator muscleblind-like MBNL1. Nat.Struct.Mol.Biol. 2008 15 1343 1351 3D2Q 19043415 Crystal structure of MBNL1 tandem zinc finger 3 and 4 domain 2008-05-08 2008-12-02 Teplova, M.,Patel, D.J. Structural insights into RNA recognition by the alternative-splicing regulator muscleblind-like MBNL1. Nat.Struct.Mol.Biol. 2008 15 1343 1351 3D2S 19043415 Crystal structure of MBNL1 tandem zinc finger 3 and 4 domain in complex with CGCUGU RNA 2008-05-08 2008-12-02 Teplova, M.,Patel, D.J. Structural insights into RNA recognition by the alternative-splicing regulator muscleblind-like MBNL1. Nat.Struct.Mol.Biol. 2008 15 1343 1351 3DL8 18923516 Structure of the complex of aquifex aeolicus SecYEG and bacillus subtilis SecA 2008-06-26 2008-12-02 Zimmer, J.,Nam, Y.,Rapoport, T.A. Structure of a complex of the ATPase SecA and the protein-translocation channel. Nature 2008 455 936 943 3EF0 19026779 The Structure of Fcp1, an essential RNA polymerase II CTD phosphatase 2008-09-07 2008-12-02 Ghosh, A.,Shuman, S.,Lima, C.D. The structure of Fcp1, an essential RNA polymerase II CTD phosphatase. Mol.Cell 2008 32 478 490 3EF1 19026779 The Structure of Fcp1, an essential RNA polymerase II CTD phosphatase 2008-09-07 2008-12-02 Ghosh, A.,Shuman, S.,Lima, C.D. The structure of Fcp1, an essential RNA polymerase II CTD phosphatase. Mol.Cell 2008 32 478 490 3EP6 19053272 Human AdoMetDC D174N mutant complexed with S-Adenosylmethionine methyl ester and no putrescine bound 2008-09-29 2008-12-23 Bale, S.,Lopez, M.M.,Makhatadze, G.I.,Fang, Q.,Pegg, A.E.,Ealick, S.E. Structural Basis for Putrescine Activation of Human S-Adenosylmethionine Decarboxylase. Biochemistry 2008 47 13404 13417 3EP7 19053272 Human AdoMetDC E256Q mutant complexed with S-Adenosylmethionine methyl ester and no putrescine bound 2008-09-29 2008-12-23 Bale, S.,Lopez, M.M.,Makhatadze, G.I.,Fang, Q.,Pegg, A.E.,Ealick, S.E. Structural Basis for Putrescine Activation of Human S-Adenosylmethionine Decarboxylase. Biochemistry 2008 47 13404 13417 3EP8 19053272 Human AdoMetDC E178Q mutant complexed with S-Adenosylmethionine methyl ester and no putrescine bound 2008-09-29 2008-12-23 Bale, S.,Lopez, M.M.,Makhatadze, G.I.,Fang, Q.,Pegg, A.E.,Ealick, S.E. Structural Basis for Putrescine Activation of Human S-Adenosylmethionine Decarboxylase. Biochemistry 2008 47 13404 13417 3ETO 19075186 2 Angstrom Xray structure of the NOTCH1 Negative Regulatory Region (NRR) 2008-10-08 2008-12-23 Gordon, W.R.,Roy, M.,Vardar-Ulu, D.,Garfinkel, M.,Mansour, M.R.,Aster, J.C.,Blacklow, S.C. Structure of the Notch1-negative regulatory region: implications for normal activation and pathogenic signaling in T-ALL. Blood 2009 113 4381 4390 3EW8 19053282 Crystal Structure Analysis of human HDAC8 D101L variant 2008-10-14 2008-12-30 Dowling, D.P.,Gantt, S.L.,Gattis, S.G.,Fierke, C.A.,Christianson, D.W. Structural studies of human histone deacetylase 8 and its site-specific variants complexed with substrate and inhibitors. Biochemistry 2008 47 13554 13563 3EWF 19053282 Crystal Structure Analysis of human HDAC8 H143A variant complexed with substrate. 2008-10-14 2008-12-30 Dowling, D.P.,Gantt, S.L.,Gattis, S.G.,Fierke, C.A.,Christianson, D.W. Structural studies of human histone deacetylase 8 and its site-specific variants complexed with substrate and inhibitors. Biochemistry 2008 47 13554 13563 3F06 19053282 Crystal Structure Analysis of Human HDAC8 D101A Variant. 2008-10-24 2008-12-30 Dowling, D.P.,Gantt, S.L.,Gattis, S.G.,Fierke, C.A.,Christianson, D.W. Structural studies of human histone deacetylase 8 and its site-specific variants complexed with substrate and inhibitors. Biochemistry 2008 47 13554 13563 3FEF Crystal structure of putative glucosidase lplD from bacillus subtilis 2008-11-28 2008-12-30 Ramagopal, U.A.,Rajashankar, K.R.,Toro, R.,Burley, S.K.,Almo, S.C. Crystal structure of putative glucosidase lplD from bacillus subtilis. To be published 0 0 0 0 3D36 19101565 How to Switch Off a Histidine Kinase: Crystal Structure of Geobacillus stearothermophilus KinB with the Inhibitor Sda 2008-05-09 2009-01-13 Bick, M.J.,Lamour, V.,Rajashankar, K.R.,Gordiyenko, Y.,Robinson, C.V.,Darst, S.A. How to switch off a histidine kinase: crystal structure of Geobacillus stearothermophilus KinB with the inhibitor Sda J.Mol.Biol. 2009 386 163 177 3F8U 19119025 Tapasin/ERp57 heterodimer 2008-11-13 2009-01-13 Dong, G.,Wearsch, P.A.,Peaper, D.R.,Cresswell, P.,Reinisch, K.M. Insights into MHC class I peptide loading from the structure of the tapasin-ERp57 thiol oxidoreductase heterodimer. Immunity 2009 30 21 32 3F2T 19169240 Crystal structure of the FMN riboswitch bound to FMN, iridium hexamine soak. 2008-10-30 2009-01-27 Serganov, A.,Huang, L.,Patel, D.J. Coenzyme recognition and gene regulation by a flavin mononucleotide riboswitch. Nature 2009 458 233 237 3F2T 19169240 Crystal structure of the FMN riboswitch bound to FMN, iridium hexamine soak. 2008-10-30 2009-01-27 Serganov, A.,Huang, L.,Patel, D.J. Coenzyme recognition and gene regulation by a flavin mononucleotide riboswitch. Nature 2009 458 233 237 3F2T 19169240 Crystal structure of the FMN riboswitch bound to FMN, iridium hexamine soak. 2008-10-30 2009-01-27 Serganov, A.,Huang, L.,Patel, D.J. Coenzyme recognition and gene regulation by a flavin mononucleotide riboswitch. Nature 2009 458 233 237 3F2X 19169240 Crystal structure of the FMN riboswitch bound to FMN, Cs+ soak. 2008-10-30 2009-01-27 Serganov, A.,Huang, L.,Patel, D.J. Coenzyme recognition and gene regulation by a flavin mononucleotide riboswitch. Nature 2009 458 233 237 3FNR CRYSTAL STRUCTURE OF PUTATIVE ARGINYL T-RNA SYNTHETASE FROM Campylobacter jejuni; 2008-12-26 2009-01-27 Patskovsky, Y.,Ramagopal, U.,Toro, R.,Gilmore, M.,Chang, S.,Groshong, C.,Sauder, J.M.,Burley, S.K.,Almo, S.C. CRYSTAL STRUCTURE OF A PUTATIVE ARGINYL T-RNA SYNTHETASE FROM Campylobacter jejuni To be Published 0 0 0 0 3D0S cAMP receptor protein from m.tuberculosis, cAMP-free form 2008-05-02 2009-02-03 Gallagher, D.T.,Robinson, H.,Smith, N.,Reddy, P.T. Crystal structure of cAMP receptor protein from M. tuberculosis in the unliganded form To be Published 0 0 0 0 3E2Q 19140736 Crystal Structure Reduced PutA86-630 Mutant Y540S Complexed with trans-4-hydroxy-L-proline 2008-08-06 2009-02-03 Ostrander, E.L.,Larson, J.D.,Schuermann, J.P.,Tanner, J.J. A conserved active site tyrosine residue of proline dehydrogenase helps enforce the preference for proline over hydroxyproline as the substrate. Biochemistry 2009 48 951 959 3E2R 19140736 Crystal Structure PutA86-630 Mutant Y540S Complexed with L-tetrahydro-2-furoic acid 2008-08-06 2009-02-03 Ostrander, E.L.,Larson, J.D.,Schuermann, J.P.,Tanner, J.J. A conserved active site tyrosine residue of proline dehydrogenase helps enforce the preference for proline over hydroxyproline as the substrate. Biochemistry 2009 48 951 959 3C5L 19597481 Polo-like kinase 1 Polo box domain in complex with PPHSpT peptide 2008-01-31 2009-02-17 Yun, S.M.,Moulaei, T.,Lim, D.,Bang, J.K.,Park, J.E.,Shenoy, S.R.,Liu, F.,Kang, Y.H.,Liao, C.,Soung, N.K.,Lee, S.,Yoon, D.Y.,Lim, Y.,Lee, D.H.,Otaka, A.,Appella, E.,McMahon, J.B.,Nicklaus, M.C.,Burke, T.R.,Yaffe, M.B.,Wlodawer, A.,Lee, K.S. Structural and functional analyses of minimal phosphopeptides targeting the polo-box domain of polo-like kinase 1. Nat.Struct.Mol.Biol. 2009 16 876 882 3G56 19265703 Structure of the macrolide biosensor protein, MphR(A) 2009-02-04 2009-03-03 Zheng, J.,Sagar, V.,Smolinsky, A.,Bourke, C.,LaRonde-LeBlanc, N.,Cropp, T.A. Structure and function of the macrolide biosensor protein, MphR(A), with and without erythromycin J.Mol.Biol. 2009 387 1250 1260 3CFO Triple Mutant APO structure 2008-03-04 2009-03-10 Klimenko, D.,Wang, M.,Steitz, T.A.,Konigsberg, W.H.,Wang, J. Insights into base selectivity from the structures of an RB69 DNA Polymerase triple mutant To be Published 0 0 0 0 3CFP Structure of the replicating complex of a POL Alpha family DNA Polymerase, ternary complex 1 2008-03-04 2009-03-10 Klimenko, D.,Wang, M.,Steitz, T.A.,Konigsberg, W.H.,Wang, J. Insights into base selectivity from the structures of an RB69 DNA Polymerase triple mutant To be Published 0 0 0 0 3DLA 19270703 X-ray crystal structure of glutamine-dependent NAD+ synthetase from Mycobacterium tuberculosis bound to NaAD+ and DON 2008-06-26 2009-03-10 LaRonde-LeBlanc, N.,Resto, M.,Gerratana, B. Regulation of active site coupling in glutamine-dependent NAD(+) synthetase. Nat.Struct.Mol.Biol. 2009 16 421 429 3DZ7 19209891 Human AdoMetDC with 5'-[(carboxamidomethyl)methylamino]-5'-deoxy-8-methyladenosine 2008-07-29 2009-03-10 McCloskey, D.E.,Bale, S.,Secrist III, J.A.,Tiwari, A.,Moss III, T.H.,Valiyaveettil, J.,Brooks, W.H.,Guida, W.C.,Pegg, A.E.,Ealick, S.E. New Insights into the Design of Inhibitors of Human S-Adenosylmethionine Decarboxylase: Studies of Adenine C8 Substitution in Structural Analogues of S-Adenosylmethionine J.Med.Chem. 2009 52 1388 1407 3FPN 19287003 Crystal structure of UvrA-UvrB interaction domains 2009-01-05 2009-03-24 Pakotiprapha, D.,Liu, Y.,Verdine, G.L.,Jeruzalmi, D. A Structural Model for the Damage-sensing Complex in Bacterial Nucleotide Excision Repair. J.Biol.Chem. 2009 284 12837 12844 3FRQ 19265703 Structure of the macrolide biosensor protein, MphR(A), with erythromcyin 2009-01-08 2009-03-24 Zheng, J.,Sagar, V.,Smolinsky, A.,Bourke, C.,LaRonde-LeBlanc, N.,Cropp, T.A. Structure and function of the macrolide biosensor protein, MphR(A), with and without erythromycin J.Mol.Biol. 2009 387 1250 1260 3GDO Crystal structure of putative oxidoreductase yvaA from Bacillus subtilis 2009-02-24 2009-03-24 Ramagopal, U.A.,Toro, R.,Burley, S.K.,Almo, S.C. Structure of putative oxidoreductase yvaA from Bacillus subtilis. To be Published 0 0 0 0 3GFG Structure of putative oxidoreductase yvaA from Bacillus subtilis in triclinic form 2009-02-26 2009-03-24 Ramagopal, U.A.,Toro, R.,Gilmore, M.,Chang, S.,Burley, S.K.,Almo, S.C. Crystal structure of putative oxidoreductase yvaA from Bacillus subtilis in triclinic form. To be published 0 0 0 0 3GNQ Crystal structure of glyceraldehyde-3-phosphate dehydrogenase, type I from Burkholderia pseudomallei 2009-03-17 2009-03-24 Edwards, T.E. Crystal structure of glyceraldehyde-3-phosphate dehydrogenase, type I from Burkholderia pseudomallei TO BE PUBLISHED 0 0 0 0 3CH8 19646997 The crystal structure of PDZ-Fibronectin fusion protein 2008-03-08 2009-03-31 Huang, J.,Makabe, K.,Biancalana, M.,Koide, A.,Koide, S. Structural basis for exquisite specificity of affinity clamps, synthetic binding proteins generated through directed domain-interface evolution. J.Mol.Biol. 2009 392 1221 1231 3GDU 19836340 Crystal structure of DegS H198P/D320A mutant modified by DFP and in complex with YRF peptide 2009-02-24 2009-03-31 Sohn, J.,Grant, R.A.,Sauer, R.T. OMP peptides activate the DegS stress-sensor protease by a relief of inhibition mechanism. Structure 2009 17 1411 1421 3GDV 19836340 Crystal structure of DegS H198P/D320A mutant modified by DFP and in complex with YQF peptide 2009-02-24 2009-03-31 Sohn, J.,Grant, R.A.,Sauer, R.T. OMP peptides activate the DegS stress-sensor protease by a relief of inhibition mechanism. Structure 2009 17 1411 1421 3FX0 19185524 Crystal structure of Human NEMO CC2_LZ domain 2009-01-19 2009-04-07 Lo, Y.C.,Lin, S.C.,Rospigliosi, C.C.,Conze, D.B.,Wu, C.J.,Ashwell, J.D.,Eliezer, D.,Wu, H. Structural basis for recognition of diubiquitins by NEMO. Mol.Cell 2009 33 602 615 3G5K 19236878 Structure and activity of human mitochondrial peptide deformylase, a novel cancer target 2009-02-05 2009-04-07 Escobar-Alvarez, S.,Goldgur, Y.,Yang, G.,Ouerfelli, O.,Li, Y.,Scheinberg, D.A. Structure and activity of human mitochondrial peptide deformylase, a novel cancer target J.Mol.Biol. 2009 387 1211 1228 3G5P 19236878 Structure and activity of human mitochondrial peptide deformylase, a novel cancer target 2009-02-05 2009-04-07 Escobar-Alvarez, S.,Goldgur, Y.,Yang, G.,Ouerfelli, O.,Li, Y.,Scheinberg, D.A. Structure and activity of human mitochondrial peptide deformylase, a novel cancer target J.Mol.Biol. 2009 387 1211 1228 3G5O 23523424 The crystal structure of the toxin-antitoxin complex RelBE2 (Rv2865-2866) from Mycobacterium tuberculosis 2009-02-05 2009-04-14 Miallau, L.,Jain, P.,Arbing, M.A.,Cascio, D.,Phan, T.,Ahn, C.J.,Chan, S.,Chernishof, I.,Maxson, M.,Chiang, J.,Jacobs Jr., W.R.,Eisenberg, D.S. Comparative proteomics identifies the cell-associated lethality of M. tuberculosis RelBE-like toxin-antitoxin complexes. Structure 2013 21 627 637 3GB9 19388075 Human purine nucleoside phosphorylase double mutant E201Q,N243D complexed with 2-fluoroadenine 2009-02-19 2009-04-14 Afshar, S.,Sawaya, M.R.,Morrison, S.L. Structure of a mutant human purine nucleoside phosphorylase with the prodrug, 2-fluoro-2'-deoxyadenosine and the cytotoxic drug, 2-fluoroadenine. Protein Sci. 2009 18 1107 1114 3GGS 19388075 Human purine nucleoside phosphorylase double mutant E201Q,N243D complexed with 2-fluoro-2'-deoxyadenosine 2009-03-02 2009-04-14 Afshar, S.,Sawaya, M.R.,Morrison, S.L. Structure of a mutant human purine nucleoside phosphorylase with the prodrug, 2-fluoro-2'-deoxyadenosine and the cytotoxic drug, 2-fluoroadenine. Protein Sci. 2009 18 1107 1114 3GMC 19317437 Crystal Structure of 2-Methyl-3-hydroxypyridine-5-carboxylic acid Oxygenase with substrate bound 2009-03-13 2009-04-14 McCulloch, K.M.,Mukherjee, T.,Begley, T.P.,Ealick, S.E. Structure of the PLP degradative enzyme 2-methyl-3-hydroxypyridine-5-carboxylic acid oxygenase from Mesorhizobium loti MAFF303099 and its mechanistic implications. Biochemistry 2009 48 4139 4149 3G7T 19244332 Crystal structure of dengue virus type 1 envelope protein in the postfusion conformation 2009-02-10 2009-04-21 Nayak, V.,Dessau, M.,Kucera, K.,Anthony, K.,Ledizet, M.,Modis, Y. Crystal structure of dengue virus type 1 envelope protein in the postfusion conformation and its implications for membrane fusion. J.Virol. 2009 83 4338 4344 3G4S 19362093 Co-crystal structure of Tiamulin bound to the large ribosomal subunit 2009-02-04 2009-04-28 Gurel, G.,Blaha, G.,Moore, P.B.,Steitz, T.A. U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome. J.Mol.Biol. 2009 389 146 156 3G6E 19362093 Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit 2009-02-06 2009-04-28 Gurel, G.,Blaha, G.,Moore, P.B.,Steitz, T.A. U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome. J.Mol.Biol. 2009 389 146 156 3G71 19362093 Co-crystal structure of Bruceantin bound to the large ribosomal subunit 2009-02-09 2009-04-28 Gurel, G.,Blaha, G.,Moore, P.B.,Steitz, T.A. U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome. J.Mol.Biol. 2009 389 146 156 3GNA 19396172 Crystal structure of the RAG1 nonamer-binding domain with DNA 2009-03-16 2009-04-28 Yin, F.F.,Bailey, S.,Innis, C.A.,Ciubotaru, M.,Kamtekar, S.,Steitz, T.A.,Schatz, D.G. Structure of the RAG1 nonamer binding domain with DNA reveals a dimer that mediates DNA synapsis. Nat.Struct.Mol.Biol. 2009 16 499 508 3GNB 19396172 Crystal structure of the RAG1 nonamer-binding domain with DNA 2009-03-16 2009-04-28 Yin, F.F.,Bailey, S.,Innis, C.A.,Ciubotaru, M.,Kamtekar, S.,Steitz, T.A.,Schatz, D.G. Structure of the RAG1 nonamer binding domain with DNA reveals a dimer that mediates DNA synapsis. Nat.Struct.Mol.Biol. 2009 16 499 508 3CZ3 Crystal structure of Tomato Aspermy Virus 2b in complex with siRNA 2008-04-27 2009-05-05 Ma, J.B.,Li, F.,Ding, S.W.,Patel, D.J. Structural Basis for siRNA Recognition by 2b, a Viral Suppressor of Non-Cell Autonomous RNA Silencing To be Published 0 0 0 0 3CZ3 Crystal structure of Tomato Aspermy Virus 2b in complex with siRNA 2008-04-27 2009-05-05 Ma, J.B.,Li, F.,Ding, S.W.,Patel, D.J. Structural Basis for siRNA Recognition by 2b, a Viral Suppressor of Non-Cell Autonomous RNA Silencing To be Published 0 0 0 0 3GL6 19430464 Crystal structure of JARID1A-PHD3 complexed with H3(1-9)K4me3 peptide 2009-03-11 2009-05-05 Wang, G.G.,Song, J.,Wang, Z.,Dormann, H.L.,Casadio, F.,Li, H.,Luo, J.L.,Patel, D.J.,Allis, C.D. Haematopoietic malignancies caused by dysregulation of a chromatin-binding PHD finger. Nature 2009 459 847 851 3GL6 19430464 Crystal structure of JARID1A-PHD3 complexed with H3(1-9)K4me3 peptide 2009-03-11 2009-05-05 Wang, G.G.,Song, J.,Wang, Z.,Dormann, H.L.,Casadio, F.,Li, H.,Luo, J.L.,Patel, D.J.,Allis, C.D. Haematopoietic malignancies caused by dysregulation of a chromatin-binding PHD finger. Nature 2009 459 847 851 3H87 23011806 Rv0301 Rv0300 Toxin Antitoxin Complex from Mycobacterium tuberculosis 2009-04-28 2009-05-05 Min, A.B.,Miallau, L.,Sawaya, M.R.,Habel, J.,Cascio, D.,Eisenberg, D. The crystal structure of the Rv0301-Rv0300 VapBC-3 toxin-antitoxin complex from M. tuberculosis reveals a Mg(2+) ion in the active site and a putative RNA-binding site. Protein Sci. 2012 21 1754 1767 3GB5 19436071 Crystal structure of Mus musculus iodotyrosine deiodinase (IYD) bound to FMN 2009-02-18 2009-05-12 Thomas, S.R.,McTamney, P.M.,Adler, J.M.,Laronde-Leblanc, N.,Rokita, S.E. Crystal structure of iodotyrosine deiodinase, a novel flavoprotein responsible for iodide salvage in thyroid glands. J.Biol.Chem. 2009 284 19659 19667 3GFD 19436071 Crystal structure of Mus musculus iodotyrosine deiodinase (IYD) bound to FMN and mono-iodotyrosine (MIT) 2009-02-26 2009-05-12 Thomas, S.R.,McTamney, P.M.,Adler, J.M.,Laronde-Leblanc, N.,Rokita, S.E. Crystal structure of iodotyrosine deiodinase, a novel flavoprotein responsible for iodide salvage in thyroid glands. J.Biol.Chem. 2009 284 19659 19667 3GH8 19436071 Crystal structure of Mus musculus iodotyrosine deiodinase (IYD) bound to FMN and di-iodotyrosine (DIT) 2009-03-03 2009-05-12 Thomas, S.R.,McTamney, P.M.,Adler, J.M.,Laronde-Leblanc, N.,Rokita, S.E. Crystal structure of iodotyrosine deiodinase, a novel flavoprotein responsible for iodide salvage in thyroid glands. J.Biol.Chem. 2009 284 19659 19667 3GII 19446528 Dpo4 extension ternary complex with disordered A opposite an oxoG in anti conformation 2009-03-05 2009-05-19 Rechkoblit, O.,Malinina, L.,Cheng, Y.,Geacintov, N.E.,Broyde, S.,Patel, D.J. Impact of conformational heterogeneity of OxoG lesions and their pairing partners on bypass fidelity by Y family polymerases. Structure 2009 17 725 736 3GIJ 19446528 Dpo4 extension ternary complex with oxoG(syn)-A(anti) and oxoG(anti)-A(syn) pairs 2009-03-05 2009-05-19 Rechkoblit, O.,Malinina, L.,Cheng, Y.,Geacintov, N.E.,Broyde, S.,Patel, D.J. Impact of conformational heterogeneity of OxoG lesions and their pairing partners on bypass fidelity by Y family polymerases. Structure 2009 17 725 736 3GIK 19446528 Dpo4 extension ternary complex with the oxoG(anti)-C(anti) pair 2009-03-05 2009-05-19 Rechkoblit, O.,Malinina, L.,Cheng, Y.,Geacintov, N.E.,Broyde, S.,Patel, D.J. Impact of conformational heterogeneity of OxoG lesions and their pairing partners on bypass fidelity by Y family polymerases. Structure 2009 17 725 736 3GIL 19446528 Dpo4 extension ternary complex with oxoG(anti)-T(anti) pair 2009-03-05 2009-05-19 Rechkoblit, O.,Malinina, L.,Cheng, Y.,Geacintov, N.E.,Broyde, S.,Patel, D.J. Impact of conformational heterogeneity of OxoG lesions and their pairing partners on bypass fidelity by Y family polymerases. Structure 2009 17 725 736 3G8Q 19407206 A cytidine deaminase edits C-to-U in transfer RNAs in archaea 2009-02-12 2009-05-26 Randau, L.,Stanley, B.J.,Kohlway, A.,Mechta, S.,Xiong, Y.,Soll, D. A cytidine deaminase edits C to U in transfer RNAs in Archaea Science 2009 324 657 659 3H8V 20368332 Human Ubiquitin-activating Enzyme 5 in Complex with ATP 2009-04-29 2009-05-26 Bacik, J.P.,Walker, J.R.,Ali, M.,Schimmer, A.D.,Dhe-Paganon, S. Crystal structure of the human ubiquitin-activating enzyme 5 (UBA5) bound to ATP: mechanistic insights into a minimalistic E1 enzyme. J.Biol.Chem. 2010 285 20273 20280 3FDQ 19446532 Recognition of AT-rich DNA binding sites by the MogR Repressor 2008-11-26 2009-06-02 Shen, A.,Higgins, D.E.,Panne, D. Recognition of AT-Rich DNA Binding Sites by the MogR Repressor. Structure 2009 17 769 777 3FDQ 19446532 Recognition of AT-rich DNA binding sites by the MogR Repressor 2008-11-26 2009-06-02 Shen, A.,Higgins, D.E.,Panne, D. Recognition of AT-Rich DNA Binding Sites by the MogR Repressor. Structure 2009 17 769 777 3GV5 19440206 Human DNA polymerase iota in complex with T template DNA and incoming ddADP 2009-03-30 2009-06-02 Kirouac, K.N.,Ling, H. Structural basis of error-prone replication and stalling at a thymine base by human DNA polymerase iota Embo J. 2009 28 1644 1654 3GV7 19440206 Human DNA polymerase iota in complex with T template DNA and incoming dTTP 2009-03-30 2009-06-02 Kirouac, K.N.,Ling, H. Structural basis of error-prone replication and stalling at a thymine base by human DNA polymerase iota Embo J. 2009 28 1644 1654 3GV8 19440206 Human DNA polymerase iota in complex with T template DNA and incoming dGTP 2009-03-30 2009-06-02 Kirouac, K.N.,Ling, H. Structural basis of error-prone replication and stalling at a thymine base by human DNA polymerase iota Embo J. 2009 28 1644 1654 3HJC Crystal structure of the carboxy-terminal domain of HSP90 from Leishmania major, LmjF33.0312 2009-05-21 2009-06-02 Wernimont, A.K.,Tempel, W.,Lin, Y.H.,Hutchinson, A.,Mackenzie, F.,Fairlamb, A.,Kozieradzki, I.,Cossar, D.,Zhao, Y.,Schapira, M.,Bochkarev, A.,Arrowsmith, C.H.,Bountra, C.,Weigelts, J.,Edwards, A.M.,Ferguson, M.A.J.,Hui, R.,Pizarro, J.C.,Hills, T. Crystal Structure of the middle and carboxy-terminal domain of HSP90 from Leishmania major, LMJF33.0312 To be Published 0 0 0 0 3H5V 19461580 Crystal structure of the GluR2-ATD 2009-04-22 2009-06-09 Jin, R.,Singh, S.K.,Gu, S.,Furukawa, H.,Sobolevsky, A.I.,Zhou, J.,Jin, Y.,Gouaux, E. Crystal structure and association behaviour of the GluR2 amino-terminal domain. Embo J. 2009 28 1812 1823 3G4D 19489610 Crystal Structure of (+)-delta-Cadinene Synthase from Gossypium arboreum and Evolutionary Divergence of Metal Binding Motifs for Catalysis 2009-02-03 2009-06-16 Gennadios, H.A.,Gonzalez, V.,Di Costanzo, L.,Li, A.,Yu, F.,Miller, D.J.,Allemann, R.K.,Christianson, D.W. Crystal structure of (+)-delta-cadinene synthase from Gossypium arboreum and evolutionary divergence of metal binding motifs for catalysis. Biochemistry 2009 48 6175 6183 3HAJ 19549836 Crystal structure of human PACSIN2 F-BAR domain (p212121 lattice) 2009-05-01 2009-06-16 Wang, Q.,Navarro, M.V.,Peng, G.,Molinelli, E.,Lin Goh, S.,Judson, B.L.,Rajashankar, K.R.,Sondermann, H. Molecular mechanism of membrane constriction and tubulation mediated by the F-BAR protein Pacsin/Syndapin. Proc.Natl.Acad.Sci.USA 2009 106 12700 12705 3F96 19394314 Crystal structure of human plasma platelet activating factor acetylhydrolase covalently inhibited by sarin 2008-11-13 2009-06-23 Samanta, U.,Kirby, S.D.,Srinivasan, P.,Cerasoli, D.M.,Bahnson, B.J. Crystal structures of human group-VIIA phospholipase A2 inhibited by organophosphorus nerve agents exhibit non-aged complexes. Biochem Pharmacol 2009 78 420 429 3F97 19394314 Crystal structure of human plasma platelet activating factor acetylhydrolase covalently inhibited by soman 2008-11-13 2009-06-23 Samanta, U.,Kirby, S.D.,Srinivasan, P.,Cerasoli, D.M.,Bahnson, B.J. Crystal structures of human group-VIIA phospholipase A2 inhibited by organophosphorus nerve agents exhibit non-aged complexes. Biochem Pharmacol 2009 78 420 429 3FMG 19520960 Structure of rotavirus outer capsid protein VP7 trimer in complex with a neutralizing Fab 2008-12-22 2009-06-23 Aoki, S.T.,Settembre, E.C.,Trask, S.D.,Greenberg, H.B.,Harrison, S.C.,Dormitzer, P.R. Structure of rotavirus outer-layer protein VP7 bound with a neutralizing Fab. Science 2009 324 1444 1447 3G7W 19475663 Islet Amyloid Polypeptide (IAPP or Amylin) Residues 1 to 22 fused to Maltose Binding Protein 2009-02-11 2009-06-23 Wiltzius, J.J.,Sievers, S.A.,Sawaya, M.R.,Eisenberg, D. Atomic structures of IAPP (amylin) fusions suggest a mechanism for fibrillation and the role of insulin in the process Protein Sci. 2009 18 1521 1530 3HLK 19497300 Crystal structure of human mitochondrial acyl-CoA thioesterase (ACOT2) 2009-05-27 2009-06-23 Mandel, C.R.,Tweel, B.,Tong, L. Crystal structure of human mitochondrial acyl-CoA thioesterase (ACOT2) Biochem.Biophys.Res.Commun. 2009 385 630 633 3H0W 19527050 Human AdoMetDC with 5'-Deoxy-5'-[(N-dimethyl)amino]-8-methyl-adenosine 2009-04-10 2009-06-30 Bale, S.,Brooks, W.,Hanes, J.W.,Mahesan, A.M.,Guida, W.C.,Ealick, S.E. Role of the sulfonium center in determining the ligand specificity of human s-adenosylmethionine decarboxylase. Biochemistry 2009 48 6423 6430 3H6P Crystal structure of Rv3019c-Rv3020c from Mycobacterium tuberculosis 2009-04-23 2009-06-30 Chan, S.,Arbing, M.,Phan, T.,Kaufmann, M.,Cascio, D.,Eisenberg, D. Crystal structure of Rv3019c-Rv3020c from Mycobacterium tuberculosis To be Published 0 0 0 0 3HEI 19525919 Ligand Recognition by A-Class Eph Receptors: Crystal Structures of the EphA2 Ligand-Binding Domain and the EphA2/ephrin-A1 Complex 2009-05-08 2009-06-30 Himanen, J.P.,Goldgur, Y.,Miao, H.,Myshkin, E.,Guo, H.,Buck, M.,Nguyen, M.,Rajashankar, K.R.,Wang, B.,Nikolov, D.B. Ligand recognition by A-class Eph receptors: crystal structures of the EphA2 ligand-binding domain and the EphA2/ephrin-A1 complex. Embo Rep. 2009 10 722 728 3HPN 19525919 Ligand recognition by A-class EPH receptors: crystal structures of the EPHA2 ligand-binding domain and the EPHA2/EPHRIN-A1 complex 2009-06-04 2009-06-30 Himanen, J.P.,Goldgur, Y.,Miao, H.,Myshkin, E.,Guo, H.,Buck, M.,Nguyen, M.,Rajashankar, K.R.,Wang, B.,Nikolov, D.B. Ligand recognition by A-class Eph receptors: crystal structures of the EphA2 ligand-binding domain and the EphA2/ephrin-A1 complex. Embo Rep. 2009 10 722 728 3HXR 19576787 Nucleoporin Nup120 from S.cerevisiae (aa 1-757) 2009-06-21 2009-07-28 Leksa, N.C.,Brohawn, S.G.,Schwartz, T.U. The structure of the scaffold nucleoporin Nup120 reveals a new and unexpected domain architecture. Structure 2009 17 1082 1091 3GJ0 19505478 Crystal structure of human RanGDP 2009-03-07 2009-08-04 Partridge, J.R.,Schwartz, T.U. Crystallographic and Biochemical Analysis of the Ran-binding Zinc Finger Domain. J.Mol.Biol. 2009 391 375 389 3GJ3 19505478 Crystal structure of human RanGDP-Nup153ZnF2 complex 2009-03-07 2009-08-04 Partridge, J.R.,Schwartz, T.U. Crystallographic and Biochemical Analysis of the Ran-binding Zinc Finger Domain. J.Mol.Biol. 2009 391 375 389 3GJ4 19505478 Crystal structure of human RanGDP-Nup153ZnF3 complex 2009-03-07 2009-08-04 Partridge, J.R.,Schwartz, T.U. Crystallographic and Biochemical Analysis of the Ran-binding Zinc Finger Domain. J.Mol.Biol. 2009 391 375 389 3GJ5 19505478 Crystal structure of human RanGDP-Nup153ZnF4 complex 2009-03-07 2009-08-04 Partridge, J.R.,Schwartz, T.U. Crystallographic and Biochemical Analysis of the Ran-binding Zinc Finger Domain. J.Mol.Biol. 2009 391 375 389 3GJ6 19505478 Crystal structure of human RanGDP-Nup153ZnF1 complex 2009-03-07 2009-08-04 Partridge, J.R.,Schwartz, T.U. Crystallographic and Biochemical Analysis of the Ran-binding Zinc Finger Domain. J.Mol.Biol. 2009 391 375 389 3GJ7 19505478 Crystal structure of human RanGDP-Nup153ZnF12 complex 2009-03-07 2009-08-04 Partridge, J.R.,Schwartz, T.U. Crystallographic and Biochemical Analysis of the Ran-binding Zinc Finger Domain. J.Mol.Biol. 2009 391 375 389 3GJ8 19505478 Crystal structure of human RanGDP-Nup153ZnF34 complex 2009-03-07 2009-08-04 Partridge, J.R.,Schwartz, T.U. Crystallographic and Biochemical Analysis of the Ran-binding Zinc Finger Domain. J.Mol.Biol. 2009 391 375 389 3FEY 19668212 Crystal structure of the CBC-importin alpha complex. 2008-12-01 2009-08-11 Dias, S.M.,Wilson, K.F.,Rojas, K.S.,Ambrosio, A.L.,Cerione, R.A. The molecular basis for the regulation of the cap-binding complex by the importins. Nat.Struct.Mol.Biol. 2009 16 930 937 3HYM 19668213 Insights into Anaphase Promoting Complex TPR subdomain assembly from a CDC26-APC6 structure 2009-06-22 2009-08-11 Wang, J.,Dye, B.T.,Rajashankar, K.R.,Kurinov, I.,Schulman, B.A. Insights into anaphase promoting complex TPR subdomain assembly from a CDC26-APC6 structure. Nat.Struct.Mol.Biol. 2009 16 987 989 3I5Q 19674973 Nup170(aa1253-1502) at 2.2 A, S.cerevisiae 2009-07-06 2009-08-11 Whittle, J.R.,Schwartz, T.U. Architectural nucleoporins Nup157/170 and Nup133 are structurally related and descend from a second ancestral element. J.Biol.Chem. 2009 284 28442 28452 3H94 19695261 Crystal structure of the membrane fusion protein CusB from Escherichia coli 2009-04-30 2009-08-18 Su, C.C.,Yang, F.,Long, F.,Reyon, D.,Routh, M.D.,Kuo, D.W.,Mokhtari, A.K.,Van Ornam, J.D.,Rabe, K.L.,Hoy, J.A.,Lee, Y.J.,Rajashankar, K.R.,Yu, E.W. Crystal structure of the membrane fusion protein CusB from Escherichia coli J.Mol.Biol. 2009 393 342 355 3H8Y 19690376 Crystal structure of carboxysome small shell protein CsoS1C from Halothiobacillus neapolitanus 2009-04-29 2009-09-01 Tsai, Y.,Sawaya, M.R.,Yeates, T.O. Analysis of lattice-translocation disorder in the layered hexagonal structure of carboxysome shell protein CsoS1C Acta Crystallogr.,Sect.D 2009 65 980 988 3FWE 19805344 Crystal Structure of the Apo D138L CAP mutant 2009-01-17 2009-09-08 Sharma, H.,Yu, S.,Kong, J.,Wang, J.,Steitz, T.A. Structure of apo-CAP reveals that large conformational changes are necessary for DNA binding Proc.Natl.Acad.Sci.USA 2009 106 16604 16609 3HIF 19805344 The crystal structure of apo wild type CAP at 3.6 A resolution. 2009-05-19 2009-09-08 Sharma, H.,Yu, S.,Kong, J.,Wang, J.,Steitz, T.A. Structure of apo-CAP reveals that large conformational changes are necessary for DNA binding. Proc.Natl.Acad.Sci.USA 2009 106 16604 16609 3I2D 19748360 Crystal Structure of S. Cerevisiae SUMO E3 Ligase SIZ1 2009-06-29 2009-09-15 Yunus, A.A.,Lima, C.D. Structure of the Siz/PIAS SUMO E3 ligase Siz1 and determinants required for SUMO modification of PCNA. Mol.Cell 2009 35 669 682 3EWC 19728741 Crystal Structure of adenosine deaminase from Plasmodial vivax in complex with MT-coformycin 2008-10-14 2009-09-22 Ho, M.C.,Cassera, M.B.,Madrid, D.C.,Ting, L.M.,Tyler, P.C.,Kim, K.,Almo, S.C.,Schramm, V.L. Structural and metabolic specificity of methylthiocoformycin for malarial adenosine deaminases. Biochemistry 2009 48 9618 9626 3HAN 19603754 Crystal structure of bacteriorhodopsin mutant V49A crystallized from bicelles 2009-05-02 2009-09-22 Joh, N.H.,Oberai, A.,Yang, D.,Whitelegge, J.P.,Bowie, J.U. Similar energetic contributions of packing in the core of membrane and water-soluble proteins. J.Am.Chem.Soc. 2009 131 10846 10847 3EOD Crystal structure of N-terminal domain of E. coli RssB 2008-09-26 2009-10-06 Levchenko, I.,Grant, R.A.,Sauer, R.T.,Baker, T.A. The structure of RssB, a ClpX adaptor protein that regulates sigma S To be Published 0 0 0 0 3FFA 19703466 Crystal Structure of a fast activating G protein mutant 2008-12-02 2009-10-06 Kapoor, N.,Menon, S.T.,Chauhan, R.,Sachdev, P.,Sakmar, T.P. Structural evidence for a sequential release mechanism for activation of heterotrimeric g proteins. J.Mol.Biol. 2009 393 882 897 3FFB 19703466 Gi-alpha-1 mutant in GDP bound form 2008-12-02 2009-10-06 Kapoor, N.,Menon, S.T.,Chauhan, R.,Sachdev, P.,Sakmar, T.P. Structural evidence for a sequential release mechanism for activation of heterotrimeric g proteins. J.Mol.Biol. 2009 393 882 897 3HJF 19812667 Crystal structure of T. thermophilus Argonaute E546 mutant protein complexed with DNA guide strand and 15-nt RNA target strand 2009-05-21 2009-10-06 Wang, Y.,Juranek, S.,Li, H.,Sheng, G.,Wardle, G.S.,Tuschl, T.,Patel, D.J. Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature 2009 461 754 761 3HK2 19812667 Crystal structure of T. thermophilus Argonaute N478 mutant protein complexed with DNA guide strand and 19-nt RNA target strand 2009-05-22 2009-10-06 Wang, Y.,Juranek, S.,Li, H.,Sheng, G.,Wardle, G.S.,Tuschl, T.,Patel, D.J. Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature 2009 461 754 761 3HM9 19812667 Crystal structure of T. thermophilus Argonaute complexed with DNA guide strand and 19-nt RNA target strand 2009-05-28 2009-10-06 Wang, Y.,Juranek, S.,Li, H.,Sheng, G.,Wardle, G.S.,Tuschl, T.,Patel, D.J. Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature 2009 461 754 761 3HO1 19812667 Crystal structure of T. thermophilus Argonaute N546 mutant protein complexed with DNA guide strand and 12-nt RNA target strand 2009-06-01 2009-10-06 Wang, Y.,Juranek, S.,Li, H.,Sheng, G.,Wardle, G.S.,Tuschl, T.,Patel, D.J. Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature 2009 461 754 761 3HVR 19812667 Crystal structure of T. thermophilus Argonaute complexed with DNA guide strand and 19-nt RNA target strand with two Mg2+ at the cleavage site 2009-06-16 2009-10-06 Wang, Y.,Juranek, S.,Li, H.,Sheng, G.,Wardle, G.S.,Tuschl, T.,Patel, D.J. Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature 2009 461 754 761 3HXM 19812667 Structure of an argonaute complexed with guide DNA and target RNA duplex containing two mismatches. 2009-06-21 2009-10-06 Wang, Y.,Juranek, S.,Li, H.,Sheng, G.,Wardle, G.S.,Tuschl, T.,Patel, D.J. Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature 2009 461 754 761 3IE9 19715303 Structure of oxidized M98L mutant of amicyanin 2009-07-22 2009-10-06 Choi, M.,Sukumar, N.,Liu, A.,Davidson, V.L. Defining the role of the axial ligand of the type 1 copper site in amicyanin by replacement of methionine with leucine. Biochemistry 2009 48 9174 9184 3IEJ 19773165 Pyrazole-based Cathepsin S Inhibitors with Arylalkynes as P1 Binding Elements 2009-07-22 2009-10-06 Ameriks, M.K.,Axe, F.U.,Bembenek, S.D.,Edwards, J.P.,Gu, Y.,Karlsson, L.,Randal, M.,Sun, S.,Thurmond, R.L.,Zhu, J. Pyrazole-based cathepsin S inhibitors with arylalkynes as P1 binding elements. Bioorg.Med.Chem.Lett. 2009 19 6131 6134 3ES2 Structure of the C-terminal phosphatase domain of P. aeruginonsa RssB 2008-10-03 2009-10-20 Levchenko, I.,Grant, R.A.,Sauer, R.T.,Baker, T.A. The structure of RSSB, a clpx adaptor protein that regulates sigma s To be Published 0 0 0 0 3HQI 19818708 Structures of SPOP-Substrate Complexes: Insights into Molecular Architectures of BTB-Cul3 Ubiquitin Ligases: SPOPMATHx/BTB/3-box-PucSBC1 2009-06-07 2009-10-20 Zhuang, M.,Calabrese, M.F.,Liu, J.,Waddell, M.B.,Nourse, A.,Hammel, M.,Miller, D.J.,Walden, H.,Duda, D.M.,Seyedin, S.N.,Hoggard, T.,Harper, J.W.,White, K.P.,Schulman, B.A. Structures of SPOP-substrate complexes: insights into molecular architectures of BTB-Cul3 ubiquitin ligases. Mol.Cell 2009 36 39 50 3HTK 19748359 Crystal structure of Mms21 and Smc5 complex 2009-06-11 2009-10-20 Duan, X.,Sarangi, P.,Liu, X.,Rangi, G.K.,Zhao, X.,Ye, H. Structural and functional insights into the roles of the Mms21 subunit of the Smc5/6 complex. Mol.Cell 2009 35 657 668 3HU6 19818708 Structures of SPOP-Substrate Complexes: Insights into Molecular Architectures of BTB-Cul3 Ubiquitin Ligases: SPOPMATHx/BTB/3-box-PucSBC1 2009-06-13 2009-10-20 Zhuang, M.,Calabrese, M.F.,Liu, J.,Waddell, M.B.,Nourse, A.,Hammel, M.,Miller, D.J.,Walden, H.,Duda, D.M.,Seyedin, S.N.,Hoggard, T.,Harper, J.W.,White, K.P.,Schulman, B.A. Structures of SPOP-substrate complexes: insights into molecular architectures of BTB-Cul3 ubiquitin ligases. Mol.Cell 2009 36 39 50 3IVB Structures of SPOP-Substrate Complexes: Insights into Architectures of BTB-Cul3 Ubiquitin Ligases: SPOPMATH-MacroH2ASBCpep1 2009-08-31 2009-10-20 Zhuang, M.,Calabrese, M.F.,Liu, J.,Waddell, M.B.,Nourse, A.,Hammel, M.,Miller, D.J.,Walden, H.,Duda, D.M.,Steven, S.,Hoggard, T.,Harper, J.W.,White, K.P.,Schulman, B.A. Structure 9 To be Published 0 0 0 0 3IVV 19818708 Structures of SPOP-Substrate Complexes: Insights into Molecular Architectures of BTB-Cul3 Ubiquitin Ligases: SPOPMATH-PucSBC1_pep1 2009-09-01 2009-10-20 Zhuang, M.,Calabrese, M.F.,Liu, J.,Waddell, M.B.,Nourse, A.,Hammel, M.,Miller, D.J.,Walden, H.,Duda, D.M.,Seyedin, S.N.,Hoggard, T.,Harper, J.W.,White, K.P.,Schulman, B.A. Structures of SPOP-Substrate Complexes: Insights into Molecular Architectures of BTB-Cul3 Ubiquitin Ligases. Mol.Cell 2009 36 39 50 3HL9 19875080 Simvastatin Synthase (LovD) from Aspergillus terreus, unliganded 2009-05-27 2009-10-27 Gao, X.,Xie, X.,Pashkov, I.,Sawaya, M.R.,Laidman, J.,Zhang, W.,Cacho, R.,Yeates, T.O.,Tang, Y. Directed evolution and structural characterization of a simvastatin synthase Chem.Biol. 2009 16 1064 1074 3HLB 19875080 Simvastatin Synthase (LovD) from Aspergillus terreus, unliganded, selenomethionyl derivative 2009-05-27 2009-10-27 Gao, X.,Xie, X.,Pashkov, I.,Sawaya, M.R.,Laidman, J.,Zhang, W.,Cacho, R.,Yeates, T.O.,Tang, Y. Directed evolution and structural characterization of a simvastatin synthase Chem.Biol. 2009 16 1064 1074 3HLC 19875080 Simvastatin Synthase (LovD) from Aspergillus terreus, S5 mutant, unliganded 2009-05-27 2009-10-27 Gao, X.,Xie, X.,Pashkov, I.,Sawaya, M.R.,Laidman, J.,Zhang, W.,Cacho, R.,Yeates, T.O.,Tang, Y. Directed evolution and structural characterization of a simvastatin synthase Chem.Biol. 2009 16 1064 1074 3HLD 19875080 Simvastatin Synthase (LovD), from Aspergillus terreus, S5 mutant complex with monacolin J acid 2009-05-27 2009-10-27 Gao, X.,Xie, X.,Pashkov, I.,Sawaya, M.R.,Laidman, J.,Zhang, W.,Cacho, R.,Yeates, T.O.,Tang, Y. Directed evolution and structural characterization of a simvastatin synthase Chem.Biol. 2009 16 1064 1074 3HLE 19875080 Simvastatin Synthase (LovD), from Aspergillus terreus, S5 mutant, S76A mutant, complex with monacolin J acid 2009-05-27 2009-10-27 Gao, X.,Xie, X.,Pashkov, I.,Sawaya, M.R.,Laidman, J.,Zhang, W.,Cacho, R.,Yeates, T.O.,Tang, Y. Directed evolution and structural characterization of a simvastatin synthase Chem.Biol. 2009 16 1064 1074 3HLF 19875080 Simvastatin Synthase (LovD), from Aspergillus terreus, S5 mutant, S76A mutant, complex with simvastatin 2009-05-27 2009-10-27 Gao, X.,Xie, X.,Pashkov, I.,Sawaya, M.R.,Laidman, J.,Zhang, W.,Cacho, R.,Yeates, T.O.,Tang, Y. Directed evolution and structural characterization of a simvastatin synthase Chem.Biol. 2009 16 1064 1074 3HLG 19875080 Simvastatin Synthase (LovD), from Aspergillus terreus, S5 mutant, S76A mutant, complex with lovastatin 2009-05-27 2009-10-27 Gao, X.,Xie, X.,Pashkov, I.,Sawaya, M.R.,Laidman, J.,Zhang, W.,Cacho, R.,Yeates, T.O.,Tang, Y. Directed evolution and structural characterization of a simvastatin synthase Chem.Biol. 2009 16 1064 1074 3JRO 19855394 NUP84-NUP145C-SEC13 edge element of the NPC lattice 2009-09-08 2009-10-27 Brohawn, S.G.,Schwartz, T.U. Molecular architecture of the Nup84-Nup145C-Sec13 edge element in the nuclear pore complex lattice. Nat.Struct.Mol.Biol. 2009 16 1173 1177 3GQ5 20010681 Sequence-matched MutM Interrogation Complex 5 (IC5) 2009-03-23 2009-11-10 Qi, Y.,Spong, M.C.,Nam, K.,Banerjee, A.,Jiralerspong, S.,Karplus, M.,Verdine, G.L. Encounter and extrusion of an intrahelical lesion by a DNA repair enzyme. Nature 2009 462 762 766 3IT3 19836403 Crystal Structure Francisella tularensis histidine acid phosphatase D261A mutant complexed with substrate 3'-AMP 2009-08-27 2009-11-10 Singh, H.,Felts, R.L.,Schuermann, J.P.,Reilly, T.J.,Tanner, J.J. Crystal Structures of the histidine acid phosphatase from Francisella tularensis provide insight into substrate recognition. J.Mol.Biol. 2009 394 893 904 3F79 Structure of pseudo-centered cell crystal form of the C-terminal phosphatase domain of P. aeruginosa RssB 2008-11-07 2009-11-24 Levchenko, I.,Grant, R.A.,Sauer, R.T.,Baker, T.A. The structure of RSSB, a CLPX adaptor protein that regulates sigma S To be Published 0 0 0 0 3HTE 19914167 Crystal structure of nucleotide-free hexameric ClpX 2009-06-11 2009-11-24 Glynn, S.E.,Martin, A.,Nager, A.R.,Baker, T.A.,Sauer, R.T. Structures of asymmetric ClpX hexamers reveal nucleotide-dependent motions in a AAA+ protein-unfolding machine. Cell(Cambridge,Mass.) 2009 139 744 756 3HWS 19914167 Crystal structure of nucleotide-bound hexameric ClpX 2009-06-18 2009-11-24 Glynn, S.E.,Martin, A.,Nager, A.R.,Baker, T.A.,Sauer, R.T. Structures of asymmetric ClpX hexamers reveal nucleotide-dependent motions in a AAA+ protein-unfolding machine. Cell(Cambridge,Mass.) 2009 139 744 756 3KFW Uncharacterized protein Rv0674 from Mycobacterium tuberculosis 2009-10-28 2009-12-01 Ramagopal, U.A.,Toro, R.,Burley, S.K.,Almo, S.C. Uncharacterized protein Rv0674 from Mycobacterium tuberculosis To be Published 0 0 0 0 3H1D 20007713 Structure of the HUWE1 HECT Domain 2009-04-11 2009-12-08 Pandya, R.K.,Partridge, J.R.,Love, K.R.,Schwartz, T.U.,Ploegh, H.L. A structural element within the HUWE1 HECT domain modulates self-ubiquitination and substrate ubiquitination activities. J.Biol.Chem. 2010 285 5664 5673 3HIT 19920175 Crystal structure of Saporin-L1 in complex with the dinucleotide inhibitor, a transition state analogue 2009-05-20 2009-12-08 Ho, M.C.,Sturm, M.B.,Almo, S.C.,Schramm, V.L. Transition state analogues in structures of ricin and saporin ribosome-inactivating proteins. Proc.Natl.Acad.Sci.USA 2009 106 20276 20281 3IGI 19952115 Tertiary Architecture of the Oceanobacillus Iheyensis Group II Intron 2009-07-27 2009-12-22 Toor, N.,Keating, K.S.,Fedorova, O.,Rajashankar, K.,Wang, J.,Pyle, A.M. Tertiary architecture of the Oceanobacillus iheyensis group II intron. Rna 2010 16 57 69 3KV2 20153713 HIGH RESOLUTION STRUCTURE OF HUMAN ARGINASE I IN COMPLEX WITH THE STRONG INHIBITOR N(omega)-hydroxy-nor-L-arginine (nor-NOHA) 2009-11-28 2009-12-22 Di Costanzo, L.,Ilies, M.,Thorn, K.J.,Christianson, D.W. Inhibition of human arginase I by substrate and product analogues. Arch.Biochem.Biophys. 2010 496 101 108 2WDT 20042598 Crystal structure of Plasmodium falciparum UCHL3 in complex with the suicide inhibitor UbVME 2009-03-26 2009-12-29 Artavanis-Tsakonas, K.,Weihofen, W.A.,Antos, J.M.,Coleman, B.I.,Comeaux, C.A.,Duraisingh, M.T.,Gaudet, R.,Ploegh, H.L. Characterization and Structural Studies of the Plasmodium Falciparum Ubiquitin and Nedd8 Hydrolase Uchl3. J.Biol.Chem. 2010 285 6857 0 3I6P 20044574 Ethanolamine Utilization Microcompartment Shell Subunit, EutM 2009-07-07 2010-01-12 Tanaka, S.,Sawaya, M.R.,Yeates, T.O. Structure and Mechanisms of a Protein-Based Organelle in Escherichia coli. Science 2010 327 81 84 3I71 20044574 Ethanolamine Utilization Microcompartment Shell Subunit, EutK C-terminal domain 2009-07-07 2010-01-12 Tanaka, S.,Sawaya, M.R.,Yeates, T.O. Structure and Mechanisms of a Protein-Based Organelle in Escherichia coli. Science 2010 327 81 84 3I82 20044574 Ethanolamine Utilization Microcompartment Shell Subunit, EutL Closed Form 2009-07-09 2010-01-12 Tanaka, S.,Sawaya, M.R.,Yeates, T.O. Structure and Mechanisms of a Protein-Based Organelle in Escherichia coli. Science 2010 327 81 84 3I87 20044574 Ethanolamine Utilization Microcompartment Shell Subunit, EutL Open Form 2009-07-09 2010-01-12 Tanaka, S.,Sawaya, M.R.,Yeates, T.O. Structure and Mechanisms of a Protein-Based Organelle in Escherichia coli. Science 2010 327 81 84 3I96 20044574 Ethanolamine Utilization Microcompartment Shell Subunit, EutS 2009-07-10 2010-01-12 Tanaka, S.,Sawaya, M.R.,Yeates, T.O. Structure and Mechanisms of a Protein-Based Organelle in Escherichia coli. Science 2010 327 81 84 3IA0 20044574 Ethanolamine Utilization Microcompartment Shell Subunit, EutS-G39V mutant 2009-07-13 2010-01-12 Tanaka, S.,Sawaya, M.R.,Yeates, T.O. Structure and Mechanisms of a Protein-Based Organelle in Escherichia coli. Science 2010 327 81 84 3JTG 20079749 Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA 2009-09-11 2010-01-12 Agarkar, V.B.,Babayeva, N.D.,Wilder, P.J.,Rizzino, A.,Tahirov, T.H. Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA. J.Mol.Biol. 2010 397 278 289 3JVZ 20064473 E2~Ubiquitin-HECT 2009-09-17 2010-01-12 Kamadurai, H.B.,Souphron, J.,Scott, D.C.,Duda, D.M.,Miller, D.J.,Stringer, D.,Piper, R.C.,Schulman, B.A. Insights into ubiquitin transfer cascades from a structure of a UbcH5B approximately ubiquitin-HECT(NEDD4L) complex. Mol.Cell 2009 36 1095 1102 3JYC 20019282 Crystal structure of the eukaryotic strong inward-rectifier K+ channel Kir2.2 at 3.1 Angstrom resolution 2009-09-21 2010-01-12 Tao, X.,Avalos, J.L.,Chen, J.,MacKinnon, R. Crystal structure of the eukaryotic strong inward-rectifier K+ channel Kir2.2 at 3.1 A resolution. Science 2009 326 1668 1674 3KHK Crystal structure of type-I restriction-modification system methylation subunit (MM_0429) from Methanosarchina mazei. 2009-10-30 2010-01-19 Ramagopal, U.A.,Toro, R.,Burley, S.K.,Almo, S.C. Crystal structure of type-I restriction-modification system methylation subunit (MM_0429) from Methanosarchina mazei. To be Published 0 0 0 0 3GMZ 21728378 Crystal of human arginase in complex with L-ornithine. Resolution 1.43 A. 2009-03-15 2010-01-26 Ilies, M.,Di Costanzo, L.,Dowling, D.P.,Thorn, K.J.,Christianson, D.W. Binding of alpha,alpha-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design J.Med.Chem. 2011 54 5432 5443 3KVP Crystal Structure of Uncharacterized protein ymzC Precursor from Bacillus subtilis, Northeast Structural Genomics Consortium Target SR378A 2009-11-30 2010-02-02 Kuzin, A.P.,Chen, Y.,Afonine, P.,Seetharaman, J.,Fang, F.,Xiao, R.,Cunningham, K.,Ma, L.,Chen, C.X.,Everett, J.K.,Nair, R.,Acton, T.B.,Rost, B.,Montelione, G.T.,Tong, L.,Hunt, J.F. Northeast Structural Genomics Consortium Target SR378A To be Published 0 0 0 0 3KB9 20131801 Epi-isozizaene synthase: Complex with Mg, inorganic pyrophosphate and benzyl triethyl ammonium cation 2009-10-20 2010-02-09 Aaron, J.A.,Lin, X.,Cane, D.E.,Christianson, D.W. Structure of Epi-Isozizaene Synthase from Streptomyces coelicolor A3(2), a Platform for New Terpenoid Cyclization Templates Biochemistry 2010 49 1787 1797 3KP9 20110994 Structure of a bacterial homolog of vitamin K epoxide reductase 2009-11-16 2010-02-09 Li, W.,Schulman, S.,Dutton, R.J.,Boyd, D.,Beckwith, J.,Rapoport, T.A. Structure of a bacterial homologue of vitamin K epoxide reductase. Nature 2010 463 507 512 3KXP 20099871 Crystal Structure of E-2-(Acetamidomethylene)succinate Hydrolase 2009-12-03 2010-02-09 McCulloch, K.M.,Mukherjee, T.,Begley, T.P.,Ealick, S.E. Structure determination and characterization of the vitamin B(6) degradative enzyme (E)-2-(acetamidomethylene)succinate hydrolase. Biochemistry 2010 49 1226 1235 3LGK 20131801 D99N Epi-isozizaene synthase 2010-01-20 2010-02-09 Aaron, J.A.,Lin, X.,Cane, D.E.,Christianson, D.W. Structure of Epi-Isozizaene Synthase from Streptomyces coelicolor A3(2), a Platform for New Terpenoid Cyclization Templates Biochemistry 2010 49 1787 1797 3KHG 20154704 Dpo4 extension ternary complex with misinserted A opposite the 2-aminofluorene-guanine [AF]G lesion 2009-10-30 2010-02-16 Rechkoblit, O.,Kolbanovskiy, A.,Malinina, L.,Geacintov, N.E.,Broyde, S.,Patel, D.J. Mechanism of error-free and semitargeted mutagenic bypass of an aromatic amine lesion by Y-family polymerase Dpo4. Nat.Struct.Mol.Biol. 2010 17 379 388 3KHL 20154704 Dpo4 post-extension ternary complex with misinserted A opposite the 2-aminofluorene-guanine [AF]G lesion 2009-10-30 2010-02-16 Rechkoblit, O.,Kolbanovskiy, A.,Malinina, L.,Geacintov, N.E.,Broyde, S.,Patel, D.J. Mechanism of error-free and semitargeted mutagenic bypass of an aromatic amine lesion by Y-family polymerase Dpo4. Nat.Struct.Mol.Biol. 2010 17 379 388 3KHR 20154704 Dpo4 post-extension ternary complex with the correct C opposite the 2-aminofluorene-guanine [AF]G lesion 2009-10-30 2010-02-16 Rechkoblit, O.,Kolbanovskiy, A.,Malinina, L.,Geacintov, N.E.,Broyde, S.,Patel, D.J. Mechanism of error-free and semitargeted mutagenic bypass of an aromatic amine lesion by Y-family polymerase Dpo4. Nat.Struct.Mol.Biol. 2010 17 379 388 3KJ0 20066663 Mcl-1 in complex with Bim BH3 mutant I2dY 2009-11-02 2010-02-16 Fire, E.,Gulla, S.V.,Grant, R.A.,Keating, A.E. Mcl-1-Bim complexes accommodate surprising point mutations via minor structural changes. Protein Sci. 2010 19 507 519 3KYC 20164921 Human SUMO E1 complex with a SUMO1-AMP mimic 2009-12-05 2010-02-16 Olsen, S.K.,Capili, A.D.,Lu, X.,Tan, D.S.,Lima, C.D. Active site remodelling accompanies thioester bond formation in the SUMO E1. Nature 2010 463 906 912 3KYD 20164921 Human SUMO E1~SUMO1-AMP tetrahedral intermediate mimic 2009-12-05 2010-02-16 Olsen, S.K.,Capili, A.D.,Lu, X.,Tan, D.S.,Lima, C.D. Active site remodelling accompanies thioester bond formation in the SUMO E1. Nature 2010 463 906 912 3KYD 20164921 Human SUMO E1~SUMO1-AMP tetrahedral intermediate mimic 2009-12-05 2010-02-16 Olsen, S.K.,Capili, A.D.,Lu, X.,Tan, D.S.,Lima, C.D. Active site remodelling accompanies thioester bond formation in the SUMO E1. Nature 2010 463 906 912 3GN0 21728378 Crystal structure of human arginase I in complex with difluoromethylornithine (DFMO) 2009-03-15 2010-02-23 Ilies, M.,Di Costanzo, L.,Dowling, D.P.,Thorn, K.J.,Christianson, D.W. Binding of alpha,alpha-Disubstituted Amino Acids to Arginase Suggests New Avenues for Inhibitor Design J.Med.Chem. 2011 54 5432 5443 3LP4 20153713 Crystal structure of human arginase I in complex with L-LYSINE, 1.90A Resolution. 2010-02-04 2010-02-23 Di Costanzo, L.,Ilies, M.,Thorn, K.J.,Christianson, D.W. Inhibition of human arginase I by substrate and product analogues. Arch.Biochem.Biophys. 2010 496 101 108 3LP7 20153713 Crystal structure of Human Arginase I in complex with inhibitor N(omega)-hydroxy-L-arginine (NOHA), 2.04A Resolution 2010-02-04 2010-02-23 Di Costanzo, L.,Ilies, M.,Thorn, K.J.,Christianson, D.W. Inhibition of human arginase I by substrate and product analogues. Arch.Biochem.Biophys. 2010 496 101 108 3KP8 20110994 The thioredoxin-like domain of a VKOR homolog from Synechococcus sp. 2009-11-15 2010-03-02 Li, W.,Schulman, S.,Dutton, R.J.,Boyd, D.,Beckwith, J.,Rapoport, T.A. Structure of a bacterial homologue of vitamin K epoxide reductase. Nature 2010 463 507 512 3HE4 20387835 Heterospecific coiled-coil pair SYNZIP5:SYNZIP6 2009-05-07 2010-03-23 Reinke, A.W.,Grant, R.A.,Keating, A.E. A synthetic coiled-coil interactome provides heterospecific modules for molecular engineering. J.Am.Chem.Soc. 2010 132 6025 6031 3IPK 20231452 Crystal Structure of A3VP1 of AgI/II of Streptococcus mutans 2009-08-17 2010-03-31 Larson, M.R.,Rajashankar, K.R.,Patel, M.H.,Robinette, R.A.,Crowley, P.J.,Michalek, S.,Brady, L.J.,Deivanayagam, C. Elongated fibrillar structure of a streptococcal adhesin assembled by the high-affinity association of alpha- and PPII-helices. Proc.Natl.Acad.Sci.USA 2010 107 5983 5988 3IOX 20231452 Crystal Structure of A3VP1 of AgI/II of Streptococcus mutans 2009-08-14 2010-04-14 Larson, M.R.,Rajashankar, K.R.,Patel, M.H.,Robinette, R.A.,Crowley, P.J.,Michalek, S.,Brady, L.J.,Deivanayagam, C. Elongated fibrillar structure of a streptococcal adhesin assembled by the high-affinity association of alpha- and PPII-helices. Proc.Natl.Acad.Sci.USA 2010 107 5983 5988 3KN5 20382163 Crystal structure of the C-terminal kinase domain of msk1 in complex with AMP-PNP 2009-11-12 2010-04-21 Malakhova, M.,D'Angelo, I.,Kim, H.G.,Kurinov, I.,Bode, A.M.,Dong, Z. The crystal structure of the active form of the C-terminal kinase domain of mitogen- and stress-activated protein kinase 1. J.Mol.Biol. 2010 399 41 52 3KN6 20382163 Crystal structure of the C-terminal kinase domain of MSK1 2009-11-12 2010-04-21 Malakhova, M.,D'Angelo, I.,Kim, H.G.,Kurinov, I.,Bode, A.M.,Dong, Z. The crystal structure of the active form of the C-terminal kinase domain of mitogen- and stress-activated protein kinase 1. J.Mol.Biol. 2010 399 41 52 3MFJ Bovine trypsin at 0.8 A resolution, restrained refinement 2010-04-02 2010-04-21 Brzuszkiewicz, A.,Dauter, M.,Dauter, Z. Bovine trypsin at 0.8 A and role of restraints at ultra-high resolution To be Published 0 0 0 0 3JR9 20395367 Crystal structure of Fis bound to 27 bp optimal binding sequence F2 2009-09-08 2010-04-28 Stella, S.,Cascio, D.,Johnson, R.C. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev. 2010 24 814 826 3JRD 20395367 Crystal structure of Fis bound to 27 bp DNA F25 containing T2A3 sequence at center 2009-09-08 2010-04-28 Stella, S.,Cascio, D.,Johnson, R.C. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev. 2010 24 814 826 3JRE 20395367 Crystal structure of Fis bound to 27 bp DNA F26 containing A-tract at center 2009-09-08 2010-04-28 Stella, S.,Cascio, D.,Johnson, R.C. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev. 2010 24 814 826 3JRF 20395367 Crystal structure of Fis bound to 27 bp DNA F27 containing a C/G at center 2009-09-08 2010-04-28 Stella, S.,Cascio, D.,Johnson, R.C. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev. 2010 24 814 826 3JRH 20395367 Crystal structure of Fis bound to 27 bp non consensus sequence DNA F21 2009-09-08 2010-04-28 Stella, S.,Cascio, D.,Johnson, R.C. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes Dev. 2010 24 814 826 3KU4 20364833 Trapping of an oxocarbenium ion intermediate in UP crystals 2009-11-26 2010-04-28 Paul, D.,O'Leary, S.E.,Rajashankar, K.,Bu, W.,Toms, A.,Settembre, E.C.,Sanders, J.M.,Begley, T.P.,Ealick, S.E. Glycal formation in crystals of uridine phosphorylase. Biochemistry 2010 49 3499 3509 3KUK 20364833 Trapping of an oxocarbenium ion intermediate in UP crystals 2009-11-27 2010-04-28 Paul, D.,O'Leary, S.E.,Rajashankar, K.,Bu, W.,Toms, A.,Settembre, E.C.,Sanders, J.M.,Begley, T.P.,Ealick, S.E. Glycal formation in crystals of uridine phosphorylase. Biochemistry 2010 49 3499 3509 3KVR 20364833 Trapping of an oxocarbenium ion intermediate in UP crystals 2009-11-30 2010-04-28 Paul, D.,O'Leary, S.E.,Rajashankar, K.,Bu, W.,Toms, A.,Settembre, E.C.,Sanders, J.M.,Begley, T.P.,Ealick, S.E. Glycal formation in crystals of uridine phosphorylase. Biochemistry 2010 49 3499 3509 3KVY 20364833 Trapping of an oxocarbenium ion intermediate in UP crystals 2009-11-30 2010-04-28 Paul, D.,O'Leary, S.E.,Rajashankar, K.,Bu, W.,Toms, A.,Settembre, E.C.,Sanders, J.M.,Begley, T.P.,Ealick, S.E. Glycal formation in crystals of uridine phosphorylase. Biochemistry 2010 49 3499 3509 3L45 20351252 A Joint Neutron and X-ray structure of Oxidized Amicyanin 2009-12-18 2010-04-28 Sukumar, N.,Mathews, F.S.,Langan, P.,Davidson, V.L. A joint x-ray and neutron study on amicyanin reveals the role of protein dynamics in electron transfer. Proc.Natl.Acad.Sci.USA 2010 107 6817 6822 3L45 20351252 A Joint Neutron and X-ray structure of Oxidized Amicyanin 2009-12-18 2010-04-28 Sukumar, N.,Mathews, F.S.,Langan, P.,Davidson, V.L. A joint x-ray and neutron study on amicyanin reveals the role of protein dynamics in electron transfer. Proc.Natl.Acad.Sci.USA 2010 107 6817 6822 3MI4 Bovine trypsin at 0.8 A resolution, non-restrained refinement 2010-04-09 2010-04-28 Brzuszkiewicz, A.,Dauter, M.,Dauter, Z. Bovine trypsin at 0.8 A and role of restraints at ultra-high resolution To be Published 0 0 0 0 3MML Allophanate Hydrolase Complex from Mycobacterium smegmatis, Msmeg0435-Msmeg0436 2010-04-20 2010-04-28 Kaufmann, M.,Chernishof, I.,Shin, A.,Germano, D.,Sawaya, M.R.,Waldo, G.S.,Arbing, M.A.,Perry, J.,Eisenberg, D. Crystal Structure of Allphanate Hydrolase Complex from M. smegmatis, Msmeg0435-Msmeg0436 To be Published 0 0 0 0 3KZ0 20363230 MCL-1 complex with MCL-1-specific selected peptide 2009-12-07 2010-05-05 Dutta, S.,Gulla, S.,Chen, T.S.,Fire, E.,Grant, R.A.,Keating, A.E. Determinants of BH3 binding specificity for Mcl-1 versus Bcl-xL. J.Mol.Biol. 2010 398 747 762 3LX9 20444686 Interconversion of Human Lysosomal Enzyme Specificities 2010-02-25 2010-05-05 Tomasic, I.B.,Metcalf, M.C.,Guce, A.I.,Clark, N.E.,Garman, S.C. Interconversion of the specificities of human lysosomal enzymes associated with Fabry and Schindler diseases. J.Biol.Chem. 2010 285 21560 21566 3LXC 20444686 Interconversion of Human Lysosomal Enzyme Specificities 2010-02-25 2010-05-05 Tomasic, I.B.,Metcalf, M.C.,Guce, A.I.,Clark, N.E.,Garman, S.C. Interconversion of the specificities of human lysosomal enzymes associated with Fabry and Schindler diseases. J.Biol.Chem. 2010 285 21560 21566 3L1E 20440841 Bovine AlphaA crystallin Zinc Bound 2009-12-11 2010-05-12 Laganowsky, A.,Benesch, J.L.,Landau, M.,Ding, L.,Sawaya, M.R.,Cascio, D.,Huang, Q.,Robinson, C.V.,Horwitz, J.,Eisenberg, D. Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function. Protein Sci. 2010 19 1031 1043 3L1G 20440841 Human AlphaB crystallin 2009-12-11 2010-05-12 Laganowsky, A.,Benesch, J.L.,Landau, M.,Ding, L.,Sawaya, M.R.,Cascio, D.,Huang, Q.,Robinson, C.V.,Horwitz, J.,Eisenberg, D. Crystal structures of truncated alphaA and alphaB crystallins reveal structural mechanisms of polydispersity important for eye lens function. Protein Sci. 2010 19 1031 1043 3LJ0 20417606 IRE1 complexed with ADP and Quercetin 2010-01-25 2010-05-12 Wiseman, R.L.,Zhang, Y.,Lee, K.P.,Harding, H.P.,Haynes, C.M.,Price, J.,Sicheri, F.,Ron, D. Flavonol activation defines an unanticipated ligand-binding site in the kinase-RNase domain of IRE1. Mol.Cell 2010 38 291 304 3LJ1 20417606 IRE1 complexed with Cdk1/2 Inhibitor III 2010-01-25 2010-05-12 Wiseman, R.L.,Zhang, Y.,Lee, K.P.,Harding, H.P.,Haynes, C.M.,Price, J.,Sicheri, F.,Ron, D. Flavonol activation defines an unanticipated ligand-binding site in the kinase-RNase domain of IRE1. Mol.Cell 2010 38 291 304 3LJ2 20417606 IRE1 complexed with JAK Inhibitor I 2010-01-25 2010-05-12 Wiseman, R.L.,Zhang, Y.,Lee, K.P.,Harding, H.P.,Haynes, C.M.,Price, J.,Sicheri, F.,Ron, D. Flavonol activation defines an unanticipated ligand-binding site in the kinase-RNase domain of IRE1. Mol.Cell 2010 38 291 304 3MLG 21068371 2ouf-2x, a designed knotted protein 2010-04-16 2010-05-12 King, N.P.,Jacobitz, A.W.,Sawaya, M.R.,Goldschmidt, L.,Yeates, T.O. Structure and folding of a designed knotted protein. Proc.Natl.Acad.Sci.USA 2010 107 20732 20737 3F5W KcsA Potassium channel in the open-inactivated state with 32 A opening at T112 2008-11-04 2010-05-19 Cuello, L.G.,Jogini, V.,Cortes, D.M.,Perozo, E. KcsA Potassium channel in the open-inactivated state with 32 A opening at T112 TO BE PUBLISHED 0 0 0 0 3F7V KcsA Potassium channel in the open-inactivated state with 23 A opening at T112 2008-11-10 2010-05-19 Cuello, L.G.,Jogini, V.,Cortes, D.M.,Perozo, E. KcsA Potassium channel in the open-inactivated state with 23 A opening at T112 TO BE PUBLISHED 0 0 0 0 3F7Y KcsA Potassium channel in the partially open state with 17 A opening at T112 2008-11-10 2010-05-19 Cuello, L.G.,Jogini, V.,Cortes, D.M.,Perozo, E. KcsA Potassium channel in the partially open state with 17 A opening at T112 TO BE PUBLISHED 0 0 0 0 3FB5 KcsA potassium channel in the partially open state with 14.5 A opening at T112 2008-11-18 2010-05-19 Cuello, L.G.,Jogini, V.,Cortes, D.M.,Perozo, E. KcsA potassium channel in the partially open state with 14.5 A opening at T112 TO BE PUBLISHED 0 0 0 0 3FB6 KcsA Potassium channel in the partially open state with 16 A opening at T112 2008-11-18 2010-05-19 Cuello, L.G.,Jogini, V.,Cortes, D.M.,Perozo, E. KcsA Potassium channel in the partially open state with 16 A opening at T112 TO BE PUBLISHED 0 0 0 0 3K53 20123128 Crystal Structure of NFeoB from P. furiosus 2009-10-06 2010-05-26 Hung, K.W.,Chang, Y.W.,Eng, E.T.,Chen, J.H.,Chen, Y.C.,Sun, Y.J.,Hsiao, C.D.,Dong, G.,Spasov, K.A.,Unger, V.M.,Huang, T.H. Structural fold, conservation and Fe(II) binding of the intracellular domain of prokaryote FeoB. J.Struct.Biol. 2010 170 501 512 3MKH 20481475 Podospora anserina Nitroalkane Oxidase 2010-04-14 2010-06-02 Tormos, J.R.,Taylor, A.B.,Daubner, S.C.,Hart, P.J.,Fitzpatrick, P.F. Identification of a hypothetical protein from Podospora anserina as a nitroalkane oxidase. Biochemistry 2010 49 5035 5041 3MI9 20535204 Crystal structure of HIV-1 Tat complexed with human P-TEFb 2010-04-09 2010-06-09 Tahirov, T.H.,Babayeva, N.D.,Varzavand, K.,Cooper, J.J.,Sedore, S.C.,Price, D.H. Crystal structure of HIV-1 Tat complexed with human P-TEFb. Nature 2010 465 747 751 3MIA 20535204 Crystal structure of HIV-1 Tat complexed with ATP-bound human P-TEFb 2010-04-09 2010-06-09 Tahirov, T.H.,Babayeva, N.D.,Varzavand, K.,Cooper, J.J.,Sedore, S.C.,Price, D.H. Crystal structure of HIV-1 Tat complexed with human P-TEFb. Nature 2010 465 747 751 3MT5 20508092 Crystal Structure of the Human BK Gating Apparatus 2010-04-30 2010-06-09 Yuan, P.,Leonetti, M.D.,Pico, A.R.,Hsiung, Y.,MacKinnon, R. Structure of the human BK channel Ca2+-activation apparatus at 3.0 A resolution. Science 2010 329 182 186 3M9M 20512114 Crystal Structure of Dpo4 in complex with DNA containing the major cisplatin lesion 2010-03-22 2010-06-16 Wong, J.H.,Brown, J.A.,Suo, Z.,Blum, P.,Nohmi, T.,Ling, H. Structural insight into dynamic bypass of the major cisplatin-DNA adduct by Y-family polymerase Dpo4. Embo J. 2010 29 2059 2069 3M9N 20512114 Crystal Structure of Dpo4 in complex with DNA containing the major cisplatin lesion 2010-03-22 2010-06-16 Wong, J.H.,Brown, J.A.,Suo, Z.,Blum, P.,Nohmi, T.,Ling, H. Structural insight into dynamic bypass of the major cisplatin-DNA adduct by Y-family polymerase Dpo4. Embo J. 2010 29 2059 2069 3M9O 20512114 Crystal Structure of Dpo4 in complex with DNA containing the major cisplatin lesion 2010-03-22 2010-06-16 Wong, J.H.,Brown, J.A.,Suo, Z.,Blum, P.,Nohmi, T.,Ling, H. Structural insight into dynamic bypass of the major cisplatin-DNA adduct by Y-family polymerase Dpo4. Embo J. 2010 29 2059 2069 3HPL 20613845 KcsA E71H-F103A mutant in the closed state 2009-06-04 2010-06-23 Cuello, L.G.,Jogini, V.,Cortes, D.M.,Pan, A.C.,Gagnon, D.G.,Dalmas, O.,Cordero-Morales, J.F.,Chakrapani, S.,Roux, B.,Perozo, E. Structural basis for the coupling between activation and inactivation gates in K(+) channels. Nature 2010 466 272 275 3LZC 20559380 Crystal structure of Dph2 from Pyrococcus horikoshii 2010-03-01 2010-06-23 Zhang, Y.,Zhu, X.,Torelli, A.T.,Lee, M.,Dzikovski, B.,Koralewski, R.M.,Wang, E.,Freed, J.,Krebs, C.,Ealick, S.E.,Lin, H. Diphthamide biosynthesis requires an organic radical generated by an iron-sulphur enzyme. Nature 2010 465 891 896 3MFI 20577207 DNA Polymerase Eta in Complex With a cis-syn Thymidine Dimer 2010-04-02 2010-06-23 Silverstein, T.D.,Johnson, R.E.,Jain, R.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis for the suppression of skin cancers by DNA polymerase eta. Nature 2010 465 1039 1043 3MK8 20562877 The MCL-1 BH3 Helix is an Exclusive MCL-1 Inhibitor and Apoptosis Sensitizer 2010-04-14 2010-06-23 Stewart, M.L.,Fire, E.,Keating, A.E.,Walensky, L.D. The MCL-1 BH3 helix is an exclusive MCL-1 inhibitor and apoptosis sensitizer. Nat.Chem.Biol. 2010 6 595 601 3MZ3 20545365 Crystal structure of Co2+ HDAC8 complexed with M344 2010-05-11 2010-06-23 Dowling, D.P.,Gattis, S.G.,Fierke, C.A.,Christianson, D.W. Structures of metal-substituted human histone deacetylase 8 provide mechanistic inferences on biological function. Biochemistry 2010 49 5048 5056 3MZ6 20545365 Crystal structure of D101L Fe2+ HDAC8 complexed with M344 2010-05-11 2010-06-23 Dowling, D.P.,Gattis, S.G.,Fierke, C.A.,Christianson, D.W. Structures of metal-substituted human histone deacetylase 8 provide mechanistic inferences on biological function. Biochemistry 2010 49 5048 5056 3MZ7 20545365 Crystal structure of D101L Co2+ HDAC8 complexed with M344 2010-05-11 2010-06-23 Dowling, D.P.,Gattis, S.G.,Fierke, C.A.,Christianson, D.W. Structures of metal-substituted human histone deacetylase 8 provide mechanistic inferences on biological function. Biochemistry 2010 49 5048 5056 3HGG Crystal Structure of CmeR Bound to Cholic Acid 2009-05-13 2010-06-30 Routh, M.D.,Yang, F.,Su, C.-C.,Long, F.,Zhang, Q.,Yu, E.W. Structural basis for anionic ligand recognition by multidrug binding proteins: Crystal structures of CmeR-bile acid complexes To be Published 0 0 0 0 3HGY Crystal Structure of CmeR Bound to Taurocholic Acid 2009-05-14 2010-06-30 Routh, M.D.,Yang, F.,Su, C.-C.,Zhang, Q.,Yu, E.W. Structural basis for anionic ligand recognition by multidrug binding proteins: crystal structures of CmeR-bile acid complexes To be Published 0 0 0 0 3MX0 20505120 Crystal Structure of EphA2 ectodomain in complex with ephrin-A5 2010-05-06 2010-06-30 Himanen, J.P.,Yermekbayeva, L.,Janes, P.W.,Walker, J.R.,Xu, K.,Atapattu, L.,Rajashankar, K.R.,Mensinga, A.,Lackmann, M.,Nikolov, D.B.,Dhe-Paganon, S. Architecture of Eph receptor clusters. Proc.Natl.Acad.Sci.USA 2010 107 10860 10865 3LQI 20541251 Crystal structure of MLL1 PHD3-Bromo complexed with H3(1-9)K4me2 peptide 2010-02-09 2010-07-07 Wang, Z.,Song, J.,Milne, T.A.,Wang, G.G.,Li, H.,Allis, C.D.,Patel, D.J. Pro isomerization in MLL1 PHD3-bromo cassette connects H3K4me readout to CyP33 and HDAC-mediated repression. Cell(Cambridge,Mass.) 2010 141 1183 1194 3M1C 20601960 Crystal structure of the conserved herpesvirus fusion regulator complex gH-gL 2010-03-04 2010-07-07 Chowdary, T.K.,Cairns, T.M.,Atanasiu, D.,Cohen, G.H.,Eisenberg, R.J.,Heldwein, E.E. Crystal structure of the conserved herpesvirus fusion regulator complex gH-gL. Nat.Struct.Mol.Biol. 2010 17 882 888 3FB7 Open KcsA potassium channel in the presence of Rb+ ion 2008-11-18 2010-07-14 Cuello, L.G.,Jogini, V.,Cortes, D.M.,Pan, A.C.,Gagnon, D.H.,Cordero-Morales, J.F.,Chakrapani, S.,Roux, B.,Perozo, E. Open KcsA potassium channel in the presence of Rb+ ion TO BE PUBLISHED 0 0 0 0 3KTU Structure of human 8-oxoGuanine Glycosylase 1 bound to fluorninated oxoG-containing DNA 2009-11-26 2010-07-14 Verdine, G.L.,Lee, S.M. Structural investigation of hOGG1 bound to a fluorinated oxoG analog to be published 0 0 0 0 3L2P 20518483 Human DNA Ligase III Recognizes DNA Ends by Dynamic Switching Between Two DNA Bound States 2009-12-15 2010-07-14 Cotner-Gohara, E.,Kim, I.K.,Hammel, M.,Tainer, J.A.,Tomkinson, A.E.,Ellenberger, T. Human DNA Ligase III Recognizes DNA Ends by Dynamic Switching between Two DNA-Bound States. Biochemistry 2010 49 6165 6176 3NRZ 20615869 Crystal Structure of Bovine Xanthine Oxidase in Complex with Hypoxanthine 2010-07-01 2010-07-14 Cao, H.,Pauff, J.M.,Hille, R. Substrate orientation and catalytic specificity in the action of xanthine oxidase: the sequential hydroxylation of hypoxanthine to uric acid. J.Biol.Chem. 2010 285 28044 28053 3NYB 20696927 Structure and function of the polymerase core of TRAMP, a RNA surveillance complex 2010-07-14 2010-08-04 Hamill, S.,Wolin, S.L.,Reinisch, K.M. Structure and function of the polymerase core of TRAMP, a RNA surveillance complex. Proc.Natl.Acad.Sci.USA 2010 107 15045 15050 3KH2 20696400 Crystal structure of the P1 bacteriophage Doc toxin (F68S) in complex with the Phd antitoxin (L17M/V39A). Northeast Structural Genomics targets ER385-ER386 2009-10-29 2010-08-18 Arbing, M.A.,Handelman, S.K.,Kuzin, A.P.,Verdon, G.,Wang, C.,Su, M.,Rothenbacher, F.P.,Abashidze, M.,Liu, M.,Hurley, J.M.,Xiao, R.,Acton, T.,Inouye, M.,Montelione, G.T.,Woychik, N.A.,Hunt, J.F. Crystal Structures of Phd-Doc, HigA, and YeeU Establish Multiple Evolutionary Links between Microbial Growth-Regulating Toxin-Antitoxin Systems. Structure 2010 18 996 1010 3MFK 20686355 Ets1 complex with stromelysin-1 promoter DNA 2010-04-02 2010-08-18 Babayeva, N.D.,Wilder, P.J.,Shiina, M.,Mino, K.,Desler, M.,Ogata, K.,Rizzino, A.,Tahirov, T.H. Structural basis of Ets1 cooperative binding to palindromic sequences on stromelysin-1 promoter DNA. Cell Cycle 2010 9 3054 3062 3MZK 20696705 Sec13/Sec16 complex, S.cerevisiae 2010-05-12 2010-08-18 Whittle, J.R.,Schwartz, T.U. Structure of the Sec13-Sec16 edge element, a template for assembly of the COPII vesicle coat. J.Cell Biol. 2010 190 347 361 3MZL 20696705 Sec13/Sec31 edge element, loop deletion mutant 2010-05-12 2010-08-18 Whittle, J.R.,Schwartz, T.U. Structure of the Sec13-Sec16 edge element, a template for assembly of the COPII vesicle coat. J.Cell Biol. 2010 190 347 361 3LGI 20739286 Structure of the protease domain of DegS (DegS-deltaPDZ) at 1.65 A 2010-01-20 2010-08-25 Sohn, J.,Grant, R.A.,Sauer, R.T. Allostery is an intrinsic property of the protease domain of DegS: implications for enzyme function and evolution. J.Biol.Chem. 2010 285 34039 34047 3LH1 20739286 Q191A mutant of the DegS-deltaPDZ 2010-01-21 2010-08-25 Sohn, J.,Grant, R.A.,Sauer, R.T. Allostery is an intrinsic property of the protease domain of DegS: implications for enzyme function and evolution. J.Biol.Chem. 2010 285 34039 34047 3LH3 20739286 DFP modified DegS delta PDZ 2010-01-21 2010-08-25 Sohn, J.,Grant, R.A.,Sauer, R.T. Allostery is an intrinsic property of the protease domain of DegS: implications for enzyme function and evolution. J.Biol.Chem. 2010 285 34039 34047 3OGI 24312350 Crystal structure of the Mycobacterium tuberculosis H37Rv EsxOP complex (Rv2346c-Rv2347c) 2010-08-16 2010-08-25 Arbing, M.A.,Chan, S.,Harris, L.,Kuo, E.,Zhou, T.T.,Ahn, C.J.,Nguyen, L.,He, Q.,Lu, J.,Menchavez, P.T.,Shin, A.,Holton, T.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Heterologous expression of mycobacterial Esx complexes in Escherichia coli for structural studies is facilitated by the use of maltose binding protein fusions. Plos One 2013 8 0 0 3N4R 20723757 Structure of Csm1 C-terminal domain, R3 form 2010-05-22 2010-09-01 Corbett, K.D.,Yip, C.K.,Ee, L.S.,Walz, T.,Amon, A.,Harrison, S.C. The Monopolin Complex Crosslinks Kinetochore Components to Regulate Chromosome-Microtubule Attachments. Cell(Cambridge,Mass.) 2010 142 556 567 3N4S 20723757 Structure of Csm1 C-terminal domain, P21212 form 2010-05-22 2010-09-01 Corbett, K.D.,Yip, C.K.,Ee, L.S.,Walz, T.,Amon, A.,Harrison, S.C. The Monopolin Complex Crosslinks Kinetochore Components to Regulate Chromosome-Microtubule Attachments. Cell(Cambridge,Mass.) 2010 142 556 567 3NS4 20660722 Structure of a C-terminal fragment of its Vps53 subunit suggests similarity of GARP to a family of tethering complexes 2010-07-01 2010-09-15 Vasan, N.,Hutagalung, A.,Novick, P.,Reinisch, K.M. Structure of a C-terminal fragment of its Vps53 subunit suggests similarity of Golgi-associated retrograde protein (GARP) complex to a family of tethering complexes. Proc.Natl.Acad.Sci.USA 2010 107 14176 14181 3O4Z 20801936 Tel2 structure and function in the Hsp90-dependent maturation of mTOR and ATR complexes 2010-07-27 2010-09-15 Takai, H.,Xie, Y.,de Lange, T.,Pavletich, N.P. Tel2 structure and function in the Hsp90-dependent maturation of mTOR and ATR complexes. Genes Dev. 2010 24 2019 2030 3O6B 20832729 A Dual E3 Mechanism for Rub1 Ligation to Cdc53: Dcn1(P)-Cdc53(WHB) low resolution 2010-07-28 2010-09-15 Scott, D.C.,Monda, J.K.,Grace, C.R.,Duda, D.M.,Kriwacki, R.W.,Kurz, T.,Schulman, B.A. A dual E3 mechanism for Rub1 ligation to Cdc53. Mol.Cell 2010 39 784 796 3OGD 20843803 AlkA Undamaged DNA Complex: Interrogation of a G*:C base pair 2010-08-16 2010-09-15 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of Escherichia coli AlkA in Complex with Undamaged DNA. J.Biol.Chem. 2010 285 35783 35791 3OH6 20843803 AlkA Undamaged DNA Complex: Interrogation of a C:G base pair 2010-08-17 2010-09-15 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of Escherichia coli AlkA in Complex with Undamaged DNA. J.Biol.Chem. 2010 285 35783 35791 3OH9 20843803 AlkA Undamaged DNA Complex: Interrogation of a T:A base pair 2010-08-17 2010-09-15 Bowman, B.R.,Lee, S.,Wang, S.,Verdine, G.L. Structure of Escherichia coli AlkA in Complex with Undamaged DNA. J.Biol.Chem. 2010 285 35783 35791 3K07 20865003 Crystal structure of CusA 2009-09-24 2010-09-22 Long, F.,Su, C.C.,Zimmermann, M.T.,Boyken, S.E.,Rajashankar, K.R.,Jernigan, R.L.,Yu, E.W. Crystal structures of the CusA efflux pump suggest methionine-mediated metal transport. Nature 2010 467 484 488 3KSO 20865003 Structure and Mechanism of the Heavy Metal Transporter CusA 2009-11-23 2010-09-22 Long, F.,Su, C.C.,Zimmermann, M.T.,Boyken, S.E.,Rajashankar, K.R.,Jernigan, R.L.,Yu, E.W. Crystal structures of the CusA efflux pump suggest methionine-mediated metal transport. Nature 2010 467 484 488 3KSS 20865003 Structure and Mechanism of the Heavy Metal Transporter CusA 2009-11-23 2010-09-22 Long, F.,Su, C.C.,Zimmermann, M.T.,Boyken, S.E.,Rajashankar, K.R.,Jernigan, R.L.,Yu, E.W. Crystal structures of the CusA efflux pump suggest methionine-mediated metal transport. Nature 2010 467 484 488 3OTO 20962038 Crystal Structure of the 30S ribosomal subunit from a KsgA mutant of Thermus thermophilus (HB8) 2010-09-13 2010-09-29 Demirci, H.,Murphy, F.,Belardinelli, R.,Kelley, A.C.,Ramakrishnan, V.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. Modification of 16S ribosomal RNA by the KsgA methyltransferase restructures the 30S subunit to optimize ribosome function. Rna 2010 16 2319 2324 3N79 20870711 PduT C38S Mutant from Salmonella enterica Typhimurium 2010-05-26 2010-10-06 Crowley, C.S.,Cascio, D.,Sawaya, M.R.,Kopstein, J.S.,Bobik, T.A.,Yeates, T.O. Structural Insight into the Mechanisms of Transport across the Salmonella enterica Pdu Microcompartment Shell. J.Biol.Chem. 2010 285 37838 37846 3NGK 20870711 PduA from Salmonella enterica Typhimurium 2010-06-11 2010-10-06 Crowley, C.S.,Cascio, D.,Sawaya, M.R.,Kopstein, J.S.,Bobik, T.A.,Yeates, T.O. Structural Insight into the Mechanisms of Transport across the Salmonella enterica Pdu Microcompartment Shell. J.Biol.Chem. 2010 285 37838 37846 3NGK 20870711 PduA from Salmonella enterica Typhimurium 2010-06-11 2010-10-06 Crowley, C.S.,Cascio, D.,Sawaya, M.R.,Kopstein, J.S.,Bobik, T.A.,Yeates, T.O. Structural Insight into the Mechanisms of Transport across the Salmonella enterica Pdu Microcompartment Shell. J.Biol.Chem. 2010 285 37838 37846 3ORG 20929736 Crystal Structure of a eukaryotic CLC transporter 2010-09-07 2010-10-06 Feng, L.,Campbell, E.B.,Hsiung, Y.,MacKinnon, R. Structure of a eukaryotic CLC transporter defines an intermediate state in the transport cycle. Science 2010 330 635 641 3K0I Crystal structure of Cu(I)CusA 2009-09-24 2010-10-13 Long, F.,Su, C.-C.,Routh, M.D.,Rajashankar, K.R.,Yu, E.W. Crystal structure of CusA To be Published 0 0 0 0 3OQ9 20935634 Structure of the FAS/FADD death domain assembly 2010-09-02 2010-10-13 Wang, L.,Yang, J.K.,Kabaleeswaran, V.,Rice, A.J.,Cruz, A.C.,Park, A.Y.,Yin, Q.,Damko, E.,Jang, S.B.,Raunser, S.,Robinson, C.V.,Siegel, R.M.,Walz, T.,Wu, H. The Fas-FADD death domain complex structure reveals the basis of DISC assembly and disease mutations. Nat.Struct.Mol.Biol. 2010 17 1324 1329 3OCU 20934434 Structure of Recombinant Haemophilus Influenzae e(P4) Acid Phosphatase mutant D66N complexed with NMN 2010-08-10 2010-10-20 Singh, H.,Schuermann, J.P.,Reilly, T.J.,Calcutt, M.J.,Tanner, J.J. Recognition of nucleoside monophosphate substrates by Haemophilus influenzae class C acid phosphatase. J.Mol.Biol. 2010 404 639 649 3OCY 20934434 Structure of Recombinant Haemophilus Influenzae e(P4) Acid Phosphatase Complexed with inorganic phosphate 2010-08-10 2010-10-20 Singh, H.,Schuermann, J.P.,Reilly, T.J.,Calcutt, M.J.,Tanner, J.J. Recognition of nucleoside monophosphate substrates by Haemophilus influenzae class C acid phosphatase. J.Mol.Biol. 2010 404 639 649 3NBN 20972443 Crystal structure of a dimer of Notch Transcription Complex trimers on HES1 DNA 2010-06-03 2010-11-03 Arnett, K.L.,Hass, M.,McArthur, D.G.,Ilagan, M.X.,Aster, J.C.,Kopan, R.,Blacklow, S.C. Structural and mechanistic insights into cooperative assembly of dimeric Notch transcription complexes. Nat.Struct.Mol.Biol. 2010 17 1312 1317 3OCT Crystal structure of bruton's tyrosine kinase mutant V555R in complex with dasatinib 2010-08-10 2010-11-03 Di Paolo, J.A.,Huang, T.,Balazs, M.,Barbosa, J.,Barck, K.H.,Carano, R.A.D.,Darrow, J.,Davies, D.R.,DeForge, L.E.,Dennis Jr., G.,Diehl, L.,Ferrando, R. A novel, specific Btk inhibitor antagonizes BCR and Fc[gamma]R signaling and suppresses inflammatory arthritis To be Published 0 0 0 0 3OW7 19695261 Crystal structure of the membrane fusion protein CusB from Escherichia coli. 2010-09-17 2010-11-17 Su, C.C.,Yang, F.,Long, F.,Reyon, D.,Routh, M.D.,Kuo, D.W.,Mokhtari, A.K.,Van Ornam, J.D.,Rabe, K.L.,Hoy, J.A.,Lee, Y.J.,Rajashankar, K.R.,Yu, E.W. Crystal structure of the membrane fusion protein CusB from Escherichia coli. J.Mol.Biol. 2009 393 342 355 3KM2 As-isolated TOMATO CHLOROPLAST SUPEROXIDE DISMUTASE 2009-11-09 2010-12-01 Galaleldeen, A.,Taylor, A.B.,Hart, P.J. Biophysical properties of tomato chloroplast sod To be Published 0 0 0 0 3O7O 21082721 Use of synthetic symmetrization in the crystallization and structure determination of CelA from Thermotoga maritima 2010-07-30 2010-12-01 Forse, G.J.,Ram, N.,Banatao, D.R.,Cascio, D.,Sawaya, M.R.,Klock, H.E.,Lesley, S.A.,Yeates, T.O. Synthetic symmetrization in the crystallization and structure determination of CelA from Thermotoga maritima. Protein Sci. 2011 20 168 178 3OII 21087996 Crystal structure of Saccharomyces Cerevisiae Nep1/Emg1 bound to S-adenosylhomocysteine 2010-08-19 2010-12-01 Thomas, S.R.,Keller, C.A.,Szyk, A.,Cannon, J.R.,Laronde-Leblanc, N.A. Structural insight into the functional mechanism of Nep1/Emg1 N1-specific pseudouridine methyltransferase in ribosome biogenesis. Nucleic Acids Res. 2011 39 2445 2457 3OIJ 21087996 Crystal structure of Saccharomyces Cerevisiae Nep1/Emg1 bound to S-adenosylhomocysteine and 2 molecules of cognate RNA 2010-08-19 2010-12-01 Thomas, S.R.,Keller, C.A.,Szyk, A.,Cannon, J.R.,Laronde-Leblanc, N.A. Structural insight into the functional mechanism of Nep1/Emg1 N1-specific pseudouridine methyltransferase in ribosome biogenesis. Nucleic Acids Res. 2011 39 2445 2457 3OIN 21087996 Crystal structure of Saccharomyces cerevisiae Nep1/Emg1 bound to S-adenosylhomocysteine and 1 molecule of cognate RNA 2010-08-19 2010-12-01 Thomas, S.R.,Keller, C.A.,Szyk, A.,Cannon, J.R.,Laronde-Leblanc, N.A. Structural insight into the functional mechanism of Nep1/Emg1 N1-specific pseudouridine methyltransferase in ribosome biogenesis. Nucleic Acids Res. 2011 39 2445 2457 3OUI 24900242 PHD2-R717 with 40787422 2010-09-14 2010-12-01 Rosen, M.D.,Venkatesan, H.,Peltier, H.M.,Bembenek, S.D.,Kanelakis, K.C.,Zhao, L.X.,Leonard, B.E.,Hocutt, F.M.,Wu, X.,Palomino, H.L.,Brondstetter, T.I.,Haugh, P.V.,Cagnon, L.,Yan, W.,Liotta, L.A.,Young, A.,Mirzadegan, T.,Shankley, N.P.,Barrett, T.D.,Rabinowitz, M.H. Benzimidazole-2-pyrazole HIF Prolyl 4-Hydroxylase Inhibitors as Oral Erythropoietin Secretagogues. ACS Med Chem Lett 2010 1 526 529 3LOW 21131979 Crystal structure of Beta 2 Microglobulin domain-swapped dimer 2010-02-04 2010-12-08 Liu, C.,Sawaya, M.R.,Eisenberg, D. Beta2-microglobulin forms three-dimensional domain-swapped amyloid fibrils with disulfide linkages. Nat.Struct.Mol.Biol. 2011 18 49 55 3KX9 24030827 Engineering a closed form of the Archaeoglobus fulgidus ferritin by site directed mutagenesis 2009-12-02 2010-12-15 Sana, B.,Johnson, E.,Le Magueres, P.,Criswell, A.,Cascio, D.,Lim, S. The role of nonconserved residues of Archaeoglobus fulgidus ferritin on its unique structure and biophysical properties. J.Biol.Chem. 2013 288 32663 32672 3O2D 21134642 Crystal structure of HIV-1 primary receptor CD4 in complex with a potent antiviral antibody 2010-07-22 2010-12-22 Freeman, M.M.,Seaman, M.S.,Rits-Volloch, S.,Hong, X.,Kao, C.Y.,Ho, D.D.,Chen, B. Crystal Structure of HIV-1 Primary Receptor CD4 in Complex with a Potent Antiviral Antibody. Structure 2010 18 1632 1641 3OHB 21070945 Yeast DNA polymerase eta extending from an 8-oxoG lesion 2010-08-17 2010-12-22 Silverstein, T.D.,Jain, R.,Johnson, R.E.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis for error-free replication of oxidatively damaged DNA by yeast DNA polymerase eta. Structure 2010 18 1463 1470 3OOC 19695261 Crystal structure of the membrane fusion protein CusB from Escherichia coli 2010-08-30 2010-12-29 Su, C.C.,Yang, F.,Long, F.,Reyon, D.,Routh, M.D.,Kuo, D.W.,Mokhtari, A.K.,Van Ornam, J.D.,Rabe, K.L.,Hoy, J.A.,Lee, Y.J.,Rajashankar, K.R.,Yu, E.W. Crystal structure of the membrane fusion protein CusB from Escherichia coli. J.Mol.Biol. 2009 393 342 355 3PT6 21163962 Crystal structure of mouse DNMT1(650-1602) in complex with DNA 2010-12-02 2010-12-29 Song, J.,Rechkoblit, O.,Bestor, T.H.,Patel, D.J. Structure of DNMT1-DNA complex reveals a role for autoinhibition in maintenance DNA methylation. Science 2011 331 1036 1040 3PTA 21163962 Crystal structure of human DNMT1(646-1600) in complex with DNA 2010-12-02 2010-12-29 Song, J.,Rechkoblit, O.,Bestor, T.H.,Patel, D.J. Structure of DNMT1-DNA complex reveals a role for autoinhibition in maintenance DNA methylation. Science 2011 331 1036 1040 3O62 21168769 Nucleosome core particle modified with a cisplatin 1,3-cis-{Pt(NH3)2}2+-d(GpTpG) intrastrand cross-link 2010-07-28 2011-01-05 Todd, R.C.,Lippard, S.J. Consequences of Cisplatin binding on nucleosome structure and dynamics. Chem.Biol. 2010 17 1334 1343 3LL8 22343722 Crystal Structure of Calcineurin in Complex with AKAP79 Peptide 2010-01-28 2011-01-12 Li, H.,Pink, M.D.,Murphy, J.G.,Stein, A.,Dell'acqua, M.L.,Hogan, P.G. Balanced interactions of calcineurin with AKAP79 regulate Ca(2+)-calcineurin-NFAT signaling. Nat.Struct.Mol.Biol. 2012 19 337 345 3O3I 21193640 Crystal Structure of human Hiwi1 PAZ domain (residues 277-399) in complex with 14-mer RNA (12-bp + 2-nt overhang) containing 2'-OH at its 3'-end 2010-07-24 2011-01-12 Tian, Y.,Simanshu, D.K.,Ma, J.B.,Patel, D.J. Inaugural Article: Structural basis for piRNA 2'-O-methylated 3'-end recognition by Piwi PAZ (Piwi/Argonaute/Zwille) domains. Proc.Natl.Acad.Sci.USA 2011 108 903 910 3O7V 21193640 Crystal Structure of human Hiwi1 (V361M) PAZ domain (residues 277-399) in complex with 14-mer RNA (12-bp + 2-nt overhang) containing 2'-OCH3 at its 3'-end 2010-08-01 2011-01-12 Tian, Y.,Simanshu, D.K.,Ma, J.B.,Patel, D.J. Inaugural Article: Structural basis for piRNA 2'-O-methylated 3'-end recognition by Piwi PAZ (Piwi/Argonaute/Zwille) domains. Proc.Natl.Acad.Sci.USA 2011 108 903 910 3O90 20853856 High resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into catalytic mechanism and inhibition by aldehydes 2010-08-03 2011-01-12 French, J.B.,Cen, Y.,Sauve, A.A.,Ealick, S.E. High-resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into the catalytic mechanism and inhibition by aldehydes . Biochemistry 2010 49 8803 8812 3O91 20853856 High resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into catalytic mechanism and inhibition by aldehydes 2010-08-03 2011-01-12 French, J.B.,Cen, Y.,Sauve, A.A.,Ealick, S.E. High-resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into the catalytic mechanism and inhibition by aldehydes . Biochemistry 2010 49 8803 8812 3O93 20853856 High resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into catalytic mechanism and inhibition by aldehydes 2010-08-03 2011-01-12 French, J.B.,Cen, Y.,Sauve, A.A.,Ealick, S.E. High-resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into the catalytic mechanism and inhibition by aldehydes . Biochemistry 2010 49 8803 8812 3O94 20853856 High resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into catalytic mechanism and inhibition by aldehydes 2010-08-03 2011-01-12 French, J.B.,Cen, Y.,Sauve, A.A.,Ealick, S.E. High-resolution crystal structures of Streptococcus pneumoniae nicotinamidase with trapped intermediates provide insights into the catalytic mechanism and inhibition by aldehydes . Biochemistry 2010 49 8803 8812 3PKV 21166463 Crystal Structure of Toxoflavin Lyase (TflA) 2010-11-12 2011-01-12 Fenwick, M.K.,Philmus, B.,Begley, T.P.,Ealick, S.E. Toxoflavin lyase requires a novel 1-his-2-carboxylate facial triad . Biochemistry 2011 50 1091 1100 3O7B 21087996 Crystal structure of Archaeoglobus Fulgidus Nep1 bound to S-adenosylhomocysteine 2010-07-30 2011-01-19 Thomas, S.R.,Keller, C.A.,Szyk, A.,Cannon, J.R.,Laronde-Leblanc, N.A. Structural insight into the functional mechanism of Nep1/Emg1 N1-specific pseudouridine methyltransferase in ribosome biogenesis. Nucleic Acids Res. 2011 39 2445 2457 3OTP 21458668 Crystal structure of the DegP dodecamer with a model substrate 2010-09-13 2011-01-19 Kim, S.,Grant, R.A.,Sauer, R.T. Covalent Linkage of Distinct Substrate Degrons Controls Assembly and Disassembly of DegP Proteolytic Cages. Cell(Cambridge,Mass.) 2011 145 67 78 3PJZ 21317882 Crystal Structure of the Potassium Transporter TrkH from Vibrio parahaemolyticus 2010-11-10 2011-01-19 Cao, Y.,Jin, X.,Huang, H.,Derebe, M.G.,Levin, E.J.,Kabaleeswaran, V.,Pan, Y.,Punta, M.,Love, J.,Weng, J.,Quick, M.,Ye, S.,Kloss, B.,Bruni, R.,Martinez-Hackert, E.,Hendrickson, W.A.,Rost, B.,Javitch, J.A.,Rajashankar, K.R.,Jiang, Y.,Zhou, M. Crystal structure of a potassium ion transporter, TrkH. Nature 2011 471 336 340 3PWX Structure of putative flagellar hook-associated protein from Vibrio parahaemolyticus 2010-12-09 2011-01-19 Ramagopal, U.A.,Patskovsky, Y.,Toro, R.,Burley, S.K.,Almo, S.C. Structure of putative flagellar hook-associated protein from Vibrio parahaemolyticus To be published 0 0 0 0 3P2D 21215759 Crystal structure of arrestin-3 reveals the basis of the difference in receptor binding between two non-visual subtypes 2010-10-01 2011-01-26 Zhan, X.,Gimenez, L.E.,Gurevich, V.V.,Spiller, B.W. Crystal Structure of Arrestin-3 Reveals the Basis of the Difference in Receptor Binding Between Two Non-visual Subtypes. J.Mol.Biol. 2011 406 467 478 3PUS 21167174 PHF2 Jumonji-NOG-Ni(II) 2010-12-06 2011-01-26 Horton, J.R.,Upadhyay, A.K.,Hashimoto, H.,Zhang, X.,Cheng, X. Structural basis for human PHF2 Jumonji domain interaction with metal ions. J.Mol.Biol. 2011 406 1 8 3Q0B 21245167 Crystal structure of SUVH5 SRA- fully methylated CG DNA complex in space group P42212 2010-12-15 2011-02-02 Rajakumara, E.,Law, J.A.,Simanshu, D.K.,Voigt, P.,Johnson, L.M.,Reinberg, D.,Patel, D.J.,Jacobsen, S.E. A dual flip-out mechanism for 5mC recognition by the Arabidopsis SUVH5 SRA domain and its impact on DNA methylation and H3K9 dimethylation in vivo. Genes Dev. 2011 25 137 152 3PLY 21268585 Structure of Oxidized P96G Mutant of Amicyanin 2010-11-15 2011-02-09 Choi, M.,Sukumar, N.,Mathews, F.S.,Liu, A.,Davidson, V.L. Proline 96 of the copper ligand loop of amicyanin regulates electron transfer from methylamine dehydrogenase by positioning other residues at the protein-protein interface. Biochemistry 2011 50 1265 1273 3OLP 21246636 Crystal structure of a bacterial phosphoglucomutase, an enzyme important in the virulence of multiple human pathogens 2010-08-26 2011-02-16 Mehra-Chaudhary, R.,Mick, J.,Tanner, J.J.,Henzl, M.T.,Beamer, L.J. Crystal structure of a bacterial phosphoglucomutase, an enzyme involved in the virulence of multiple human pathogens. Proteins 2011 79 1215 1229 3Q0D 21245167 Crystal structure of SUVH5 SRA- hemi methylated CG DNA complex 2010-12-15 2011-02-23 Rajakumara, E.,Law, J.A.,Simanshu, D.K.,Voigt, P.,Johnson, L.M.,Reinberg, D.,Patel, D.J.,Jacobsen, S.E. A dual flip-out mechanism for 5mC recognition by the Arabidopsis SUVH5 SRA domain and its impact on DNA methylation and H3K9 dimethylation in vivo. Genes Dev. 2011 25 137 152 3Q1C 21235237 Structure of EspG Protein 2010-12-17 2011-02-23 Germane, K.L.,Spiller, B.W. Structural and Functional Studies Indicate That the EPEC Effector, EspG, Directly Binds p21-Activated Kinase. Biochemistry 2011 50 917 919 3QJ6 21720545 The crystal structure of PWWP domain of human Hepatoma-derived growth factor 2 in complex with H3K79me3 peptide 2011-01-28 2011-02-23 Wu, H.,Zeng, H.,Lam, R.,Tempel, W.,Amaya, M.F.,Xu, C.,Dombrovski, L.,Qiu, W.,Wang, Y.,Min, J. Structural and Histone Binding Ability Characterizations of Human PWWP Domains. Plos One 2011 6 0 0 3LAF 23038776 Structure of DCC, a netrin-1 receptor 2010-01-06 2011-03-02 Chen, Q.,Sun, X.,Zhou, X.H.,Liu, J.H.,Wu, J.,Zhang, Y.,Wang, J.H. N-terminal horseshoe conformation of DCC is functionally required for axon guidance and might be shared by other neural receptors. J.Cell.Sci. 2013 126 186 195 3NE5 21350490 Crystal structure of the CusBA heavy-metal efflux complex from Escherichia coli 2010-06-08 2011-03-02 Su, C.C.,Long, F.,Zimmermann, M.T.,Rajashankar, K.R.,Jernigan, R.L.,Yu, E.W. Crystal structure of the CusBA heavy-metal efflux complex of Escherichia coli. Nature 2011 470 558 562 3Q9B 21268586 Crystal Structure of APAH complexed with M344 2011-01-07 2011-03-02 Lombardi, P.M.,Angell, H.D.,Whittington, D.A.,Flynn, E.F.,Rajashankar, K.R.,Christianson, D.W. Structure of prokaryotic polyamine deacetylase reveals evolutionary functional relationships with eukaryotic histone deacetylases . Biochemistry 2011 50 1808 1817 3Q9C 21268586 Crystal Structure of H159A APAH complexed with N8-acetylspermidine 2011-01-07 2011-03-02 Lombardi, P.M.,Angell, H.D.,Whittington, D.A.,Flynn, E.F.,Rajashankar, K.R.,Christianson, D.W. Structure of prokaryotic polyamine deacetylase reveals evolutionary functional relationships with eukaryotic histone deacetylases . Biochemistry 2011 50 1808 1817 3Q9F 21268586 Crystal Structure of APAH complexed with CAPS 2011-01-07 2011-03-02 Lombardi, P.M.,Angell, H.D.,Whittington, D.A.,Flynn, E.F.,Rajashankar, K.R.,Christianson, D.W. Structure of prokaryotic polyamine deacetylase reveals evolutionary functional relationships with eukaryotic histone deacetylases . Biochemistry 2011 50 1808 1817 3OEI 23523424 Crystal structure of Mycobacterium tuberculosis RelJK (Rv3357-Rv3358-RelBE3) 2010-08-12 2011-03-16 Miallau, L.,Jain, P.,Arbing, M.A.,Cascio, D.,Phan, T.,Ahn, C.J.,Chan, S.,Chernishof, I.,Maxson, M.,Chiang, J.,Jacobs Jr., W.R.,Eisenberg, D.S. Comparative proteomics identifies the cell-associated lethality of M. tuberculosis RelBE-like toxin-antitoxin complexes. Structure 2013 21 627 637 3O0Z 21445309 Crystal structure of a coiled-coil domain from human ROCK I 2010-07-20 2011-03-23 Tu, D.,Li, Y.,Song, H.K.,Toms, A.V.,Gould, C.J.,Ficarro, S.B.,Marto, J.A.,Goode, B.L.,Eck, M.J. Crystal Structure of a Coiled-Coil Domain from Human ROCK I. Plos One 2011 6 0 0 3QC1 Protein Phosphatase Subunit: Alpha4 2011-01-14 2011-03-30 Spiller, B.W.,LeNoue-Newton, M.L.,Watkins, G.R.,Germane, K.L.,Zhou, P.,McCorvey, L.R.,Wadzinski, B.E. The Mid1 and PP2Ac binding domains of Alpha4 are both required for Alpha4 to inhibit PP2Ac degradation TO BE PUBLISHED 0 0 0 0 3P49 21439473 Crystal Structure of a Glycine Riboswitch from Fusobacterium nucleatum 2010-10-06 2011-04-06 Butler, E.B.,Xiong, Y.,Wang, J.,Strobel, S.A. Structural basis of cooperative ligand binding by the glycine riboswitch. Chem.Biol. 2011 18 293 298 3QA8 21423167 Crystal Structure of inhibitor of kappa B kinase beta 2011-01-10 2011-04-06 Xu, G.,Lo, Y.C.,Li, Q.,Napolitano, G.,Wu, X.,Jiang, X.,Dreano, M.,Karin, M.,Wu, H. Crystal structure of inhibitor of kappa B kinase beta. Nature 2011 472 325 330 3QE5 21505225 Complete structure of Streptococcus mutans Antigen I/II carboxy-terminus 2011-01-19 2011-04-20 Larson, M.R.,Rajashankar, K.R.,Crowley, P.J.,Kelly, C.,Mitchell, T.J.,Brady, L.J.,Deivanayagam, C. Crystal Structure of the C-terminal Region of Streptococcus mutans Antigen I/II and Characterization of Salivary Agglutinin Adherence Domains. J.Biol.Chem. 2011 286 21657 21666 3QW3 21507942 Structure of Leishmania donovani OMP decarboxylase 2011-02-26 2011-04-20 French, J.B.,Yates, P.A.,Soysa, D.R.,Boitz, J.M.,Carter, N.S.,Chang, B.,Ullman, B.,Ealick, S.E. The Leishmania donovani UMP synthase is essential for promastigote viability and has an unusual tetrameric structure that exhibits substrate-controlled oligomerization. J.Biol.Chem. 2011 286 20930 20941 3QW4 21507942 Structure of Leishmania donovani UMP synthase 2011-02-26 2011-04-20 French, J.B.,Yates, P.A.,Soysa, D.R.,Boitz, J.M.,Carter, N.S.,Chang, B.,Ullman, B.,Ealick, S.E. The Leishmania donovani UMP synthase is essential for promastigote viability and has an unusual tetrameric structure that exhibits substrate-controlled oligomerization. J.Biol.Chem. 2011 286 20930 20941 3R4F 21471452 Prohead RNA 2011-03-17 2011-04-20 Ding, F.,Lu, C.,Zhao, W.,Rajashankar, K.R.,Anderson, D.L.,Jardine, P.J.,Grimes, S.,Ke, A. Structure and assembly of the essential RNA ring component of a viral DNA packaging motor. Proc.Natl.Acad.Sci.USA 2011 108 7357 7362 3QVJ 21616082 Allantoin racemase from Klebsiella pneumoniae 2011-02-25 2011-05-04 French, J.B.,Neau, D.B.,Ealick, S.E. Characterization of the Structure and Function of Klebsiella pneumoniae Allantoin Racemase. J.Mol.Biol. 2011 410 447 460 3NB6 20496948 Crystal structure of Aquifex aeolicus peptidoglycan glycosyltransferase in complex with Methylphosphoryl Neryl Moenomycin 2010-06-02 2011-05-18 Fuse, S.,Tsukamoto, H.,Yuan, Y.,Wang, T.S.,Zhang, Y.,Bolla, M.,Walker, S.,Sliz, P.,Kahne, D. Functional and structural analysis of a key region of the cell wall inhibitor moenomycin. Acs Chem.Biol. 2010 5 701 711 3NB7 20496948 Crystal structure of Aquifex Aeolicus Peptidoglycan Glycosyltransferase in complex with Decarboxylated Neryl Moenomycin 2010-06-02 2011-05-18 Fuse, S.,Tsukamoto, H.,Yuan, Y.,Wang, T.S.,Zhang, Y.,Bolla, M.,Walker, S.,Sliz, P.,Kahne, D. Functional and structural analysis of a key region of the cell wall inhibitor moenomycin. Acs Chem.Biol. 2010 5 701 711 3PYA Crystal structure of ent-copalyl diphosphate synthase from Arabidopsis thaliana in complex with (S)-15-aza-14,15-dihydrogeranylgeranyl thiolodiphosphate 2010-12-12 2011-05-25 Koksal, M.,Hu, H.,Coates, R.M.,Peters, R.J.,Christianson, D.W. Structure of ent-Copalyl Diphosphate Synthase from Arabidopsis thaliana, a Protonation-Dependent Diterpene Cyclase To be Published 0 0 0 0 3PYB Crystal structure of ent-copalyl diphosphate synthase from Arabidopsis thaliana in complex with 13-aza-13,14-dihydrocopalyl diphosphate 2010-12-12 2011-05-25 Koksal, M.,Hu, H.,Coates, R.M.,Peters, R.J.,Christianson, D.W. Structure of ent-Copalyl Diphosphate Synthase from Arabidopsis thaliana, a Protonation-Dependent Diterpene Cyclase To be Published 0 0 0 0 3RHW 21572436 C. elegans glutamate-gated chloride channel (GluCl) in complex with Fab and ivermectin 2011-04-12 2011-05-25 Hibbs, R.E.,Gouaux, E. Principles of activation and permeation in an anion-selective Cys-loop receptor. Nature 2011 474 54 60 3RI5 21572436 C. elegans glutamate-gated chloride channel (GluCl) in complex with Fab, ivermectin and picrotoxin 2011-04-12 2011-05-25 Hibbs, R.E.,Gouaux, E. Principles of activation and permeation in an anion-selective Cys-loop receptor. Nature 2011 474 54 60 3RIA 21572436 C. elegans glutamate-gated chloride channel (GluCl) in complex with Fab, ivermectin and iodide. 2011-04-13 2011-05-25 Hibbs, R.E.,Gouaux, E. Principles of activation and permeation in an anion-selective Cys-loop receptor. Nature 2011 474 54 60 3RIF 21572436 C. elegans glutamate-gated chloride channel (GluCl) in complex with Fab, ivermectin and glutamate. 2011-04-13 2011-05-25 Hibbs, R.E.,Gouaux, E. Principles of activation and permeation in an anion-selective Cys-loop receptor. Nature 2011 474 54 60 3RZF 21423167 Crystal Structure of Inhibitor of kappaB kinase beta (I4122) 2011-05-11 2011-05-25 Xu, G.,Lo, Y.C.,Li, Q.,Napolitano, G.,Wu, X.,Jiang, X.,Dreano, M.,Karin, M.,Wu, H. Crystal structure of inhibitor of KappaB kinase Beta. Nature 2011 472 325 330 3Q26 21462277 Cyrstal structure of human alpha-synuclein (10-42) fused to maltose binding protein (MBP) 2010-12-19 2011-06-01 Zhao, M.,Cascio, D.,Sawaya, M.R.,Eisenberg, D. Structures of segments of alpha-synuclein fused to maltose-binding protein suggest intermediate states during amyloid formation Protein Sci. 2011 20 996 1004 3Q27 21462277 Cyrstal structure of human alpha-synuclein (32-57) fused to maltose binding protein (MBP) 2010-12-19 2011-06-01 Zhao, M.,Cascio, D.,Sawaya, M.R.,Eisenberg, D. Structures of segments of alpha-synuclein fused to maltose-binding protein suggest intermediate states during amyloid formation Protein Sci. 2011 20 996 1004 3Q28 21462277 Cyrstal structure of human alpha-synuclein (58-79) fused to maltose binding protein (MBP) 2010-12-19 2011-06-01 Zhao, M.,Cascio, D.,Sawaya, M.R.,Eisenberg, D. Structures of segments of alpha-synuclein fused to maltose-binding protein suggest intermediate states during amyloid formation Protein Sci. 2011 20 996 1004 3Q29 21462277 Cyrstal structure of human alpha-synuclein (1-19) fused to maltose binding protein (MBP) 2010-12-19 2011-06-01 Zhao, M.,Cascio, D.,Sawaya, M.R.,Eisenberg, D. Structures of segments of alpha-synuclein fused to maltose-binding protein suggest intermediate states during amyloid formation Protein Sci. 2011 20 996 1004 3QZS 21596426 Crystal Structure of BPTF bromo in complex with histone H4K16ac - Form I 2011-03-07 2011-06-01 Ruthenburg, A.J.,Li, H.,Milne, T.A.,Dewell, S.,McGinty, R.K.,Yuen, M.,Ueberheide, B.,Dou, Y.,Muir, T.W.,Patel, D.J.,Allis, C.D. Recognition of a Mononucleosomal Histone Modification Pattern by BPTF via Multivalent Interactions. Cell(Cambridge,Mass.) 2011 145 692 706 3QZT 21596426 Crystal Structure of BPTF bromo in complex with histone H4K16ac - Form II 2011-03-07 2011-06-01 Ruthenburg, A.J.,Li, H.,Milne, T.A.,Dewell, S.,McGinty, R.K.,Yuen, M.,Ueberheide, B.,Dou, Y.,Muir, T.W.,Patel, D.J.,Allis, C.D. Recognition of a Mononucleosomal Histone Modification Pattern by BPTF via Multivalent Interactions. Cell(Cambridge,Mass.) 2011 145 692 706 3Q9H 21473620 LVFFA segment from Alzheimer's Amyloid-Beta displayed on 42-membered macrocycle scaffold 2011-01-07 2011-06-08 Liu, C.,Sawaya, M.R.,Cheng, P.N.,Zheng, J.,Nowick, J.S.,Eisenberg, D. Characteristics of Amyloid-Related Oligomers Revealed by Crystal Structures of Macrocyclic beta-Sheet Mimics. J.Am.Chem.Soc. 2011 133 6736 6744 3Q9I 21473620 LVFFA segment from Alzheimer's Amyloid-Beta displayed on 42-membered macrocycle scaffold, bromide derivative 2011-01-07 2011-06-08 Liu, C.,Sawaya, M.R.,Cheng, P.N.,Zheng, J.,Nowick, J.S.,Eisenberg, D. Characteristics of Amyloid-Related Oligomers Revealed by Crystal Structures of Macrocyclic beta-Sheet Mimics. J.Am.Chem.Soc. 2011 133 6736 6744 3Q9J 21473620 AIIFL segment derived from Alzheimer's Amyloid-Beta displayed on 42-membered macrocycle scaffold 2011-01-07 2011-06-08 Liu, C.,Sawaya, M.R.,Cheng, P.N.,Zheng, J.,Nowick, J.S.,Eisenberg, D. Characteristics of Amyloid-Related Oligomers Revealed by Crystal Structures of Macrocyclic beta-Sheet Mimics. J.Am.Chem.Soc. 2011 133 6736 6744 3NG0 Crystal Structure of Glutamine Synthetase from Synechocystis sp. PCC 6803 2010-06-10 2011-06-15 Saelices, L.,Cascio, D.,Florencio, F.J.,Muro-Pastor, M.I. Crystal Structure of Glutamine Synthetase from Synechocystis sp. PCC 6803 To be Published 0 0 0 0 3QLC 21666679 Complex structure of ATRX ADD domain bound to unmodified H3 1-15 peptide 2011-02-02 2011-06-15 Iwase, S.,Xiang, B.,Ghosh, S.,Ren, T.,Lewis, P.W.,Cochrane, J.C.,Allis, C.D.,Picketts, D.J.,Patel, D.J.,Li, H.,Shi, Y. ATRX ADD domain links an atypical histone methylation recognition mechanism to human mental-retardation syndrome Nat.Struct.Mol.Biol. 2011 18 769 776 3RAQ 21645853 Dpo4 extension ternary complex with 3'-terminal primer C base opposite the 1-methylguanine (MG1) lesion 2011-03-28 2011-06-15 Rechkoblit, O.,Delaney, J.C.,Essigmann, J.M.,Patel, D.J. Implications for damage recognition during Dpo4-mediated mutagenic bypass of m1G and m3C lesions. Structure 2011 19 821 832 3RAX 21645853 Dpo4 extension ternary complex with 3'-terminal primer T base opposite the 1-methylguanine (M1G) lesion 2011-03-28 2011-06-15 Rechkoblit, O.,Delaney, J.C.,Essigmann, J.M.,Patel, D.J. Implications for damage recognition during Dpo4-mediated mutagenic bypass of m1G and m3C lesions. Structure 2011 19 821 832 3RB0 21645853 Dpo4 extension ternary complex with 3'-terminal primer G base opposite the 1-methylguanine (M1G) lesion 2011-03-28 2011-06-15 Rechkoblit, O.,Delaney, J.C.,Essigmann, J.M.,Patel, D.J. Implications for damage recognition during Dpo4-mediated mutagenic bypass of m1G and m3C lesions. Structure 2011 19 821 832 3RB3 21645853 Dpo4 extension ternary complex with 3'-terminal primer A base opposite the 1-methylguanine (m1g) lesion 2011-03-28 2011-06-15 Rechkoblit, O.,Delaney, J.C.,Essigmann, J.M.,Patel, D.J. Implications for damage recognition during Dpo4-mediated mutagenic bypass of m1G and m3C lesions. Structure 2011 19 821 832 3RB6 21645853 Dpo4 extension ternary complex with 3'-terminal primer A base opposite the 3-methylcytosine (m3c) lesion 2011-03-28 2011-06-15 Rechkoblit, O.,Delaney, J.C.,Essigmann, J.M.,Patel, D.J. Implications for damage recognition during Dpo4-mediated mutagenic bypass of m1G and m3C lesions. Structure 2011 19 821 832 3R4D 21670291 Crystal structure of mouse coronavirus receptor-binding domain complexed with its murine receptor 2011-03-17 2011-06-22 Peng, G.,Sun, D.,Rajashankar, K.R.,Qian, Z.,Holmes, K.V.,Li, F. Crystal structure of mouse coronavirus receptor-binding domain complexed with its murine receptor. Proc.Natl.Acad.Sci.USA 2011 108 10696 10701 3R5K 21674661 A designed redox-controlled caspase-7 2011-03-18 2011-06-29 Witkowski, W.A.,Hardy, J.A. A designed redox-controlled caspase. Protein Sci. 2011 20 1421 1431 3RTX 21683636 Crystal structure of mammalian capping enzyme (Mce1) and Pol II CTD complex 2011-05-04 2011-06-29 Ghosh, A.,Shuman, S.,Lima, C.D. Structural insights to how mammalian capping enzyme reads the CTD code. Mol.Cell 2011 43 299 310 3RWU 21667997 RB69 DNA Polymerase (Y567A) Ternary Complex with dATP Opposite Difluorotoluene Nucleoside 2011-05-09 2011-06-29 Xia, S.,Konigsberg, W.H.,Wang, J. Hydrogen-Bonding Capability of a Templating Difluorotoluene Nucleotide Residue in an RB69 DNA Polymerase Ternary Complex. J.Am.Chem.Soc. 2011 133 10003 10005 3SAF 21705430 Crystal structure of the human RRP6 catalytic domain with D313N mutation in the active site 2011-06-02 2011-07-06 Januszyk, K.,Liu, Q.,Lima, C.D. Activities of human RRP6 and structure of the human RRP6 catalytic domain. Rna 2011 17 1566 1577 3SAG 21705430 Crystal structure of the human RRP6 catalytic domain with D313N mutation in the active site 2011-06-02 2011-07-06 Januszyk, K.,Liu, Q.,Lima, C.D. Activities of human RRP6 and structure of the human RRP6 catalytic domain. Rna 2011 17 1566 1577 3SCF 21682308 Fe(II)-HppE with S-HPP and NO 2011-06-07 2011-07-06 Yun, D.,Dey, M.,Higgins, L.J.,Yan, F.,Liu, H.W.,Drennan, C.L. Structural basis of regiospecificity of a mononuclear iron enzyme in antibiotic fosfomycin biosynthesis. J.Am.Chem.Soc. 2011 133 11262 11269 3OCZ 21933344 Structure of Recombinant Haemophilus influenzae e(P4) Acid Phosphatase Complexed with the inhibitor adenosine 5-O-thiomonophosphate 2010-08-10 2011-07-20 Singh, H.,Reilly, T.J.,Tanner, J.J. Structural basis of the inhibition of class C acid phosphatases by adenosine 5'-phosphorothioate. Febs J. 2011 278 4374 4381 3S0X 21765428 The crystal structure of GxGD membrane protease FlaK 2011-05-13 2011-07-20 Hu, J.,Xue, Y.,Lee, S.,Ha, Y. The crystal structure of GXGD membrane protease FlaK. Nature 2011 475 528 531 3O15 Crystal Structure of Bacillus subtilis Thiamin Phosphate Synthase Complexed with a Carboxylated Thiazole Phosphate 2010-07-20 2011-07-27 McCulloch, K.M.,Hanes, J.W.,Abdelwahed, S.,Mahanta, N.,Hazra, A.,Ishida, K.,Begley, T.P.,Ealick, S.E. Crystal Structure and Kinetic Characterization of Bacillus subtilis Thiamin Phosphate Synthase with a Carboxylated Thiazole Phosphate to be published 0 0 0 0 3O16 Crystal Structure of Bacillus subtilis Thiamin Phosphate Synthase K159A 2010-07-20 2011-07-27 McCulloch, K.M.,Hanes, J.W.,Abdelwahed, S.,Mahanta, N.,Hazra, A.,Ishida, K.,Begley, T.P.,Ealick, S.E. Crystal Structure and Kinetic Characterization of Bacillus subtilis Thiamin Phosphate Synthase with a Carboxylated Thiazole Phosphate to be published 0 0 0 0 3O63 Crystal Structure of Thiamin Phosphate Synthase from Mycobacterium tuberculosis 2010-07-28 2011-07-27 McCulloch, K.M.,Ramamoorthy, D.,Ishida, K.,Guida, W.C.,Begley, T.P.,Ealick, S.E. Crystal Structure and Identification of Potential Inhibitor Compounds for Mycobacterium tuberculosis Thiamin Phosphate Synthase to be published 0 0 0 0 3RK3 21785414 Truncated SNARE complex with complexin 2011-04-17 2011-07-27 Kummel, D.,Krishnakumar, S.S.,Radoff, D.T.,Li, F.,Giraudo, C.G.,Pincet, F.,Rothman, J.E.,Reinisch, K.M. Complexin cross-links prefusion SNAREs into a zigzag array. Nat.Struct.Mol.Biol. 2011 18 927 933 3S2X 21626638 Structure of acetyl-Coenzyme A synthase Alpha subunit C-terminal domain 2011-05-17 2011-07-27 Liu, Y.,Wang, F.,Li, P.,Tan, X. Insights into the Mechanistic Role of the [Fe(4) S(4) ] Cubane in the A-Cluster {[Fe(4) S(4) ]-(SR)-[Ni(p) Ni(d) ]} of Acetyl-Coenzyme A Synthase. Chembiochem 2011 12 1417 1421 3S51 21764741 Structure of FANCI 2011-05-20 2011-07-27 Joo, W.,Xu, G.,Persky, N.S.,Smogorzewska, A.,Rudge, D.G.,Buzovetsky, O.,Elledge, S.J.,Pavletich, N.P. Structure of the FANCI-FANCD2 complex: insights into the Fanconi anemia DNA repair pathway. Science 2011 333 312 316 3SOW 21777816 Structure of UHRF1 PHD finger in complex with histone H3K4me3 1-9 peptide 2011-06-30 2011-08-03 Rajakumara, E.,Wang, Z.,Ma, H.,Hu, L.,Chen, H.,Lin, Y.,Guo, R.,Wu, F.,Li, H.,Lan, F.,Shi, Y.G.,Xu, Y.,Patel, D.J.,Shi, Y. PHD Finger Recognition of Unmodified Histone H3R2 Links UHRF1 to Regulation of Euchromatic Gene Expression. Mol.Cell 2011 43 275 284 3SWR Structure of human DNMT1 (601-1600) in complex with Sinefungin 2011-07-14 2011-08-10 Hashimoto, H.,Cheng, X. Structure of human DNMT1 (residues 600-1600) in complex with Sinefungin To be Published 0 0 0 0 3P4J 21459852 Ultra-high resolution structure of d(CGCGCG)2 Z-DNA 2010-10-06 2011-08-24 Brzezinski, K.,Brzuszkiewicz, A.,Dauter, M.,Kubicki, M.,Jaskolski, M.,Dauter, Z. High regularity of Z-DNA revealed by ultra high-resolution crystal structure at 0.55 A. Nucleic Acids Res. 2011 39 6238 6248 3QDH 21696465 Crystal structure of Actinomyces fimbrial adhesin FimA 2011-01-18 2011-08-24 Mishra, A.,Devarajan, B.,Reardon, M.E.,Dwivedi, P.,Krishnan, V.,Cisar, J.O.,Das, A.,Narayana, S.V.,Ton-That, H. Two autonomous structural modules in the fimbrial shaft adhesin FimA mediate Actinomyces interactions with streptococci and host cells during oral biofilm development. Mol.Microbiol. 2011 81 1205 1220 3QPB 21707079 Crystal Structure of Streptococcus Pyogenes Uridine Phosphorylase Reveals a Subclass of the NP-I Superfamily 2011-02-11 2011-08-24 Tran, T.H.,Christoffersen, S.,Allan, P.W.,Parker, W.B.,Serra, I.,Terreni, M.,Ealick, S.E. The Crystal Structure of Streptococcus pyogenes Uridine Phosphorylase Reveals a Distinct Subfamily of Nucleoside Phosphorylases. Biochemistry 2011 50 6549 6558 3QEP 21667997 RB69 DNA Polymerase (L561A/S565G/Y567A) Ternary Complex with dTTP Opposite Difluorotoluene Nucleoside 2011-01-20 2011-08-31 Xia, S.,Konigsberg, W.H.,Wang, J. Hydrogen-bonding capability of a templating difluorotoluene nucleotide residue in an RB69 DNA polymerase ternary complex. J.Am.Chem.Soc. 2011 133 10003 10005 3R1H 21857665 Crystal structure of the Class I ligase ribozyme-substrate preligation complex, C47U mutant, Ca2+ bound 2011-03-10 2011-08-31 Shechner, D.M.,Bartel, D.P. The structural basis of RNA-catalyzed RNA polymerization. Nat.Struct.Mol.Biol. 2011 18 1036 1042 3RCC 21912586 Crystal Structure of the Streptococcus agalactiae Sortase A 2011-03-30 2011-09-07 Khare, B.,Krishnan, V.,Rajashankar, K.R.,I-Hsiu, H.,Xin, M.,Ton-That, H.,Narayana, S.V. Structural differences between the Streptococcus agalactiae housekeeping and pilus-specific sortases: SrtA and SrtC1. Plos One 2011 6 0 0 3OKQ 23161908 Crystal structure of a core domain of yeast actin nucleation cofactor Bud6 2010-08-25 2011-09-14 Tu, D.,Graziano, B.R.,Park, E.,Zheng, W.,Li, Y.,Goode, B.L.,Eck, M.J. Structure of the formin-interaction domain of the actin nucleation-promoting factor Bud6. Proc.Natl.Acad.Sci.USA 2012 109 0 0 3SUH 21873197 Crystal structure of THF riboswitch, bound with 5-formyl-THF 2011-07-11 2011-09-14 Huang, L.,Ishibe-Murakami, S.,Patel, D.J.,Serganov, A. Long-range pseudoknot interactions dictate the regulatory response in the tetrahydrofolate riboswitch. Proc.Natl.Acad.Sci.USA 2011 108 14801 14806 3SUX 21873197 Crystal structure of THF riboswitch, bound with THF 2011-07-11 2011-09-14 Huang, L.,Ishibe-Murakami, S.,Patel, D.J.,Serganov, A. Long-range pseudoknot interactions dictate the regulatory response in the tetrahydrofolate riboswitch. Proc.Natl.Acad.Sci.USA 2011 108 14801 14806 3SUY 21873197 Crystal structure of THF riboswitch, unbound status 2011-07-11 2011-09-14 Huang, L.,Ishibe-Murakami, S.,Patel, D.J.,Serganov, A. Long-range pseudoknot interactions dictate the regulatory response in the tetrahydrofolate riboswitch. Proc.Natl.Acad.Sci.USA 2011 108 14801 14806 3RM5 21904031 Structure of Trifunctional THI20 from Yeast 2011-04-20 2011-09-21 French, J.B.,Begley, T.P.,Ealick, S.E. Structure of trifunctional THI20 from yeast. Acta Crystallogr.,Sect.D 2011 67 784 791 3RW9 21898642 Crystal Structure of human Spermidine Synthase in Complex with decarboxylated S-adenosylhomocysteine 2011-05-08 2011-09-21 Seckute, J.,McCloskey, D.E.,Thomas, H.J.,Secrist, J.A.,Pegg, A.E.,Ealick, S.E. Binding and inhibition of human spermidine synthase by decarboxylated S-adenosylhomocysteine. Protein Sci. 2011 20 1836 1844 3SB5 21898649 Zn-mediated Trimer of T4 Lysozyme R125C/E128C by Synthetic Symmetrization 2011-06-03 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SBA 21898649 Zn-mediated Hexamer of T4 Lysozyme R76H/R80H by Synthetic Symmetrization 2011-06-03 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SBB 21898649 Disulphide-mediated Tetramer of T4 Lysozyme R76C/R80C by Synthetic Symmetrization 2011-06-03 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SER 21898649 Zn-mediated Polymer of Maltose-binding Protein K26H/K30H by Synthetic Symmetrization 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SES 21898649 Cu-mediated Dimer of Maltose-binding Protein A216H/K220H by Synthetic Symmetrization 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SET 21898649 Ni-mediated Dimer of Maltose-binding Protein A216H/K220H by Synthetic Symmetrization (Form I) 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SEU 21898649 Zn-mediated Polymer of Maltose-binding Protein A216H/K220H by Synthetic Symmetrization (Form III) 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SEV 21898649 Zn-mediated Trimer of Maltose-binding Protein E310H/K314H by Synthetic Symmetrization 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SEW 21898649 Zn-mediated Polymer of Maltose-binding Protein A216H/K220H by Synthetic Symmetrization (Form I) 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SEX 21898649 Ni-mediated Dimer of Maltose-binding Protein A216H/K220H by Synthetic Symmetrization (Form II) 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SEY 21898649 Zn-mediated Polymer of Maltose-binding Protein A216H/K220H by Synthetic Symmetrization (Form II) 2011-06-11 2011-09-21 Laganowsky, A.,Zhao, M.,Soriaga, A.B.,Sawaya, M.R.,Cascio, D.,Yeates, T.O. An approach to crystallizing proteins by metal-mediated synthetic symmetrization. Protein Sci. 2011 20 1876 1890 3SF0 21933344 Structure of Recombinant Haemophilus Influenzae e(P4) Acid Phosphatase mutant D64N complexed with 5'AMP 2011-06-12 2011-09-28 Singh, H.,Reilly, T.J.,Tanner, J.J. Structural basis of the inhibition of class C acid phosphatases by adenosine 5'-phosphorothioate. Febs J. 2011 278 4374 4381 3TRK Structure of the Chikungunya virus nsP2 protease 2011-09-09 2011-09-28 Cheung, J.,Franklin, M.,Mancia, F.,Rudolph, M.,Cassidy, M.,Gary, E.,Burshteyn, F.,Love, J. Structure of the Chikungunya virus nsP2 protease To be Published 0 0 0 0 3ONX 23161908 Crystal structure of a domain of a protein involved in formation of actin cytoskeleton 2010-08-30 2011-10-12 Tu, D.,Graziano, B.R.,Park, E.,Zheng, W.,Li, Y.,Goode, B.L.,Eck, M.J. Structure of the formin-interaction domain of the actin nucleation-promoting factor Bud6. Proc.Natl.Acad.Sci.USA 2012 109 0 0 3SQ1 21923197 RB69 DNA Polymerase Ternary Complex with dUpCpp Opposite dA 2011-07-04 2011-10-12 Xia, S.,Wang, M.,Blaha, G.,Konigsberg, W.H.,Wang, J. Structural Insights into Complete Metal Ion Coordination from Ternary Complexes of B Family RB69 DNA Polymerase. Biochemistry 2011 50 9114 9124 3SYO 21962516 Crystal structure of the G protein-gated inward rectifier K+ channel GIRK2 (Kir3.2) in complex with sodium 2011-07-18 2011-10-12 Whorton, M.R.,Mackinnon, R. Crystal Structure of the Mammalian GIRK2 K(+) Channel and Gating Regulation by G Proteins, PIP(2), and Sodium. Cell(Cambridge,Mass.) 2011 147 199 208 3QH9 21462929 Human Liprin-beta2 Coiled-Coil 2011-01-25 2011-10-26 Stafford, R.L.,Tang, M.Y.,Sawaya, M.R.,Phillips, M.L.,Bowie, J.U. Crystal structure of the central coiled-coil domain from human liprin-beta2 Biochemistry 2011 50 3807 3815 3NWQ 22158985 X-ray structure of ester chemical analogue [O-Ile50,O-Ile50']HIV-1 protease complexed with MVT-101 2010-07-10 2011-11-02 Torbeev, V.Y.,Raghuraman, H.,Hamelberg, D.,Tonelli, M.,Westler, W.M.,Perozo, E.,Kent, S.B. Protein conformational dynamics in the mechanism of HIV-1 protease catalysis. Proc.Natl.Acad.Sci.USA 2011 108 20982 20987 3NXE 22158985 X-ray structure of ester chemical analogue 'covalent dimer' [Ile50,O-Ile50']HIV-1 protease complexed with MVT-101 inhibitor 2010-07-13 2011-11-02 Torbeev, V.Y.,Raghuraman, H.,Hamelberg, D.,Tonelli, M.,Westler, W.M.,Perozo, E.,Kent, S.B. Protein conformational dynamics in the mechanism of HIV-1 protease catalysis. Proc.Natl.Acad.Sci.USA 2011 108 20982 20987 3U33 22004173 Crystal Structure of the E. coli adaptive response protein AidB in the space group P3(2) 2011-10-04 2011-11-02 Hamill, M.J.,Jost, M.,Wong, C.,Elliott, S.J.,Drennan, C.L. Flavin-induced oligomerization in Escherichia coli adaptive response protein AidB. Biochemistry 2011 50 10159 10169 3TS2 22078496 Mouse Lin28A in complex with let-7g microRNA pre-element 2011-09-11 2011-11-16 Nam, Y.,Chen, C.,Gregory, R.I.,Chou, J.J.,Sliz, P. Molecular Basis for Interaction of let-7 MicroRNAs with Lin28. Cell(Cambridge,Mass.) 2011 147 1080 1091 3RYM 22071089 Structure of Oxidized M98K mutant of Amicyanin 2011-05-11 2011-11-23 Sukumar, N.,Choi, M.,Davidson, V.L. Replacement of the axial copper ligand methionine with lysine in amicyanin converts it to a zinc-binding protein that no longer binds copper. J.Inorg.Biochem. 2011 105 1638 1644 3T7E 22055190 Atg8 transfer from Atg7 to Atg3: a distinctive E1-E2 architecture and mechanism in the autophagy pathway 2011-07-30 2011-11-23 Taherbhoy, A.M.,Tait, S.W.,Kaiser, S.E.,Williams, A.H.,Deng, A.,Nourse, A.,Hammel, M.,Kurinov, I.,Rock, C.O.,Green, D.R.,Schulman, B.A. Atg8 transfer from atg7 to atg3: a distinctive e1-e2 architecture and mechanism in the autophagy pathway. Mol.Cell 2011 44 451 461 3T7F 22055190 Atg8 transfer from Atg7 to Atg3: a distinctive E1-E2 architecture and mechanism in the autophagy pathway 2011-07-30 2011-11-23 Taherbhoy, A.M.,Tait, S.W.,Kaiser, S.E.,Williams, A.H.,Deng, A.,Nourse, A.,Hammel, M.,Kurinov, I.,Rock, C.O.,Green, D.R.,Schulman, B.A. Atg8 transfer from atg7 to atg3: a distinctive e1-e2 architecture and mechanism in the autophagy pathway. Mol.Cell 2011 44 451 461 3UID 27917833 Crystal Structure of Protein Ms6760 from Mycobacterium smegmatis 2011-11-04 2011-11-23 Bajaj, R.A.,Arbing, M.A.,Shin, A.,Cascio, D.,Miallau, L. Crystal structure of the toxin Msmeg_6760, the structural homolog of Mycobacterium tuberculosis Rv2035, a novel type II toxin involved in the hypoxic response. Acta Crystallogr F Struct Biol 2016 72 863 869 3SWC 22086334 GLP (G9a-like protein) SET domain in complex with Dnmt3aK44me2 peptide 2011-07-13 2011-11-30 Chang, Y.,Sun, L.,Kokura, K.,Horton, J.R.,Fukuda, M.,Espejo, A.,Izumi, V.,Koomen, J.M.,Bedford, M.T.,Zhang, X.,Shinkai, Y.,Fang, J.,Cheng, X. MPP8 mediates the interactions between DNA methyltransferase Dnmt3a and H3K9 methyltransferase GLP/G9a. Nat Commun 2011 2 533 533 3TWR 22153077 Crystal structure of ARC4 from human Tankyrase 2 in complex with peptide from human 3BP2 2011-09-22 2011-12-07 Guettler, S.,Larose, J.,Petsalaki, E.,Gish, G.,Scotter, A.,Pawson, T.,Rottapel, R.,Sicheri, F. Structural basis and sequence rules for substrate recognition by tankyrase explain the basis for cherubism disease. Cell(Cambridge,Mass.) 2011 147 1340 1354 3SA0 22084399 Complex of ERK2 with norathyriol 2011-06-02 2011-12-14 Li, J.,Malakhova, M.,Mottamal, M.,Reddy, K.,Kurinov, I.,Carper, A.,Langfald, A.,Oi, N.,Kim, M.O.,Zhu, F.,Sosa, C.P.,Zhou, K.,Bode, A.M.,Dong, Z. Norathyriol Suppresses Skin Cancers Induced by Solar Ultraviolet Radiation by Targeting ERK Kinases. Cancer Res. 2012 72 260 270 3UIN 22194619 Complex between human RanGAP1-SUMO2, UBC9 and the IR1 domain from RanBP2 2011-11-05 2011-12-28 Gareau, J.R.,Reverter, D.,Lima, C.D. Determinants of small ubiquitin-like modifier 1 (SUMO1) protein specificity, E3 ligase, and SUMO-RanGAP1 binding activities of nucleoporin RanBP2. J.Biol.Chem. 2012 287 4740 4751 3UIO 22194619 Complex between human RanGAP1-SUMO2, UBC9 and the IR1 domain from RanBP2 containing IR2 Motif II 2011-11-05 2011-12-28 Gareau, J.R.,Reverter, D.,Lima, C.D. Determinants of small ubiquitin-like modifier 1 (SUMO1) protein specificity, E3 ligase, and SUMO-RanGAP1 binding activities of nucleoporin RanBP2. J.Biol.Chem. 2012 287 4740 4751 3UIP 22194619 Complex between human RanGAP1-SUMO1, UBC9 and the IR1 domain from RanBP2 containing IR2 Motif II 2011-11-05 2011-12-28 Gareau, J.R.,Reverter, D.,Lima, C.D. Determinants of small ubiquitin-like modifier 1 (SUMO1) protein specificity, E3 ligase, and SUMO-RanGAP1 binding activities of nucleoporin RanBP2. J.Biol.Chem. 2012 287 4740 4751 3USM 22245965 Crystal Structure of LeuT bound to L-selenomethionine in space group C2 from lipid bicelles (collected at 1.2 A) 2011-11-23 2012-01-11 Wang, H.,Elferich, J.,Gouaux, E. Structures of LeuT in bicelles define conformation and substrate binding in a membrane-like context. Nat.Struct.Mol.Biol. 2012 19 212 219 3U5M 22196728 Crystal structure of TRIM33 PHD-Bromo in the free state 2011-10-11 2012-01-18 Xi, Q.,Wang, Z.,Zaromytidou, A.I.,Zhang, X.H.,Chow-Tsang, L.F.,Liu, J.X.,Kim, H.,Barlas, A.,Manova-Todorova, K.,Kaartinen, V.,Studer, L.,Mark, W.,Patel, D.J.,Massague, J. A poised chromatin platform for TGF-beta access to master regulators Cell(Cambridge,Mass.) 2011 147 1511 1524 3U5N 22196728 Crystal structure of the complex of TRIM33 PHD-Bromo and H3(1-20)K9me3K14ac histone peptide 2011-10-11 2012-01-18 Xi, Q.,Wang, Z.,Zaromytidou, A.I.,Zhang, X.H.,Chow-Tsang, L.F.,Liu, J.X.,Kim, H.,Barlas, A.,Manova-Todorova, K.,Kaartinen, V.,Studer, L.,Mark, W.,Patel, D.J.,Massague, J. A Poised Chromatin Platform for TGF-beta access to master regulators Cell(Cambridge,Mass.) 2011 147 1511 1524 3U5O 22196728 Crystal structure of the complex of TRIM33 PHD-Bromo and H3(1-22)K9me3K14acK18ac histone peptide 2011-10-11 2012-01-18 Xi, Q.,Wang, Z.,Zaromytidou, A.I.,Zhang, X.H.,Chow-Tsang, L.F.,Liu, J.X.,Kim, H.,Barlas, A.,Manova-Todorova, K.,Kaartinen, V.,Studer, L.,Mark, W.,Patel, D.J.,Massague, J. A poised chromatin platform for TGF-beta access to master regulators Cell(Cambridge,Mass.) 2011 147 1511 1524 3QEI 22304682 RB69 DNA Polymerase (L561A/S565G/Y567A) Ternary Complex with dCTP Opposite Difluorotoluene Nucleoside 2011-01-20 2012-01-25 Xia, S.,Eom, S.H.,Konigsberg, W.H.,Wang, J. Structural Basis for Differential Insertion Kinetics of dNMPs Opposite a Difluorotoluene Nucleotide Residue. Biochemistry 2012 51 1476 1485 3QER 22304682 RB69 DNA Polymerase (L561A/S565G/Y567A) Ternary Complex with dATP Opposite Difluorotoluene Nucleoside 2011-01-20 2012-01-25 Xia, S.,Eom, S.H.,Konigsberg, W.H.,Wang, J. Structural Basis for Differential Insertion Kinetics of dNMPs Opposite a Difluorotoluene Nucleotide Residue. Biochemistry 2012 51 1476 1485 3QES 22304682 RB69 DNA Polymerase (L561A/S565G/Y567A) Ternary Complex with dGTP Opposite Difluorotoluene Nucleoside 2011-01-20 2012-01-25 Xia, S.,Eom, S.H.,Konigsberg, W.H.,Wang, J. Structural Basis for Differential Insertion Kinetics of dNMPs Opposite a Difluorotoluene Nucleotide Residue. Biochemistry 2012 51 1476 1485 3QET RB69 DNA Polymerase (L561A/S565G/Y567A) Ternary Complex with dTTP Opposite dT 2011-01-20 2012-01-25 Xia, S.,Konigsberg, W.H.,Wang, J. Hydrogen-Bonding Capability of Difluorotoluene Nucleoside in Replication Complexes To be Published 0 0 0 0 3QEV RB69 DNA Polymerase (L561A/S565G/Y567A) Ternary Complex with dCTP Opposite dT 2011-01-20 2012-01-25 Xia, S.,Konigsberg, W.H.,Wang, J. Hydrogen-Bonding Capability of Difluorotoluene Nucleoside in Replication Complexes To be Published 0 0 0 0 3QEX RB69 DNA Polymerase (L561A/S565G/Y567A) Ternary Complex with dGTP Opposite dT 2011-01-20 2012-01-25 Xia, S.,Konigsberg, W.H.,Wang, J. Hydrogen-Bonding Capability of Difluorotoluene Nucleoside in Replication Complexes To be Published 0 0 0 0 3SRZ 22267739 Clostridium difficile toxin A (TcdA) glucolsyltransferase domain bound to UDP-glucose 2011-07-07 2012-02-01 Pruitt, R.N.,Chumbler, N.M.,Rutherford, S.A.,Farrow, M.A.,Friedman, D.B.,Spiller, B.,Lacy, D.B. Structural Determinants of Clostridium difficile Toxin A Glucosyltransferase Activity. J.Biol.Chem. 2012 287 8013 8020 3SS1 22267739 Clostridium difficile toxin A (TcdA) glucolsyltransferase domain 2011-07-07 2012-02-01 Pruitt, R.N.,Chumbler, N.M.,Rutherford, S.A.,Farrow, M.A.,Friedman, D.B.,Spiller, B.,Lacy, D.B. Structural Determinants of Clostridium difficile Toxin A Glucosyltransferase Activity. J.Biol.Chem. 2012 287 8013 8020 3UIG 22244766 crystal structure of human Survivin in complex with T3 phosphorylated H3(1-15) peptide 2011-11-04 2012-02-01 Du, J.,Kelly, A.E.,Funabiki, H.,Patel, D.J. Structural Basis for Recognition of H3T3ph and Smac/DIABLO N-terminal Peptides by Human Survivin. Structure 2012 20 185 195 3UTH 22294687 Crystal structure of Aspergillus fumigatus UDP galactopyranose mutase complexed with substrate UDP-Galp in reduced state 2011-11-25 2012-02-08 Dhatwalia, R.,Singh, H.,Oppenheimer, M.,Karr, D.B.,Nix, J.C.,Sobrado, P.,Tanner, J.J. Crystal Structures and Small-angle X-ray Scattering Analysis of UDP-galactopyranose Mutase from the Pathogenic Fungus Aspergillus fumigatus. J.Biol.Chem. 2012 287 9041 9051 3UWX 22307053 Crystal structure of UvrA-UvrB complex 2011-12-03 2012-02-08 Pakotiprapha, D.,Samuels, M.,Shen, K.,Hu, J.H.,Jeruzalmi, D. Structure and mechanism of the UvrA-UvrB DNA damage sensor. Nat.Struct.Mol.Biol. 2012 19 291 298 3UX8 22307053 Crystal structure of UvrA 2011-12-04 2012-02-08 Pakotiprapha, D.,Samuels, M.,Shen, K.,Hu, J.H.,Jeruzalmi, D. Structure and mechanism of the UvrA-UvrB DNA damage sensor. Nat.Struct.Mol.Biol. 2012 19 291 298 3UY6 22262858 BlaR1 sensor domain from Staphylococcus aureus with N439V mutation 2011-12-05 2012-02-08 Kumarasiri, M.,Llarrull, L.I.,Borbulevych, O.,Fishovitz, J.,Lastochkin, E.,Baker, B.M.,Mobashery, S. An amino acid position at crossroads of evolution of protein function: antibiotic sensor domain of BlaR1 protein from Staphylococcus aureus versus clasS D beta-lactamases J.Biol.Chem. 2012 287 8232 8241 3TNZ 22238141 Crystal structure of Mus musculus iodotyrosine deiodinase (IYD) C217A, C239A bound to FMN and mono-iodotyrosine (MIT) 2011-09-02 2012-02-29 Buss, J.M.,McTamney, P.M.,Rokita, S.E. Expression of a soluble form of iodotyrosine deiodinase for active site characterization by engineering the native membrane protein from Mus musculus. Protein Sci. 2012 21 351 361 3UAV 22349225 Crystal structure of adenosine phosphorylase from Bacillus cereus 2011-10-22 2012-02-29 Dessanti, P.,Zhang, Y.,Allegrini, S.,Tozzi, M.G.,Sgarrella, F.,Ealick, S.E. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase. Acta Crystallogr.,Sect.D 2012 68 239 248 3UAX 22349225 Crystal structure of adenosine phosphorylase from Bacillus cereus complexed with inosine 2011-10-22 2012-02-29 Dessanti, P.,Zhang, Y.,Allegrini, S.,Tozzi, M.G.,Sgarrella, F.,Ealick, S.E. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase. Acta Crystallogr.,Sect.D 2012 68 239 248 3UAY 22349225 Crystal structure of Bacillus cereus adenosine phosphorylase D204N mutant complexed with adenosine 2011-10-22 2012-02-29 Dessanti, P.,Zhang, Y.,Allegrini, S.,Tozzi, M.G.,Sgarrella, F.,Ealick, S.E. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase. Acta Crystallogr.,Sect.D 2012 68 239 248 3V60 22382979 Structure of S. cerevisiae PCNA conjugated to SUMO on lysine 164 2011-12-18 2012-02-29 Armstrong, A.A.,Mohideen, F.,Lima, C.D. Recognition of SUMO-modified PCNA requires tandem receptor motifs in Srs2. Nature 2012 483 59 63 3V61 22382979 Structure of S. cerevisiae PCNA conjugated to SUMO on lysine 164 2011-12-18 2012-02-29 Armstrong, A.A.,Mohideen, F.,Lima, C.D. Recognition of SUMO-modified PCNA requires tandem receptor motifs in Srs2. Nature 2012 483 59 63 3VAR 22356908 Crystal structure of DNPEP, ZnZn form 2011-12-29 2012-02-29 Chen, Y.,Farquhar, E.R.,Chance, M.R.,Palczewski, K.,Kiser, P.D. Insights into substrate specificity and metal activation of Mammalian tetrahedral aspartyl aminopeptidase. J.Biol.Chem. 2012 287 13356 13370 3VAT 22356908 Crystal structure of DNPEP, ZnMg form 2011-12-29 2012-02-29 Chen, Y.,Farquhar, E.R.,Chance, M.R.,Palczewski, K.,Kiser, P.D. Insights into substrate specificity and metal activation of Mammalian tetrahedral aspartyl aminopeptidase. J.Biol.Chem. 2012 287 13356 13370 3V0A 22363010 2.7 angstrom crystal structure of BoNT/Ai in complex with NTNHA 2011-12-07 2012-03-14 Gu, S.,Rumpel, S.,Zhou, J.,Strotmeier, J.,Bigalke, H.,Perry, K.,Shoemaker, C.B.,Rummel, A.,Jin, R. Botulinum neurotoxin is shielded by NTNHA in an interlocked complex. Science 2012 335 977 981 3V9F 24995510 Crystal Structure of the extracellular domain of the putative hybrid two component system BT3049 from B. thetaiotaomicron 2011-12-27 2012-03-14 Zhang, Z.,Liu, Q.,Hendrickson, W.A. Crystal structures of apparent saccharide sensors from histidine kinase receptors prevalent in a human gut symbiont. Febs J. 2014 281 4263 4279 3ZXU 22322944 Crystal structure of the Ctf19-Mcm21 kinetochore heterodimer from yeast 2011-08-15 2012-03-14 Schmitzberger, F.,Harrison, S.C. Rwd Domain: A Recurring Module in Kinetochore Architecture Shown by a Ctf19-Mcm21 Complex Structure. Embo Rep. 2012 13 216 0 4DJD 22419154 Crystal structure of folate-free corrinoid iron-sulfur protein (CFeSP) in complex with its methyltransferase (MeTr) 2012-02-01 2012-03-14 Kung, Y.,Ando, N.,Doukov, T.I.,Blasiak, L.C.,Bender, G.,Seravalli, J.,Ragsdale, S.W.,Drennan, C.L. Visualizing molecular juggling within a B12-dependent methyltransferase complex. Nature 2012 484 265 269 4DJE 22419154 Crystal structure of folate-bound corrinoid iron-sulfur protein (CFeSP) in complex with its methyltransferase (MeTr), co-crystallized with folate 2012-02-01 2012-03-14 Kung, Y.,Ando, N.,Doukov, T.I.,Blasiak, L.C.,Bender, G.,Seravalli, J.,Ragsdale, S.W.,Drennan, C.L. Visualizing molecular juggling within a B12-dependent methyltransferase complex. Nature 2012 484 265 269 3SGN 22403391 Bromoderivative-8 of amyloid-related segment of alphaB-crystallin residues 90-100 2011-06-15 2012-03-21 Laganowsky, A.,Liu, C.,Sawaya, M.R.,Whitelegge, J.P.,Park, J.,Zhao, M.,Pensalfini, A.,Soriaga, A.B.,Landau, M.,Teng, P.K.,Cascio, D.,Glabe, C.,Eisenberg, D. Atomic view of a toxic amyloid small oligomer. Science 2012 335 1228 1231 3SGP 22403391 Amyloid-related segment of alphaB-crystallin residues 90-100 mutant V91L 2011-06-15 2012-03-21 Laganowsky, A.,Liu, C.,Sawaya, M.R.,Whitelegge, J.P.,Park, J.,Zhao, M.,Pensalfini, A.,Soriaga, A.B.,Landau, M.,Teng, P.K.,Cascio, D.,Glabe, C.,Eisenberg, D. Atomic view of a toxic amyloid small oligomer. Science 2012 335 1228 1231 3SGR 22403391 Tandem repeat of amyloid-related segment of alphaB-crystallin residues 90-100 mutant V91L 2011-06-15 2012-03-21 Laganowsky, A.,Liu, C.,Sawaya, M.R.,Whitelegge, J.P.,Park, J.,Zhao, M.,Pensalfini, A.,Soriaga, A.B.,Landau, M.,Teng, P.K.,Cascio, D.,Glabe, C.,Eisenberg, D. Atomic view of a toxic amyloid small oligomer. Science 2012 335 1228 1231 3UZ0 22431613 Crystal Structure of SpoIIIAH and SpoIIQ Complex 2011-12-07 2012-03-21 Meisner, J.,Maehigashi, T.,Andre, I.,Dunham, C.M.,Moran, C.P. Structure of the basal components of a bacterial transporter. Proc.Natl.Acad.Sci.USA 2012 109 5446 5451 3UZW 22437839 Crystal structure of 5beta-reductase (AKR1D1) E120H mutant in complex with NADP+ 2011-12-07 2012-03-21 Chen, M.,Drury, J.E.,Christianson, D.W.,Penning, T.M. Conversion of Human Steroid 5beta-Reductase (AKR1D1) into 3β-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: EXAMPLE OF PERFECT ENZYME ENGINEERING. J.Biol.Chem. 2012 287 16609 16622 3UZY 22437839 Crystal structure of 5beta-reductase (AKR1D1) E120H mutant in complex with NADP+ and 5beta-dihydrotestosterone 2011-12-07 2012-03-21 Chen, M.,Drury, J.E.,Christianson, D.W.,Penning, T.M. Conversion of Human Steroid 5beta-Reductase (AKR1D1) into 3β-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: EXAMPLE OF PERFECT ENZYME ENGINEERING. J.Biol.Chem. 2012 287 16609 16622 3UZZ 22437839 Crystal structure of 5beta-reductase (AKR1D1) E120H mutant in complex with NADP+ and delta4-androstenedione 2011-12-07 2012-03-21 Chen, M.,Drury, J.E.,Christianson, D.W.,Penning, T.M. Conversion of Human Steroid 5beta-Reductase (AKR1D1) into 3β-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: EXAMPLE OF PERFECT ENZYME ENGINEERING. J.Biol.Chem. 2012 287 16609 16622 2YFH 27303899 Structure of a Chimeric Glutamate Dehydrogenase 2011-04-05 2012-04-04 Oliveira, T.,Sharkey, M.A.,Engel, P.C.,Khan, A.R. Crystal Structure of a Chimaeric Bacterial Glutamate Dehydrogenase. Acta Crystallogr.,Sect.F 2016 72 462 0 3RI4 22432043 Ets1 cooperative binding to widely separated sites on promoter DNA 2011-04-12 2012-04-04 Babayeva, N.D.,Baranovskaya, O.I.,Tahirov, T.H. Structural basis of ets1 cooperative binding to widely separated sites on promoter DNA. Plos One 2012 7 0 0 3S8B Structure of Yeast Ribonucleotide Reductase 1 with AMPPNP and CDP 2011-05-27 2012-04-11 Ahmad, M.F.,Kaushal, P.S.,Wan, Q.,Wijeratna, S.R.,Huang, M.,Dealwis, C.D. Structural and biochemical basis of lethal mutant R293A of yeast ribonucleotide reductase To be Published 0 0 0 0 3S8C Structure of Yeast Ribonucleotide Reductase 1 R293A with AMPPNP and CDP 2011-05-27 2012-04-11 Ahmad, M.F.,Kaushal, P.S.,Wan, Q.,Wijeratna, S.R.,Huang, M.,Dealwis, C.D. Structural and biochemical basis of lethal mutant R293A of yeast ribonucleotide reductase To be Published 0 0 0 0 3SDB 22280445 Crystal structure of C176A mutant of glutamine-dependent NAD+ synthetase from M. tuberculosis in apo form 2011-06-09 2012-04-11 Chuenchor, W.,Doukov, T.I.,Resto, M.,Chang, A.,Gerratana, B. Regulation of the intersubunit ammonia tunnel in Mycobacterium tuberculosis glutamine-dependent NAD+ synthetase. Biochem.J. 2012 443 417 426 4EFH 22334675 Acanthamoeba Actin complex with Spir domain D 2012-03-29 2012-04-11 Chen, C.K.,Sawaya, M.R.,Phillips, M.L.,Reisler, E.,Quinlan, M.E. Multiple Forms of Spire-Actin Complexes and their Functional Consequences. J.Biol.Chem. 2012 287 10684 10692 4DS6 22484319 Crystal structure of a group II intron in the pre-catalytic state 2012-02-17 2012-04-18 Chan, R.T.,Robart, A.R.,Rajashankar, K.R.,Pyle, A.M.,Toor, N. Crystal structure of a group II intron in the pre-catalytic state. Nat.Struct.Mol.Biol. 2012 19 555 557 4DW0 22535247 Crystal structure of the ATP-gated P2X4 ion channel in the closed, apo state at 2.9 Angstroms 2012-02-24 2012-04-25 Hattori, M.,Gouaux, E. Molecular mechanism of ATP binding and ion channel activation in P2X receptors. Nature 2012 485 207 212 4DW1 22535247 Crystal structure of the ATP-gated P2X4 ion channel in the ATP-bound, open state at 2.8 Angstroms 2012-02-24 2012-04-25 Hattori, M.,Gouaux, E. Molecular mechanism of ATP binding and ion channel activation in P2X receptors. Nature 2012 485 207 212 3V92 22516296 S663A Stable-5-LOX 2011-12-23 2012-05-02 Gilbert, N.C.,Rui, Z.,Neau, D.B.,Waight, M.T.,Bartlett, S.G.,Boeglin, W.E.,Brash, A.R.,Newcomer, M.E. Conversion of human 5-lipoxygenase to a 15-lipoxygenase by a point mutation to mimic phosphorylation at Serine-663. Faseb J. 2012 26 3222 3229 3V98 22516296 S663D Stable-5-LOX 2011-12-23 2012-05-02 Gilbert, N.C.,Rui, Z.,Neau, D.B.,Waight, M.T.,Bartlett, S.G.,Boeglin, W.E.,Brash, A.R.,Newcomer, M.E. Conversion of human 5-lipoxygenase to a 15-lipoxygenase by a point mutation to mimic phosphorylation at Serine-663. Faseb J. 2012 26 3222 3229 3V99 22516296 S663D Stable-5-LOX in complex with Arachidonic Acid 2011-12-23 2012-05-02 Gilbert, N.C.,Rui, Z.,Neau, D.B.,Waight, M.T.,Bartlett, S.G.,Boeglin, W.E.,Brash, A.R.,Newcomer, M.E. Conversion of human 5-lipoxygenase to a 15-lipoxygenase by a point mutation to mimic phosphorylation at Serine-663. Faseb J. 2012 26 3222 3229 3V9G 22516612 Crystal structure of human 1-pyrroline-5-carboxylate dehydrogenase 2011-12-27 2012-05-02 Srivastava, D.,Singh, R.K.,Moxley, M.A.,Henzl, M.T.,Becker, D.F.,Tanner, J.J. The Three-Dimensional Structural Basis of Type II Hyperprolinemia. J.Mol.Biol. 2012 420 176 189 3V9H 22516612 Crystal structure of human 1-pyrroline-5-carboxylate dehydrogenase mutant S352A 2011-12-27 2012-05-02 Srivastava, D.,Singh, R.K.,Moxley, M.A.,Henzl, M.T.,Becker, D.F.,Tanner, J.J. The Three-Dimensional Structural Basis of Type II Hyperprolinemia. J.Mol.Biol. 2012 420 176 189 3V9I 22516612 Crystal structure of human 1-pyrroline-5-carboxylate dehydrogenase mutant S352L 2011-12-27 2012-05-02 Srivastava, D.,Singh, R.K.,Moxley, M.A.,Henzl, M.T.,Becker, D.F.,Tanner, J.J. The Three-Dimensional Structural Basis of Type II Hyperprolinemia. J.Mol.Biol. 2012 420 176 189 3V9J 22516612 Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with sulfate ion 2011-12-27 2012-05-02 Srivastava, D.,Singh, R.K.,Moxley, M.A.,Henzl, M.T.,Becker, D.F.,Tanner, J.J. The Three-Dimensional Structural Basis of Type II Hyperprolinemia. J.Mol.Biol. 2012 420 176 189 3RE4 22629386 Crystal Structure of Archaeoglobus Fulgidus Rio1 Kinase bound to Toyocamycin. 2011-04-02 2012-05-09 Kiburu, I.N.,Laronde-Leblanc, N. Interaction of rio1 kinase with toyocamycin reveals a conformational switch that controls oligomeric state and catalytic activity. Plos One 2012 7 0 0 3UTV 22566663 Crystal structure of bacteriorhodopsin mutant Y57F 2011-11-26 2012-05-09 Cao, Z.,Bowie, J.U. Shifting hydrogen bonds may produce flexible transmembrane helices. Proc.Natl.Acad.Sci.USA 2012 109 8121 8126 3UTW 22566663 Crystal structure of bacteriorhodopsin mutant P50A/Y57F 2011-11-27 2012-05-09 Cao, Z.,Bowie, J.U. Shifting hydrogen bonds may produce flexible transmembrane helices. Proc.Natl.Acad.Sci.USA 2012 109 8121 8126 3UTX 22566663 Crystal structure of bacteriorhodopsin mutant T46A 2011-11-27 2012-05-09 Cao, Z.,Bowie, J.U. Shifting hydrogen bonds may produce flexible transmembrane helices. Proc.Natl.Acad.Sci.USA 2012 109 8121 8126 3UTY 22566663 Crystal structure of bacteriorhodopsin mutant P50A/T46A 2011-11-27 2012-05-09 Cao, Z.,Bowie, J.U. Shifting hydrogen bonds may produce flexible transmembrane helices. Proc.Natl.Acad.Sci.USA 2012 109 8121 8126 3VRS 22678284 Crystal structure of fluoride riboswitch, soaked in Mn2+ 2012-04-13 2012-05-09 Ren, A.,Rajashankar, K.R.,Patel, D.J. Fluoride ion encapsulation by Mg2+ ions and phosphates in a fluoride riboswitch. Nature 2012 486 85 89 4EN5 22678284 Crystal structure of fluoride riboswitch, Tl-Acetate soaked 2012-04-12 2012-05-09 Ren, A.,Rajashankar, K.R.,Patel, D.J. Fluoride ion encapsulation by Mg2+ ions and phosphates in a fluoride riboswitch. Nature 2012 486 85 89 4ENA 22678284 Crystal structure of fluoride riboswitch, soaked in Cs+ 2012-04-12 2012-05-09 Ren, A.,Rajashankar, K.R.,Patel, D.J. Fluoride ion encapsulation by Mg2+ ions and phosphates in a fluoride riboswitch. Nature 2012 486 85 89 4ENB 22678284 Crystal structure of fluoride riboswitch, bound to Iridium 2012-04-12 2012-05-09 Ren, A.,Rajashankar, K.R.,Patel, D.J. Fluoride ion encapsulation by Mg2+ ions and phosphates in a fluoride riboswitch. Nature 2012 486 85 89 3RP6 23259842 Crystal Structure of Klebsiella pneumoniae HpxO complexed with FAD 2011-04-26 2012-05-16 Hicks, K.A.,O'Leary, S.E.,Begley, T.P.,Ealick, S.E. Structural and Mechanistic Studies of HpxO, a Novel Flavin Adenine Dinucleotide-Dependent Urate Oxidase from Klebsiella pneumoniae. Biochemistry 2013 52 477 487 3RP7 23259842 Crystal Structure of Klebsiella pneumoniae HpxO complexed with FAD and uric acid 2011-04-26 2012-05-16 Hicks, K.A.,O'Leary, S.E.,Begley, T.P.,Ealick, S.E. Structural and Mechanistic Studies of HpxO, a Novel Flavin Adenine Dinucleotide-Dependent Urate Oxidase from Klebsiella pneumoniae. Biochemistry 2013 52 477 487 3RP8 23259842 Crystal Structure of Klebsiella pneumoniae R204Q HpxO complexed with FAD 2011-04-26 2012-05-16 Hicks, K.A.,O'Leary, S.E.,Begley, T.P.,Ealick, S.E. Structural and Mechanistic Studies of HpxO, a Novel Flavin Adenine Dinucleotide-Dependent Urate Oxidase from Klebsiella pneumoniae. Biochemistry 2013 52 477 487 4DXA 22577140 Co-crystal structure of Rap1 in complex with KRIT1 2012-02-27 2012-05-16 Li, X.,Zhang, R.,Draheim, K.M.,Liu, W.,Calderwood, D.A.,Boggon, T.J. Structural Basis for Small G Protein Effector Interaction of Ras-related Protein 1 (Rap1) and Adaptor Protein Krev Interaction Trapped 1 (KRIT1). J.Biol.Chem. 2012 287 22317 22327 3TZM 21983015 TGF-beta Receptor type 1 in complex with SB431542 2011-09-27 2012-05-23 Ogunjimi, A.A.,Zeqiraj, E.,Ceccarelli, D.F.,Sicheri, F.,Wrana, J.L.,David, L. Structural Basis for Specificity of TGFbeta Family Receptor Small Molecule Inhibitors Cell Signal 2012 24 476 483 4D90 22601780 Crystal Structure of Del-1 EGF domains 2012-01-11 2012-05-30 Schurpf, T.,Chen, Q.,Liu, J.H.,Wang, R.,Springer, T.A.,Wang, J.H. The RGD finger of Del-1 is a unique structural feature critical for integrin binding. Faseb J. 2012 26 3412 3420 4DOT 22605381 Crystal structure of human HRASLS3. 2012-02-10 2012-05-30 Golczak, M.,Kiser, P.D.,Sears, A.E.,Lodowski, D.T.,Blaner, W.S.,Palczewski, K. Structural Basis for the Acyltransferase Activity of Lecithin:Retinol Acyltransferase-like Proteins. J.Biol.Chem. 2012 287 23790 23807 4DPZ 22605381 Crystal structure of human HRASLS2 2012-02-14 2012-05-30 Golczak, M.,Kiser, P.D.,Sears, A.E.,Lodowski, D.T.,Blaner, W.S.,Palczewski, K. Structural Basis for the Acyltransferase Activity of Lecithin:Retinol Acyltransferase-like Proteins. J.Biol.Chem. 2012 287 23790 23807 4EGG 22654060 Computationally Designed Self-assembling tetrahedron protein, T310 2012-03-30 2012-05-30 King, N.P.,Sheffler, W.,Sawaya, M.R.,Vollmar, B.S.,Sumida, J.P.,Andre, I.,Gonen, T.,Yeates, T.O.,Baker, D. Computational design of self-assembling protein nanomaterials with atomic level accuracy. Science 2012 336 1171 1174 3RZH 22659876 Duplex Interrogation by a Direct DNA Repair Protein in the Search of Damage 2011-05-11 2012-06-06 Yi, C.,Chen, B.,Qi, B.,Zhang, W.,Jia, G.,Zhang, L.,Li, C.J.,Dinner, A.R.,Yang, C.G.,He, C. Duplex interrogation by a direct DNA repair protein in search of base damage Nat.Struct.Mol.Biol. 2012 19 671 676 3RZH 22659876 Duplex Interrogation by a Direct DNA Repair Protein in the Search of Damage 2011-05-11 2012-06-06 Yi, C.,Chen, B.,Qi, B.,Zhang, W.,Jia, G.,Zhang, L.,Li, C.J.,Dinner, A.R.,Yang, C.G.,He, C. Duplex interrogation by a direct DNA repair protein in search of base damage Nat.Struct.Mol.Biol. 2012 19 671 676 3RZL 22659876 Duplex Interrogation by a Direct DNA Repair Protein in the Search of Damage 2011-05-11 2012-06-06 Yi, C.,Chen, B.,Qi, B.,Zhang, W.,Jia, G.,Zhang, L.,Li, C.J.,Dinner, A.R.,Yang, C.G.,He, C. Duplex interrogation by a direct DNA repair protein in search of base damage Nat.Struct.Mol.Biol. 2012 19 671 676 3RZL 22659876 Duplex Interrogation by a Direct DNA Repair Protein in the Search of Damage 2011-05-11 2012-06-06 Yi, C.,Chen, B.,Qi, B.,Zhang, W.,Jia, G.,Zhang, L.,Li, C.J.,Dinner, A.R.,Yang, C.G.,He, C. Duplex interrogation by a direct DNA repair protein in search of base damage Nat.Struct.Mol.Biol. 2012 19 671 676 3VCD 22654060 Computationally Designed Self-assembling Octahedral Cage protein, O333, Crystallized in space group R32 2012-01-03 2012-06-06 King, N.P.,Sheffler, W.,Sawaya, M.R.,Vollmar, B.S.,Sumida, J.P.,Andre, I.,Gonen, T.,Yeates, T.O.,Baker, D. Computational design of self-assembling protein nanomaterials with atomic level accuracy. Science 2012 336 1171 1174 4DCL 22654060 Computationally Designed Self-assembling tetrahedron protein, T308, Crystallized in space group F23 2012-01-17 2012-06-06 King, N.P.,Sheffler, W.,Sawaya, M.R.,Vollmar, B.S.,Sumida, J.P.,Andre, I.,Gonen, T.,Yeates, T.O.,Baker, D. Computational design of self-assembling protein nanomaterials with atomic level accuracy. Science 2012 336 1171 1174 4DDF 22654060 Computationally Designed Self-assembling Octahedral Cage protein, O333, Crystallized in space group P4 2012-01-18 2012-06-06 King, N.P.,Sheffler, W.,Sawaya, M.R.,Vollmar, B.S.,Sumida, J.P.,Andre, I.,Gonen, T.,Yeates, T.O.,Baker, D. Computational design of self-assembling protein nanomaterials with atomic level accuracy. Science 2012 336 1171 1174 4DXT 22632968 Human SUN2 (AA 522-717) 2012-02-28 2012-06-06 Sosa, B.A.,Rothballer, A.,Kutay, U.,Schwartz, T.U. LINC Complexes Form by Binding of Three KASH Peptides to Domain Interfaces of Trimeric SUN Proteins. Cell(Cambridge,Mass.) 2012 149 1035 1047 4E8U 22592791 Crystal structure of Arabidopsis IDN2 XS domain along with a small segment of adjacent coiled-coil region 2012-03-20 2012-06-06 Ausin, I.,Greenberg, M.V.,Simanshu, D.K.,Hale, C.J.,Vashisht, A.A.,Simon, S.A.,Lee, T.F.,Feng, S.,Espanola, S.D.,Meyers, B.C.,Wohlschlegel, J.A.,Patel, D.J.,Jacobsen, S.E. INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis. Proc.Natl.Acad.Sci.USA 2012 109 8374 8381 4F11 22660477 Crystal structure of the extracellular domain of human GABA(B) receptor GBR2 2012-05-05 2012-06-06 Geng, Y.,Xiong, D.,Mosyak, L.,Malito, D.L.,Kniazeff, J.,Chen, Y.,Burmakina, S.,Quick, M.,Bush, M.,Javitch, J.A.,Pin, J.P.,Fan, Q.R. Structure and functional interaction of the extracellular domain of human GABA(B) receptor GBR2. Nat.Neurosci. 2012 15 970 978 4DSH 22646091 Crystal structure of reduced UDP-Galactopyranose mutase 2012-02-18 2012-06-13 Dhatwalia, R.,Singh, H.,Oppenheimer, M.,Sobrado, P.,Tanner, J.J. Crystal Structures of Trypanosoma cruzi UDP-Galactopyranose Mutase Implicate Flexibility of the Histidine Loop in Enzyme Activation. Biochemistry 2012 51 4968 4979 4ECH 22642831 Yeast Polyamine Oxidase FMS1, H67Q Mutant 2012-03-26 2012-06-13 Adachi, M.S.,Taylor, A.B.,Hart, P.J.,Fitzpatrick, P.F. Mechanistic and structural analyses of the role of his67 in the yeast polyamine oxidase fms1. Biochemistry 2012 51 4888 4897 4F1N 22722195 Crystal structure of Kluyveromyces polysporus Argonaute with a guide RNA 2012-05-07 2012-06-13 Nakanishi, K.,Weinberg, D.E.,Bartel, D.P.,Patel, D.J. Structure of yeast Argonaute with guide RNA. Nature 2012 486 368 374 4F43 22582388 Protelomerase TelA mutant R255A complexed with CAAG hairpin DNA 2012-05-10 2012-06-13 Huang, W.M.,Dagloria, J.,Fox, H.,Ruan, Q.,Tillou, J.,Shi, K.,Aihara, H.,Aron, J.,Casjens, S. Linear Chromosome-generating System of Agrobacterium tumefaciens C58: PROTELOMERASE GENERATES AND PROTECTS HAIRPIN ENDS. J.Biol.Chem. 2012 287 25551 25563 3T51 22683351 Crystal structures of the pre-extrusion and extrusion states of the CusBA adaptor-transporter complex 2011-07-26 2012-06-20 Su, C.C.,Long, F.,Lei, H.T.,Bolla, J.R.,Do, S.V.,Rajashankar, K.R.,Yu, E.W. Charged Amino Acids (R83, E567, D617, E625, R669, and K678) of CusA Are Required for Metal Ion Transport in the Cus Efflux System. J.Mol.Biol. 2012 422 429 441 3T56 22683351 Crystal structure of the pre-extrusion state of the CusBA adaptor-transporter complex 2011-07-26 2012-06-20 Su, C.C.,Long, F.,Lei, H.T.,Bolla, J.R.,Do, S.V.,Rajashankar, K.R.,Yu, E.W. Charged Amino Acids (R83, E567, D617, E625, R669, and K678) of CusA Are Required for Metal Ion Transport in the Cus Efflux System. J.Mol.Biol. 2012 422 429 441 4D9J 22654051 Structure of a 16 nm protein cage designed by fusing symmetric oligomeric domains 2012-01-11 2012-06-20 Lai, Y.T.,Cascio, D.,Yeates, T.O. Structure of a 16-nm cage designed by using protein oligomers. Science 2012 336 1129 1129 4DNT 22683351 Crystal structure of the CusBA heavy-metal efflux complex from Escherichia coli, mutant 2012-02-09 2012-06-20 Su, C.C.,Long, F.,Lei, H.T.,Bolla, J.R.,Do, S.V.,Rajashankar, K.R.,Yu, E.W. Charged Amino Acids (R83, E567, D617, E625, R669, and K678) of CusA Are Required for Metal Ion Transport in the Cus Efflux System. J.Mol.Biol. 2012 422 429 441 4DOP 22683351 Crystal structure of the CusBA heavy-metal efflux complex from Escherichia coli, R mutant 2012-02-10 2012-06-20 Su, C.C.,Long, F.,Lei, H.T.,Bolla, J.R.,Do, S.V.,Rajashankar, K.R.,Yu, E.W. Charged Amino Acids (R83, E567, D617, E625, R669, and K678) of CusA Are Required for Metal Ion Transport in the Cus Efflux System. J.Mol.Biol. 2012 422 429 441 4ERD 22705372 Crystal structure of the C-terminal domain of Tetrahymena telomerase protein p65 in complex with stem IV of telomerase RNA 2012-04-19 2012-06-20 Singh, M.,Wang, Z.,Koo, B.K.,Patel, A.,Cascio, D.,Collins, K.,Feigon, J. Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65. Mol.Cell 2012 47 16 26 4DCK 22705208 Crystal structure of the C-terminus of voltage-gated sodium channel in complex with FGF13 and CaM 2012-01-17 2012-06-27 Wang, C.,Chung, B.C.,Yan, H.,Lee, S.Y.,Pitt, G.S. Crystal Structure of the Ternary Complex of a NaV C-Terminal Domain, a Fibroblast Growth Factor Homologous Factor, and Calmodulin. Structure 2012 20 1167 1176 3U2G 22753492 Crystal structure of the C-terminal DUF1608 domain of the Methanosarcina acetivorans S-layer (MA0829) protein 2011-10-03 2012-07-04 Arbing, M.A.,Chan, S.,Shin, A.,Phan, T.,Ahn, C.J.,Rohlin, L.,Gunsalus, R.P. Structure of the surface layer of the methanogenic archaean Methanosarcina acetivorans. Proc.Natl.Acad.Sci.USA 2012 109 11812 11817 3U2H 22753492 Crystal structure of the C-terminal DUF1608 domain of the Methanosarcina acetivorans S-layer (MA0829) protein 2011-10-03 2012-07-04 Arbing, M.A.,Chan, S.,Shin, A.,Phan, T.,Ahn, C.J.,Rohlin, L.,Gunsalus, R.P. Structure of the surface layer of the methanogenic archaean Methanosarcina acetivorans. Proc.Natl.Acad.Sci.USA 2012 109 11812 11817 4ERM 22727814 Crystal structure of the dATP inhibited E. coli class Ia ribonucleotide reductase complex at 4 Angstroms resolution 2012-04-20 2012-07-04 Zimanyi, C.M.,Ando, N.,Brignole, E.J.,Asturias, F.J.,Stubbe, J.,Drennan, C.L. Tangled up in knots: structures of inactivated forms of E. coli class Ia ribonucleotide reductase. Structure 2012 20 1374 1383 4DOH 22802649 IL20/IL201/IL20R2 Ternary Complex 2012-02-09 2012-07-18 Logsdon, N.J.,Deshpande, A.,Harris, B.D.,Rajashankar, K.R.,Walter, M.R. Structural basis for receptor sharing and activation by interleukin-20 receptor-2 (IL-20R2) binding cytokines. Proc.Natl.Acad.Sci.USA 2012 109 12704 12709 4FZ0 22842900 Crystal structure of acid-sensing ion channel in complex with psalmotoxin 1 at low pH 2012-07-05 2012-08-01 Baconguis, I.,Gouaux, E. Structural plasticity and dynamic selectivity of acid-sensing ion channel-spider toxin complexes. Nature 2012 489 400 405 4EYU 22842901 The free structure of the mouse C-terminal domain of KDM6B 2012-05-01 2012-08-08 Kruidenier, L.,Chung, C.W.,Cheng, Z.,Liddle, J.,Che, K.,Joberty, G.,Bantscheff, M.,Bountra, C.,Bridges, A.,Diallo, H.,Eberhard, D.,Hutchinson, S.,Jones, E.,Katso, R.,Leveridge, M.,Mander, P.K.,Mosley, J.,Ramirez-Molina, C.,Rowland, P.,Schofield, C.J.,Sheppard, R.J.,Smith, J.E.,Swales, C.,Tanner, R.,Thomas, P.,Tumber, A.,Drewes, G.,Oppermann, U.,Patel, D.J.,Lee, K.,Wilson, D.M. A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage response. Nature 2012 488 404 408 4EZH 22842901 the crystal structure of KDM6B bound with H3K27me3 peptide 2012-05-02 2012-08-08 Kruidenier, L.,Chung, C.W.,Cheng, Z.,Liddle, J.,Che, K.,Joberty, G.,Bantscheff, M.,Bountra, C.,Bridges, A.,Diallo, H.,Eberhard, D.,Hutchinson, S.,Jones, E.,Katso, R.,Leveridge, M.,Mander, P.K.,Mosley, J.,Ramirez-Molina, C.,Rowland, P.,Schofield, C.J.,Sheppard, R.J.,Smith, J.E.,Swales, C.,Tanner, R.,Thomas, P.,Tumber, A.,Drewes, G.,Oppermann, U.,Patel, D.J.,Lee, K.,Wilson, D.M. A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage response. Nature 2012 488 404 408 4FY0 22836580 Crystal structure of LeuT-F253A bound to L-selenomethionine from lipid bicelles 2012-07-03 2012-08-08 Wang, H.,Gouaux, E. Substrate binds in the S1 site of the F253A mutant of LeuT, a neurotransmitter sodium symporter homologue. Embo Rep. 2012 13 861 866 4F3M 22841292 Crystal structure of CRISPR-associated protein 2012-05-09 2012-08-15 Nam, K.H.,Haitjema, C.,Liu, X.,Ding, F.,Wang, H.,Delisa, M.P.,Ke, A. Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System. Structure 2012 20 1574 1584 4E4E 22908245 Crystal Structure of the Y34F mutant of Saccharomyces cerevisiae Manganese Superoxide Dismutase 2012-03-12 2012-08-22 Sheng, Y.,Butler Gralla, E.,Schumacher, M.,Cascio, D.,Cabelli, D.E.,Selverstone Valentine, J. Six-coordinate manganese(3+) in catalysis by yeast manganese superoxide dismutase. Proc.Natl.Acad.Sci.USA 2012 109 14314 14319 4FDI 22940367 The molecular basis of mucopolysaccharidosis IV A 2012-05-28 2012-09-05 Rivera-Colon, Y.,Schutsky, E.K.,Kita, A.Z.,Garman, S.C. The Structure of Human GALNS Reveals the Molecular Basis for Mucopolysaccharidosis IV A. J.Mol.Biol. 2012 423 736 751 4FMB 22939626 VirA-Rab1 complex structure 2012-06-16 2012-09-05 Dong, N.,Zhu, Y.,Lu, Q.,Hu, L.,Zheng, Y.,Shao, F. Structurally Distinct Bacterial TBC-like GAPs Link Arf GTPase to Rab1 Inactivation to Counteract Host Defenses. Cell(Cambridge,Mass.) 2012 150 1029 1041 3SUI 23109716 Crystal structure of ca2+-calmodulin in complex with a trpv1 c-terminal peptide 2011-07-11 2012-09-12 Lau, S.Y.,Procko, E.,Gaudet, R. Distinct properties of Ca2+-calmodulin binding to N- and C-terminal regulatory regions of the TRPV1 channel. J.Gen.Physiol. 2012 140 541 555 3UC9 22993212 Crystal Structure of Yeast Irc6p - A Novel Type of Conserved Clathrin Accessory Protein 2011-10-26 2012-09-12 Gorynia, S.,Lorenz, T.C.,Costaguta, G.,Daboussi, L.,Cascio, D.,Payne, G.S. Yeast Irc6p is a novel type of conserved clathrin coat accessory factor related to small G proteins. Mol Biol Cell 2012 23 4416 4429 4FIE 22988085 Full-length human PAK4 2012-06-08 2012-09-12 Ha, B.H.,Davis, M.J.,Chen, C.,Lou, H.J.,Gao, J.,Zhang, R.,Krauthammer, M.,Halaban, R.,Schlessinger, J.,Turk, B.E.,Boggon, T.J. Type II p21-activated kinases (PAKs) are regulated by an autoinhibitory pseudosubstrate. Proc.Natl.Acad.Sci.USA 2012 109 16107 16112 4FIG 22988085 Catalytic domain of human PAK4 2012-06-08 2012-09-12 Ha, B.H.,Davis, M.J.,Chen, C.,Lou, H.J.,Gao, J.,Zhang, R.,Krauthammer, M.,Halaban, R.,Schlessinger, J.,Turk, B.E.,Boggon, T.J. Type II p21-activated kinases (PAKs) are regulated by an autoinhibitory pseudosubstrate. Proc.Natl.Acad.Sci.USA 2012 109 16107 16112 4FIJ 22988085 Catalytic domain of human PAK4 2012-06-08 2012-09-12 Ha, B.H.,Davis, M.J.,Chen, C.,Lou, H.J.,Gao, J.,Zhang, R.,Krauthammer, M.,Halaban, R.,Schlessinger, J.,Turk, B.E.,Boggon, T.J. Type II p21-activated kinases (PAKs) are regulated by an autoinhibitory pseudosubstrate. Proc.Natl.Acad.Sci.USA 2012 109 16107 16112 3TSO Structure of the cancer associated Rab25 protein in complex with FIP2 2011-09-13 2012-09-19 Oda, S.,Lall, P.Y.,McCaffrey, M.W.,Khan, A.R. Structure of the cancer associated Rab25 protein in complex with FIP2 TO BE PUBLISHED 0 0 0 0 4ESW 22568620 Crystal structure of C. albicans Thi5 H66G mutant 2012-04-23 2012-09-19 Lai, R.Y.,Huang, S.,Fenwick, M.K.,Hazra, A.,Zhang, Y.,Rajashankar, K.,Philmus, B.,Kinsland, C.,Sanders, J.M.,Ealick, S.E.,Begley, T.P. Thiamin pyrimidine biosynthesis in Candida albicans : a remarkable reaction between histidine and pyridoxal phosphate. J.Am.Chem.Soc. 2012 134 9157 9159 4ESW 22568620 Crystal structure of C. albicans Thi5 H66G mutant 2012-04-23 2012-09-19 Lai, R.Y.,Huang, S.,Fenwick, M.K.,Hazra, A.,Zhang, Y.,Rajashankar, K.,Philmus, B.,Kinsland, C.,Sanders, J.M.,Ealick, S.E.,Begley, T.P. Thiamin pyrimidine biosynthesis in Candida albicans : a remarkable reaction between histidine and pyridoxal phosphate. J.Am.Chem.Soc. 2012 134 9157 9159 4ESX 22568620 Crystal structure of C. albicans Thi5 complexed with PLP 2012-04-23 2012-09-19 Lai, R.Y.,Huang, S.,Fenwick, M.K.,Hazra, A.,Zhang, Y.,Rajashankar, K.,Philmus, B.,Kinsland, C.,Sanders, J.M.,Ealick, S.E.,Begley, T.P. Thiamin pyrimidine biosynthesis in Candida albicans : a remarkable reaction between histidine and pyridoxal phosphate. J.Am.Chem.Soc. 2012 134 9157 9159 4F52 22748924 Structure of a Glomulin-RBX1-CUL1 complex 2012-05-11 2012-09-19 Duda, D.M.,Olszewski, J.L.,Tron, A.E.,Hammel, M.,Lambert, L.J.,Waddell, M.B.,Mittag, T.,Decaprio, J.A.,Schulman, B.A. Structure of a Glomulin-RBX1-CUL1 Complex: Inhibition of a RING E3 Ligase through Masking of Its E2-Binding Surface. Mol.Cell 2012 47 371 382 3TU5 23009842 Actin complex with Gelsolin Segment 1 fused to Cobl segment 2011-09-15 2012-09-26 Durer, Z.A.,Kudryashov, D.S.,Sawaya, M.R.,Altenbach, C.,Hubbell, W.,Reisler, E. Structural States and dynamics of the d-loop in actin. Biophys.J. 2012 103 930 939 4FCC 22955883 Glutamate dehydrogenase from E. coli 2012-05-24 2012-09-26 Bilokapic, S.,Schwartz, T.U. Molecular basis for Nup37 and ELY5/ELYS recruitment to the nuclear pore complex. Proc.Natl.Acad.Sci.USA 2012 109 15241 15246 4FHL 22955883 Nucleoporin Nup37 from Schizosaccharomyces pombe 2012-06-06 2012-09-26 Bilokapic, S.,Schwartz, T.U. Molecular basis for Nup37 and ELY5/ELYS recruitment to the nuclear pore complex. Proc.Natl.Acad.Sci.USA 2012 109 15241 15246 4FHM 22955883 Nup37-Nup120(aa1-961) complex from Schizosaccharomyces pombe 2012-06-06 2012-09-26 Bilokapic, S.,Schwartz, T.U. Molecular basis for Nup37 and ELY5/ELYS recruitment to the nuclear pore complex. Proc.Natl.Acad.Sci.USA 2012 109 15241 15246 4FHN 22955883 Nup37-Nup120 full-length complex from Schizosaccharomyces pombe 2012-06-06 2012-09-26 Bilokapic, S.,Schwartz, T.U. Molecular basis for Nup37 and ELY5/ELYS recruitment to the nuclear pore complex. Proc.Natl.Acad.Sci.USA 2012 109 15241 15246 4FX0 22992749 Crystal structure of M. tuberculosis transcriptional regulator MosR 2012-07-02 2012-09-26 Brugarolas, P.,Movahedzadeh, F.,Wang, Y.,Zhang, N.,Bartek, I.L.,Gao, Y.N.,Voskuil, M.I.,Franzblau, S.G.,He, C. The Oxidation-sensing Regulator (MosR) Is a New Redox-dependent Transcription Factor in Mycobacterium tuberculosis. J.Biol.Chem. 2012 287 37703 37712 4FX4 22992749 Crystal structure of M. tuberculosis transcriptional regulator MOSR (Rv1049) in compex with DNA 2012-07-02 2012-09-26 Brugarolas, P.,Movahedzadeh, F.,Wang, Y.,Zhang, N.,Bartek, I.L.,Gao, Y.N.,Voskuil, M.I.,Franzblau, S.G.,He, C. The Oxidation-sensing Regulator (MosR) Is a New Redox-dependent Transcription Factor in Mycobacterium tuberculosis. J.Biol.Chem. 2012 287 37703 37712 4GZR 24312350 Crystal structure of the Mycobacterium tuberculosis H37Rv EsxOP (Rv2346c-Rv2347c) complex in space group C2221 2012-09-06 2012-09-26 Arbing, M.A.,Chan, S.,Harris, L.,Kuo, E.,Zhou, T.T.,Ahn, C.J.,Nguyen, L.,He, Q.,Lu, J.,Menchavez, P.T.,Shin, A.,Holton, T.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Heterologous expression of mycobacterial Esx complexes in Escherichia coli for structural studies is facilitated by the use of maltose binding protein fusions. Plos One 2013 8 0 0 4AY2 23022350 Capturing 5' tri-phosphorylated RNA duplex by RIG-I 2012-06-17 2012-10-03 Luo, D.,Kohlway, A.,Vela, A.,Pyle, A.M. Visualizing the Determinants of Viral RNA Recognition by Innate Immune Sensor Rig-I. Structure 2012 20 1983 0 4F3D 23012475 Structure of RPE65: P65 crystal form grown in Fos-Choline-10 2012-05-09 2012-10-03 Kiser, P.D.,Farquhar, E.R.,Shi, W.,Sui, X.,Chance, M.R.,Palczewski, K. Structure of RPE65 isomerase in a lipidic matrix reveals roles for phospholipids and iron in catalysis. Proc.Natl.Acad.Sci.USA 2012 109 0 0 4DJS 23071338 Structure of beta-catenin in complex with a stapled peptide inhibitor 2012-02-02 2012-10-17 Grossmann, T.N.,Yeh, J.T.,Bowman, B.R.,Chu, Q.,Moellering, R.E.,Verdine, G.L. Inhibition of oncogenic Wnt signaling through direct targeting of beta-catenin. Proc.Natl.Acad.Sci.USA 2012 109 17942 17947 4GDE 23036087 Crystal structure of NADPH-reduced Aspergillus fumigatus UDP-galactopyranose 2012-07-31 2012-10-17 Dhatwalia, R.,Singh, H.,Solano, L.M.,Oppenheimer, M.,Robinson, R.M.,Ellerbrock, J.F.,Sobrado, P.,Tanner, J.J. Identification of the NAD(P)H Binding Site of Eukaryotic UDP-Galactopyranose Mutase. J.Am.Chem.Soc. 2012 134 18132 18138 4GDP 23034052 Yeast polyamine oxidase FMS1, N195A mutant 2012-08-01 2012-10-17 Adachi, M.S.,Taylor, A.B.,Hart, P.J.,Fitzpatrick, P.F. Mechanistic and Structural Analyses of the Roles of Active Site Residues in Yeast Polyamine Oxidase Fms1: Characterization of the N195A and D94N Enzymes. Biochemistry 2012 51 8690 8697 4GLI 23022347 Crystal Structure of Human SMN YG-Dimer 2012-08-14 2012-10-17 Martin, R.,Gupta, K.,Ninan, N.S.,Perry, K.,Van Duyne, G.D. The survival motor neuron protein forms soluble glycine zipper oligomers. Structure 2012 20 1929 1939 4ESV 23022319 A New Twist on the Translocation Mechanism of Helicases from the Structure of DnaB with its Substrates 2012-04-23 2012-10-24 Itsathitphaisarn, O.,Wing, R.A.,Eliason, W.K.,Wang, J.,Steitz, T.A. The Hexameric Helicase DnaB Adopts a Nonplanar Conformation during Translocation. Cell(Cambridge,Mass.) 2012 151 267 277 3T4G 23089868 AIIGLMV segment from Alzheimer's Amyloid-Beta displayed on 54-membered macrocycle scaffold 2011-07-26 2012-10-31 Cheng, P.N.,Liu, C.,Zhao, M.,Eisenberg, D.,Nowick, J.S. Amyloid beta-sheet mimics that antagonize protein aggregation and reduce amyloid toxicity. Nat Chem 2012 4 927 933 4F1H 23104058 Crystal structure of TDP2 from Danio rerio complexed with a single strand DNA 2012-05-06 2012-10-31 Shi, K.,Kurahashi, K.,Gao, R.,Tsutakawa, S.E.,Tainer, J.A.,Pommier, Y.,Aihara, H. Structural basis for recognition of 5'-phosphotyrosine adducts by Tdp2. Nat.Struct.Mol.Biol. 2012 19 1372 1377 4FVA 23104058 Crystal structure of truncated Caenorhabditis elegans TDP2 2012-06-29 2012-10-31 Shi, K.,Kurahashi, K.,Gao, R.,Tsutakawa, S.E.,Tainer, J.A.,Pommier, Y.,Aihara, H. Structural basis for recognition of 5'-phosphotyrosine adducts by Tdp2. Nat.Struct.Mol.Biol. 2012 19 1372 1377 4GEW 23104058 Crystal structure of TDP2 from C. elegans 2012-08-02 2012-10-31 Shi, K.,Kurahashi, K.,Gao, R.,Tsutakawa, S.E.,Tainer, J.A.,Pommier, Y.,Aihara, H. Structural basis for recognition of 5'-phosphotyrosine adducts by Tdp2. Nat.Struct.Mol.Biol. 2012 19 1372 1377 4GIJ 23066817 Crystal Structure of Pseudouridine Monophosphate Glycosidase Complexed with Sulfate 2012-08-08 2012-10-31 Huang, S.,Mahanta, N.,Begley, T.P.,Ealick, S.E. Pseudouridine monophosphate glycosidase: a new glycosidase mechanism. Biochemistry 2012 51 9245 9255 4GIK 23066817 Crystal Structure of Pseudouridine Monophosphate Glycosidase/Linear R5P Adduct 2012-08-08 2012-10-31 Huang, S.,Mahanta, N.,Begley, T.P.,Ealick, S.E. Pseudouridine monophosphate glycosidase: a new glycosidase mechanism. Biochemistry 2012 51 9245 9255 4GIL 23066817 Crystal Structure of Pseudouridine Monophosphate Glycosidase/Linear Pseudouridine 5'-Phosphate Adduct 2012-08-08 2012-10-31 Huang, S.,Mahanta, N.,Begley, T.P.,Ealick, S.E. Pseudouridine monophosphate glycosidase: a new glycosidase mechanism. Biochemistry 2012 51 9245 9255 3UIV Human serum albumin-myristate-amantadine hydrochloride complex 2011-11-06 2012-11-07 Curry, S. Structural basis of the drug-binding specificity of human serum albumin TO BE PUBLISHED 0 0 0 0 4F3J 22892318 Crystal Structure of Trimeric gC1q Domain of Human C1QTNF5 associated with Late-onset Retinal Macular Degeneration 2012-05-09 2012-11-07 Tu, X.,Palczewski, K. Crystal structure of the globular domain of C1QTNF5: Implications for late-onset retinal macular degeneration. J.Struct.Biol. 2012 180 439 446 4DR1 23322043 Crystal structure of the apo 30S ribosomal subunit from Thermus thermophilus (HB8) 2012-02-16 2012-11-14 Demirci, H.,Murphy, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin-induced misreading of the genetic code. Nat Commun 2013 4 1355 1355 4DR2 23322043 Crystal structure of the Thermus thermophilus (HB8) 30S ribosomal subunit with multiple copies of paromomycin molecules bound 2012-02-16 2012-11-14 Demirci, H.,Murphy, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin-induced misreading of the genetic code. Nat Commun 2013 4 1355 1355 4DR3 23322043 Crystal structure of the Thermus thermophilus (HB8) 30S ribosomal subunit with streptomycin bound 2012-02-16 2012-11-14 Demirci, H.,Murphy, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin-induced misreading of the genetic code. Nat Commun 2013 4 1355 1355 4DR4 23322043 Crystal structure of the Thermus thermophilus (HB8) 30S ribosomal subunit with codon, cognate transfer RNA anticodon stem-loop and multiple copies of paromomycin molecules bound 2012-02-16 2012-11-14 Demirci, H.,Murphy, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin-induced misreading of the genetic code. Nat Commun 2013 4 1355 1355 4E8N 23101623 Structure of Oceanobacillus iheyensis group II intron in a ligand-free state in the presence of NH4+ and Mg2+ 2012-03-20 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4E8P 23101623 Structure of Oceanobacillus iheyensis group II intron in a ligand-free state in the presence of Rb+ and Mg2+ 2012-03-20 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4E8Q 23101623 Structure of Oceanobacillus iheyensis group II intron in a ligand-free state in the presence of Tl+ and Mg2+ 2012-03-20 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4E8R 23101623 Structure of Oceanobacillus iheyensis group II intron in a ligand-free state in the presence of Cs+ and Mg2+ 2012-03-20 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4E8T 23101623 Structure of Oceanobacillus iheyensis group II intron in the presence of K+, Ca2+ and an oligonucleotide fragment substrate (low energy dataset) 2012-03-20 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4E8V 23101623 Structure of Oceanobacillus iheyensis group II intron in a ligand-free state in the presence of K+ and Ba2+ 2012-03-20 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4FAQ 23101623 Structure of Oceanobacillus iheyensis group II intron in the presence of K+, Ca2+ and 5'-exon 2012-05-22 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4FAU 23101623 Structure of Oceanobacillus iheyensis group II intron in the presence of Li+, Mg2+ and 5'-exon 2012-05-22 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4FAW 23101623 Structure of Oceanobacillus iheyensis group II intron in the presence of K+, Mg2+ and a hydrolyzed oligonucleotide fragment 2012-05-22 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4FAX 23101623 Structure of Oceanobacillus iheyensis group II intron in a ligand-free state in the presence of Na+ and Mg2+ 2012-05-22 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4FB0 23101623 Structure of Oceanobacillus iheyensis group II intron C377G mutant in a ligand-free state in the presence of K+ and Mg2+ 2012-05-22 2012-11-14 Marcia, M.,Pyle, A.M. Visualizing Group II Intron Catalysis through the Stages of Splicing. Cell(Cambridge,Mass.) 2012 151 497 507 4GSK 23142976 Crystal structure of an Atg7-Atg10 crosslinked complex 2012-08-27 2012-11-14 Kaiser, S.E.,Mao, K.,Taherbhoy, A.M.,Yu, S.,Olszewski, J.L.,Duda, D.M.,Kurinov, I.,Deng, A.,Fenn, T.D.,Klionsky, D.J.,Schulman, B.A. Noncanonical E2 recruitment by the autophagy E1 revealed by Atg7-Atg3 and Atg7-Atg10 structures. Nat.Struct.Mol.Biol. 2012 19 1242 1249 4GOP 23070815 Structure and Conformational Change of a Replication Protein A Heterotrimer Bound to ssDNA 2012-08-20 2012-11-28 Fan, J.,Pavletich, N.P. Structure and conformational change of a replication protein A heterotrimer bound to ssDNA. Genes Dev. 2012 26 2337 2347 4H6Q 23151026 Structure of oxidized Deinococcus radiodurans proline dehydrogenase complexed with L-tetrahydrofuroic acid 2012-09-19 2012-11-28 Luo, M.,Arentson, B.W.,Srivastava, D.,Becker, D.F.,Tanner, J.J. Crystal structures and kinetics of monofunctional proline dehydrogenase provide insight into substrate recognition and conformational changes associated with flavin reduction and product release. Biochemistry 2012 51 10099 10108 3UJ3 23275567 Crystal Structure of the synaptic tetramer of the G-Segment Invertase (Gin) 2011-11-07 2012-12-05 Ritacco, C.J.,Kamtekar, S.,Wang, J.,Steitz, T.A. Crystal structure of an intermediate of rotating dimers within the synaptic tetramer of the G-segment invertase. Nucleic Acids Res. 2013 41 2673 2682 4GZM 23284172 Crystal structure of RAC1 F28L mutant 2012-09-06 2012-12-12 Davis, M.J.,Ha, B.H.,Holman, E.C.,Halaban, R.,Schlessinger, J.,Boggon, T.J. RAC1P29S is a spontaneously activating cancer-associated GTPase. Proc.Natl.Acad.Sci.USA 2013 110 912 917 3UX4 23222544 Crystal structure of the urea channel from the human gastric pathogen Helicobacter pylori 2011-12-03 2012-12-19 Strugatsky, D.,McNulty, R.,Munson, K.,Chen, C.K.,Soltis, S.M.,Sachs, G.,Luecke, H. Structure of the proton-gated urea channel from the gastric pathogen Helicobacter pylori. Nature 2012 493 2 258 4E0K 23213214 Crystal Structure of the amyloid-fibril forming peptide KDWSFY derived from human Beta 2 Microglobulin (58-63) 2012-03-04 2012-12-19 Liu, C.,Zhao, M.,Jiang, L.,Cheng, P.N.,Park, J.,Sawaya, M.R.,Pensalfini, A.,Gou, D.,Berk, A.J.,Glabe, C.G.,Nowick, J.,Eisenberg, D. Out-of-register beta-sheets suggest a pathway to toxic amyloid aggregates. Proc.Natl.Acad.Sci.USA 2012 109 20913 20918 4E0L 23213214 FYLLYYT segment from human Beta 2 Microglobulin (62-68) displayed on 54-membered macrocycle scaffold 2012-03-04 2012-12-19 Liu, C.,Zhao, M.,Jiang, L.,Cheng, P.N.,Park, J.,Sawaya, M.R.,Pensalfini, A.,Gou, D.,Berk, A.J.,Glabe, C.G.,Nowick, J.,Eisenberg, D. Out-of-register beta-sheets suggest a pathway to toxic amyloid aggregates. Proc.Natl.Acad.Sci.USA 2012 109 20913 20918 4E0N 23213214 SVQIVYK segment from human Tau (305-311) displayed on 54-membered macrocycle scaffold (form II) 2012-03-04 2012-12-19 Liu, C.,Zhao, M.,Jiang, L.,Cheng, P.N.,Park, J.,Sawaya, M.R.,Pensalfini, A.,Gou, D.,Berk, A.J.,Glabe, C.G.,Nowick, J.,Eisenberg, D. Out-of-register beta-sheets suggest a pathway to toxic amyloid aggregates. Proc.Natl.Acad.Sci.USA 2012 109 20913 20918 4E0O 23213214 SVQIVYK segment from human Tau (305-311) displayed on 54-membered macrocycle scaffold (form III) 2012-03-04 2012-12-19 Liu, C.,Zhao, M.,Jiang, L.,Cheng, P.N.,Park, J.,Sawaya, M.R.,Pensalfini, A.,Gou, D.,Berk, A.J.,Glabe, C.G.,Nowick, J.,Eisenberg, D. Out-of-register beta-sheets suggest a pathway to toxic amyloid aggregates. Proc.Natl.Acad.Sci.USA 2012 109 20913 20918 4GS0 23296072 Crystal structure of SHP1 catalytic domain with JAK1 activation loop peptide 2012-08-27 2012-12-19 Alicea-Velazquez, N.L.,Jakoncic, J.,Boggon, T.J. Structure-guided studies of the SHP-1/JAK1 interaction provide new insights into phosphatase catalytic domain substrate recognition. J.Struct.Biol. 2013 181 243 251 4I8G 23897468 Bovine trypsin at 0.8 resolution 2012-12-03 2012-12-19 Liebschner, D.,Dauter, M.,Brzuszkiewicz, A.,Dauter, Z. On the reproducibility of protein crystal structures: five atomic resolution structures of trypsin. Acta Crystallogr.,Sect.D 2013 69 1447 1462 4I8H 23897468 Bovine trypsin at 0.75 resolution 2012-12-03 2012-12-19 Liebschner, D.,Dauter, M.,Brzuszkiewicz, A.,Dauter, Z. On the reproducibility of protein crystal structures: five atomic resolution structures of trypsin. Acta Crystallogr.,Sect.D 2013 69 1447 1462 4I8J 23897468 Bovine trypsin at 0.87 A resolution 2012-12-03 2012-12-19 Liebschner, D.,Dauter, M.,Brzuszkiewicz, A.,Dauter, Z. On the reproducibility of protein crystal structures: five atomic resolution structures of trypsin. Acta Crystallogr.,Sect.D 2013 69 1447 1462 4I8K 23897468 Bovine trypsin at 0.85 resolution 2012-12-03 2012-12-19 Liebschner, D.,Dauter, M.,Brzuszkiewicz, A.,Dauter, Z. On the reproducibility of protein crystal structures: five atomic resolution structures of trypsin. Acta Crystallogr.,Sect.D 2013 69 1447 1462 4I8L 23897468 Bovine trypsin at 0.87 resolution 2012-12-03 2012-12-19 Liebschner, D.,Dauter, M.,Brzuszkiewicz, A.,Dauter, Z. On the reproducibility of protein crystal structures: five atomic resolution structures of trypsin. Acta Crystallogr.,Sect.D 2013 69 1447 1462 4HAI 23237835 Crystal structure of human soluble epoxide hydrolase complexed with N-cycloheptyl-1-(mesitylsulfonyl)piperidine-4-carboxamide. 2012-09-26 2012-12-26 Pecic, S.,Pakhomova, S.,Newcomer, M.E.,Morisseau, C.,Hammock, B.D.,Zhu, Z.,Rinderspacher, A.,Deng, S.X. Synthesis and structure-activity relationship of piperidine-derived non-urea soluble epoxide hydrolase inhibitors. Bioorg.Med.Chem.Lett. 2013 23 417 421 4HTO 23219551 Crystal structure of the DBD domain of human DNA ligase IV Apo form 2012-11-01 2012-12-26 De Ioannes, P.,Malu, S.,Cortes, P.,Aggarwal, A.K. Structural Basis of DNA Ligase IV-Artemis Interaction in Nonhomologous End-Joining. Cell Rep 2012 2 1505 1512 3VDM Crystal Structure of VldE, the pseudo-glycosyltransferase which catalyzes non-glycosidic C-N coupling in Validamycin A biosynthesis 2012-01-05 2013-01-09 Cavalier, M.C.,Yim, Y.-S.,Asamizu, S.,Neau, D.,Mahmud, T.,Lee, Y.-H. Crystal Structure of VldE, the pseudo-glycosyltransferase which catalyzes non-glycosidic C-N coupling in Validamycin A biosynthesis To be Published 0 0 0 0 3VDN Crystal Structure of VldE, the pseudo-glycosyltransferase, in complex with GDP 2012-01-05 2013-01-09 Cavalier, M.C.,Yim, Y.-S.,Asamizu, S.,Neau, D.,Mahmud, T.,Lee, Y.-H. Crystal Structure of the VldE, the pseudo-glycosyltransferase, which catalyzes non-glycosidic C-N coupling in Validamycin A biosynthesis To be Published 0 0 0 0 4GL2 23273991 Structural Basis for dsRNA duplex backbone recognition by MDA5 2012-08-13 2013-01-09 Wu, B.,Peisley, A.,Richards, C.,Yao, H.,Zeng, X.,Lin, C.,Chu, F.,Walz, T.,Hur, S. Structural Basis for dsRNA Recognition, Filament Formation, and Antiviral Signal Activation by MDA5. Cell(Cambridge,Mass.) 2013 152 276 289 4FUN 23277549 Structural basis for Zn2+-dependent intercellular adhesion in staphylococcal biofilms 2012-06-28 2013-01-16 Conrady, D.G.,Wilson, J.J.,Herr, A.B. Structural basis for Zn2+-dependent intercellular adhesion in staphylococcal biofilms. Proc.Natl.Acad.Sci.USA 2013 110 0 0 4HJ1 23319635 Crystal structure of glycoprotein C from Rift Valley Fever Virus (glycosylated) 2012-10-12 2013-01-16 Dessau, M.,Modis, Y. Crystal structure of glycoprotein C from Rift Valley fever virus. Proc.Natl.Acad.Sci.USA 2013 110 1696 1701 4I0X 24312350 Crystal structure of the Mycobacterum abscessus EsxEF (Mab_3112-Mab_3113) complex 2012-11-19 2013-01-16 Arbing, M.A.,Chan, S.,Harris, L.,Kuo, E.,Zhou, T.T.,Ahn, C.J.,Nguyen, L.,He, Q.,Lu, J.,Menchavez, P.T.,Shin, A.,Holton, T.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Heterologous expression of mycobacterial Esx complexes in Escherichia coli for structural studies is facilitated by the use of maltose binding protein fusions. Plos One 2013 8 0 0 4G6D 23178120 G1 ORF67 / Staphyloccus aureus sigmaA domain 4 complex 2012-07-18 2013-01-23 Osmundson, J.,Montero-Diez, C.,Westblade, L.F.,Hochschild, A.,Darst, S.A. Promoter-specific transcription inhibition in Staphylococcus aureus by a phage protein. Cell(Cambridge,Mass.) 2012 151 1005 1016 4G6D 23178120 G1 ORF67 / Staphyloccus aureus sigmaA domain 4 complex 2012-07-18 2013-01-23 Osmundson, J.,Montero-Diez, C.,Westblade, L.F.,Hochschild, A.,Darst, S.A. Promoter-specific transcription inhibition in Staphylococcus aureus by a phage protein. Cell(Cambridge,Mass.) 2012 151 1005 1016 4G94 23178120 G1 ORF67 / Staphyloccus aureus sigmaA domain 4 complex 2012-07-23 2013-01-23 Osmundson, J.,Montero-Diez, C.,Westblade, L.F.,Hochschild, A.,Darst, S.A. Promoter-specific transcription inhibition in Staphylococcus aureus by a phage protein. Cell(Cambridge,Mass.) 2012 151 1005 1016 4HC1 Crystal structure of a loop deleted mutant of human MAdCAM-1 D1D2 complexed with Fab 10G3 2012-09-28 2013-01-23 Springer, T.,Yu, Y.,Zhu, J.,Wang, J.-H.,Huang, P.-S. A Different Fold with an Integrin-Binding Loop Specialized for Flexibility in Mucosal Addressin Cell Adhesion Molecule-1 TO BE PUBLISHED 0 0 0 0 4HD9 Crystal structure of native human MAdCAM-1 D1D2 domain 2012-10-02 2013-01-23 Springer, T.,Yu, Y.,Zhu, J.,Wang, J.-H.,Huang, P.-S. A Different Fold with an Integrin-Binding Loop Specialized for Flexibility in Mucosal Addressin Cell Adhesion Molecule-1 TO BE PUBLISHED 0 0 0 0 3VFG 23696816 Crystal structure of monoclonal antibody 3F8 Fab fragment that binds to GD2 ganglioside 2012-01-09 2013-02-06 Ahmed, M.,Goldgur, Y.,Hu, J.,Guo, H.F.,Cheung, N.K. In silico Driven Redesign of a Clinically Relevant Antibody for the Treatment of GD2 Positive Tumors. Plos One 2013 8 0 0 4DNR Crystal structure of the CusBA heavy-metal efflux complex from Escherichia coli, E716F mutant 2012-02-08 2013-02-13 Su, C.-C.,Long, F.,Yu, E. Crystal structures of the pre-extrusion and extrusion states of the CusBA adaptor-transporter complex To be Published 0 0 0 0 4E0G 23382649 Protelomerase tela/DNA hairpin product/vanadate complex 2012-03-03 2013-02-13 Shi, K.,Huang, W.M.,Aihara, H. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation. Plos Biol. 2013 11 0 0 4E0J 23382649 Protelomerase tela R255A mutant complexed with DNA hairpin product 2012-03-04 2013-02-13 Shi, K.,Huang, W.M.,Aihara, H. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation. Plos Biol. 2013 11 0 0 4E0M 23213214 SVQIVYK segment from human Tau (305-311) displayed on 54-membered macrocycle scaffold (form I) 2012-03-04 2013-02-13 Liu, C.,Zhao, M.,Jiang, L.,Cheng, P.N.,Park, J.,Sawaya, M.R.,Pensalfini, A.,Gou, D.,Berk, A.J.,Glabe, C.G.,Nowick, J.,Eisenberg, D. Out-of-register beta-sheets suggest a pathway to toxic amyloid aggregates Proc.Natl.Acad.Sci.USA 2012 109 20913 20918 4E0Y 23382649 Protelomerase tela covalently complexed with mutated substrate DNA 2012-03-05 2013-02-13 Shi, K.,Huang, W.M.,Aihara, H. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation. Plos Biol. 2013 11 0 0 4E0Z 23382649 Protelomerase tela R205A covalently complexed with substrate DNA 2012-03-05 2013-02-13 Shi, K.,Huang, W.M.,Aihara, H. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation. Plos Biol. 2013 11 0 0 4E10 23382649 Protelomerase tela Y201A covalently complexed with substrate DNA 2012-03-05 2013-02-13 Shi, K.,Huang, W.M.,Aihara, H. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation. Plos Biol. 2013 11 0 0 4GZZ 23374340 Crystal structures of bacterial RNA Polymerase paused elongation complexes 2012-09-06 2013-02-13 Weixlbaumer, A.,Leon, K.,Landick, R.,Darst, S.A. Structural basis of transcriptional pausing in bacteria. Cell(Cambridge,Mass.) 2013 152 431 441 4GNX Structure of U. maydis Replication protein A bound to ssDNA 2012-08-17 2013-02-20 Pavletich, N.P.,Fan, J. Structure of To be Published 0 0 0 0 4DUY Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, U13C 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4DUZ Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, U13C, bound with streptomycin 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4DV0 Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, U20G 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4DV1 Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, U20G, bound with streptomycin 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4DV4 Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, A914G 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4DV5 Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, A914G, bound with streptomycin 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4DV6 Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, A915G 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4DV7 Crystal structure of the Thermus thermophilus 30S ribosomal subunit with a 16S rRNA mutation, A915G, bound with streptomycin 2012-02-22 2013-02-27 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4IXN 24449932 Crystal Structure of Zn(II)-bound E37A,C66A,C67A triple mutant YjiA GTPase 2013-01-26 2013-02-27 Sydor, A.M.,Jost, M.,Ryan, K.S.,Turo, K.E.,Douglas, C.D.,Drennan, C.L.,Zamble, D.B. Metal binding properties of Escherichia coli YjiA, a member of the metal homeostasis-associated COG0523 family of GTPases. Biochemistry 2013 52 1788 1801 4E1H 23808589 Fragment of human prion protein 2012-03-06 2013-03-06 Apostol, M.I.,Perry, K.,Surewicz, W.K. Crystal structure of a human prion protein fragment reveals a motif for oligomer formation. J.Am.Chem.Soc. 2013 135 10202 10205 4E1H 23808589 Fragment of human prion protein 2012-03-06 2013-03-06 Apostol, M.I.,Perry, K.,Surewicz, W.K. Crystal structure of a human prion protein fragment reveals a motif for oligomer formation. J.Am.Chem.Soc. 2013 135 10202 10205 4HQM 23479646 The crystal structure of QsrR-menadione complex 2012-10-25 2013-03-06 Ji, Q.,Zhang, L.,Jones, M.B.,Sun, F.,Deng, X.,Liang, H.,Cho, H.,Brugarolas, P.,Gao, Y.N.,Peterson, S.N.,Lan, L.,Bae, T.,He, C. Molecular mechanism of quinone signaling mediated through S-quinonization of a YodB family repressor QsrR. Proc.Natl.Acad.Sci.USA 2013 110 5010 5015 4EDI 25752492 Disulfide bonded EutL from Clostridium perfringens 2012-03-27 2013-03-27 Thompson, M.C.,Cascio, D.,Leibly, D.J.,Yeates, T.O. An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein. Protein Sci. 2015 24 956 975 4JNT 23569276 Crystal structure of the ectodomain of Bovine viral diarrhea virus 1 E2 envelope protein 2013-03-15 2013-04-17 Li, Y.,Wang, J.,Kanai, R.,Modis, Y. Crystal structure of glycoprotein E2 from bovine viral diarrhea virus. Proc.Natl.Acad.Sci.USA 2013 110 6805 6810 4I7A 23456886 GrpN pentameric microcompartment shell protein from Rhodospirillum rubrum 2012-11-30 2013-05-01 Wheatley, N.M.,Gidaniyan, S.D.,Liu, Y.,Cascio, D.,Yeates, T.O. Bacterial microcompartment shells of diverse functional types possess pentameric vertex proteins. Protein Sci. 2013 22 660 665 4IHV 23661683 Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) 2012-12-19 2013-05-01 Hancock, S.P.,Ghane, T.,Cascio, D.,Rohs, R.,Di Felice, R.,Johnson, R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 41 6750 6760 4IHW 23661683 Crystal structure of Fis bound to 27 bp Inosine substituted DNA F28-dI (AAATTTGTTTGAICITTGAGCAAATTT) 2012-12-19 2013-05-01 Hancock, S.P.,Ghane, T.,Cascio, D.,Rohs, R.,Di Felice, R.,Johnson, R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 41 6750 6760 4IHX 23661683 Crystal structure of Fis bound to 27 bp 2-Aminopurine substituted DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT) 2012-12-19 2013-05-01 Hancock, S.P.,Ghane, T.,Cascio, D.,Rohs, R.,Di Felice, R.,Johnson, R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 41 6750 6760 4IHY 23661683 Crystal structure of Fis bound to 27bp Inosine substituted DNA F29-dI (AAATTTGTTTGIICICTGAGCAAATTT) 2012-12-19 2013-05-01 Hancock, S.P.,Ghane, T.,Cascio, D.,Rohs, R.,Di Felice, R.,Johnson, R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 41 6750 6760 4IUP 23636332 crystal structure of Se-substituted arabidopsis thaliana SHH1 SAWADEE domain L200M/L218M mutant 2013-01-21 2013-05-01 Law, J.A.,Du, J.,Hale, C.J.,Feng, S.,Krajewski, K.,Palanca, A.M.,Strahl, B.D.,Patel, D.J.,Jacobsen, S.E. Polymerase IV occupancy at RNA-directed DNA methylation sites requires SHH1. Nature 2013 498 385 389 4IUQ 23636332 crystal structure of SHH1 SAWADEE domain 2013-01-21 2013-05-01 Law, J.A.,Du, J.,Hale, C.J.,Feng, S.,Krajewski, K.,Palanca, A.M.,Strahl, B.D.,Patel, D.J.,Jacobsen, S.E. Polymerase IV occupancy at RNA-directed DNA methylation sites requires SHH1. Nature 2013 498 385 389 4JSP 23636326 structure of mTORDeltaN-mLST8-ATPgammaS-Mg complex 2013-03-22 2013-05-01 Yang, H.,Rudge, D.G.,Koos, J.D.,Vaidialingam, B.,Yang, H.J.,Pavletich, N.P. mTOR kinase structure, mechanism and regulation. Nature 2013 497 217 223 4JSV 23636326 mTOR kinase structure, mechanism and regulation. 2013-03-22 2013-05-01 Yang, H.,Rudge, D.G.,Koos, J.D.,Vaidialingam, B.,Yang, H.J.,Pavletich, N.P. mTOR kinase structure, mechanism and regulation. Nature 2013 497 217 223 4JSN 23636326 structure of mTORdeltaN-mLST8 complex 2013-03-22 2013-05-08 Yang, H.,Rudge, D.G.,Koos, J.D.,Vaidialingam, B.,Yang, H.J.,Pavletich, N.P. mTOR kinase structure, mechanism and regulation. Nature 2013 497 217 223 4JT5 23636326 mTORdeltaN-mLST8-pp242 complex 2013-03-22 2013-05-08 Yang, H.,Rudge, D.G.,Koos, J.D.,Vaidialingam, B.,Yang, H.J.,Pavletich, N.P. mTOR kinase structure, mechanism and regulation. Nature 2013 497 217 223 4JVH 23630077 Structure of the star domain of quaking protein in complex with RNA 2013-03-25 2013-05-08 Teplova, M.,Hafner, M.,Teplov, D.,Essig, K.,Tuschl, T.,Patel, D.J. Structure-function studies of STAR family Quaking proteins bound to their in vivo RNA target sites. Genes Dev. 2013 27 928 940 4K36 23650368 His6 tagged anSMEcpe with bound AdoMet 2013-04-10 2013-05-08 Goldman, P.J.,Grove, T.L.,Sites, L.A.,McLaughlin, M.I.,Booker, S.J.,Drennan, C.L. X-ray structure of an AdoMet radical activase reveals an anaerobic solution for formylglycine posttranslational modification. Proc.Natl.Acad.Sci.USA 2013 110 8519 8524 4K39 23650368 Native anSMEcpe with bound AdoMet and Cp18Cys peptide 2013-04-10 2013-05-08 Goldman, P.J.,Grove, T.L.,Sites, L.A.,McLaughlin, M.I.,Booker, S.J.,Drennan, C.L. X-ray structure of an AdoMet radical activase reveals an anaerobic solution for formylglycine posttranslational modification. Proc.Natl.Acad.Sci.USA 2013 110 8519 8524 4I34 23622246 Crystal Structure of W-W-W ClpX Hexamer 2012-11-23 2013-05-15 Stinson, B.M.,Nager, A.R.,Glynn, S.E.,Schmitz, K.R.,Baker, T.A.,Sauer, R.T. Nucleotide Binding and Conformational Switching in the Hexameric Ring of a AAA+ Machine. Cell(Cambridge,Mass.) 2013 153 628 639 4I4L 23622246 Crystal Structure of Nucleotide-Bound W-W-W ClpX Hexamer 2012-11-27 2013-05-15 Stinson, B.M.,Nager, A.R.,Glynn, S.E.,Schmitz, K.R.,Baker, T.A.,Sauer, R.T. Nucleotide Binding and Conformational Switching in the Hexameric Ring of a AAA+ Machine. Cell(Cambridge,Mass.) 2013 153 628 639 4I5O 23622246 Crystal Structure of W-W-R ClpX Hexamer 2012-11-28 2013-05-15 Stinson, B.M.,Nager, A.R.,Glynn, S.E.,Schmitz, K.R.,Baker, T.A.,Sauer, R.T. Nucleotide Binding and Conformational Switching in the Hexameric Ring of a AAA+ Machine. Cell(Cambridge,Mass.) 2013 153 628 639 4I63 23622246 Crystal Structure of E-R ClpX Hexamer 2012-11-29 2013-05-15 Stinson, B.M.,Nager, A.R.,Glynn, S.E.,Schmitz, K.R.,Baker, T.A.,Sauer, R.T. Nucleotide Binding and Conformational Switching in the Hexameric Ring of a AAA+ Machine. Cell(Cambridge,Mass.) 2013 153 628 639 4I81 23622246 Crystal Structure of ATPgS bound ClpX Hexamer 2012-12-01 2013-05-15 Stinson, B.M.,Nager, A.R.,Glynn, S.E.,Schmitz, K.R.,Baker, T.A.,Sauer, R.T. Nucleotide Binding and Conformational Switching in the Hexameric Ring of a AAA+ Machine. Cell(Cambridge,Mass.) 2013 153 628 639 4I9K 23622246 Crystal structure of symmetric W-W-W ClpX Hexamer 2012-12-05 2013-05-15 Stinson, B.M.,Nager, A.R.,Glynn, S.E.,Schmitz, K.R.,Baker, T.A.,Sauer, R.T. Nucleotide Binding and Conformational Switching in the Hexameric Ring of a AAA+ Machine. Cell(Cambridge,Mass.) 2013 153 628 639 4JJN 23650358 Crystal structure of heterochromatin protein Sir3 in complex with a silenced yeast nucleosome 2013-03-08 2013-05-15 Wang, F.,Li, G.,Altaf, M.,Lu, C.,Currie, M.A.,Johnson, A.,Moazed, D. Heterochromatin protein Sir3 induces contacts between the amino terminus of histone H4 and nucleosomal DNA. Proc.Natl.Acad.Sci.USA 2013 110 8495 8500 4K2X 23621493 OxyS anhydrotetracycline hydroxylase from Streptomyces rimosus 2013-04-09 2013-05-15 Wang, P.,Bashiri, G.,Gao, X.,Sawaya, M.R.,Tang, Y. Uncovering the Enzymes that Catalyze the Final Steps in Oxytetracycline Biosynthesis. J.Am.Chem.Soc. 2013 135 7138 7141 4K97 23647843 Structure of Ternary Complex of cGAS with dsDNA and Bound ATP 2013-04-19 2013-05-15 Gao, P.,Ascano, M.,Wu, Y.,Barchet, W.,Gaffney, B.L.,Zillinger, T.,Serganov, A.A.,Liu, Y.,Jones, R.A.,Hartmann, G.,Tuschl, T.,Patel, D.J. Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase. Cell(Cambridge,Mass.) 2013 153 1094 1107 4HS9 23648063 Methanol tolerant mutant of the Proteus mirabilis lipase 2012-10-29 2013-05-22 Korman, T.P.,Sahachartsiri, B.,Charbonneau, D.M.,Huang, G.L.,Beauregard, M.,Bowie, J.U. Dieselzymes: development of a stable and methanol tolerant lipase for biodiesel production by directed evolution. Biotechnol Biofuels 2013 6 70 70 4FDZ 25752492 EutL from Clostridium perfringens, Crystallized Under Reducing Conditions 2012-05-29 2013-05-29 Thompson, M.C.,Cascio, D.,Leibly, D.J.,Yeates, T.O. An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein. Protein Sci. 2015 24 956 975 4JVG 23685672 B-Raf Kinase in Complex with Birb796 2013-03-25 2013-05-29 Lavoie, H.,Thevakumaran, N.,Gavory, G.,Li, J.J.,Padeganeh, A.,Guiral, S.,Duchaine, J.,Mao, D.Y.,Bouvier, M.,Sicheri, F.,Therrien, M. Inhibitors that stabilize a closed RAF kinase domain conformation induce dimerization. Nat.Chem.Biol. 2013 9 428 436 4KBL 23707686 Structure of HHARI, a RING-IBR-RING ubiquitin ligase: autoinhibition of an Ariadne-family E3 and insights into ligation mechanism 2013-04-23 2013-05-29 Duda, D.M.,Olszewski, J.L.,Schuermann, J.P.,Kurinov, I.,Miller, D.J.,Nourse, A.,Alpi, A.F.,Schulman, B.A. Structure of HHARI, a RING-IBR-RING Ubiquitin Ligase: Autoinhibition of an Ariadne-Family E3 and Insights into Ligation Mechanism. Structure 2013 21 1030 1041 4KC9 23707686 Structure of HHARI, a RING-IBR-RING ubiquitin ligase: autoinhibition of an Ariadne-family E3 and insights into ligation mechanism 2013-04-24 2013-05-29 Duda, D.M.,Olszewski, J.L.,Schuermann, J.P.,Kurinov, I.,Miller, D.J.,Nourse, A.,Alpi, A.F.,Schulman, B.A. Structure of HHARI, a RING-IBR-RING Ubiquitin Ligase: Autoinhibition of an Ariadne-Family E3 and Insights into Ligation Mechanism. Structure 2013 21 1030 1041 4GKJ 23781103 Structure of the Thermus thermophilus 30S ribosomal subunit complexed with a human mitochondrial anticodon stem loop (ASL) of transfer RNA Methionine (TRNAMET) bound to an mRNA with an AUG-codon in the A-site and paromomycin. 2012-08-11 2013-06-05 Cantara, W.A.,Murphy, F.V.,Demirci, H.,Agris, P.F. Expanded use of sense codons is regulated by modified cytidines in tRNA. Proc.Natl.Acad.Sci.USA 2013 110 10964 10969 4GKK 23781103 Structure of the Thermus thermophilus 30S ribosomal subunit complexed with a human mitochondrial anticodon stem loop (ASL) of transfer RNA Methionine (TRNAMET) bound to an mRNA with an AUA-codon in the A-site and paromomycin 2012-08-11 2013-06-05 Cantara, W.A.,Murphy, F.V.,Demirci, H.,Agris, P.F. Expanded use of sense codons is regulated by modified cytidines in tRNA. Proc.Natl.Acad.Sci.USA 2013 110 10964 10969 4JDM 23703617 Secreted Chlamydial Protein PGP3, full-length 2013-02-25 2013-06-05 Galaleldeen, A.,Taylor, A.B.,Chen, D.,Schuermann, J.P.,Holloway, S.P.,Hou, S.,Gong, S.,Zhong, G.,Hart, P.J. Structure of the Chlamydia trachomatis immunodominant antigen Pgp3. J.Biol.Chem. 2013 288 22068 22079 4KSJ 23708998 Crystal structure of the OTU domain of Gumby/Fam105B at 1.6 angstrom 2013-05-17 2013-06-05 Rivkin, E.,Almeida, S.M.,Ceccarelli, D.F.,Juang, Y.C.,MacLean, T.A.,Srikumar, T.,Huang, H.,Dunham, W.H.,Fukumura, R.,Xie, G.,Gondo, Y.,Raught, B.,Gingras, A.C.,Sicheri, F.,Cordes, S.P. The linear ubiquitin-specific deubiquitinase gumby regulates angiogenesis. Nature 2013 498 318 324 4KSL 23708998 Gumby/Fam105B in complex with linear di-ubiquitin 2013-05-17 2013-06-05 Rivkin, E.,Almeida, S.M.,Ceccarelli, D.F.,Juang, Y.C.,MacLean, T.A.,Srikumar, T.,Huang, H.,Dunham, W.H.,Fukumura, R.,Xie, G.,Gondo, Y.,Raught, B.,Gingras, A.C.,Sicheri, F.,Cordes, S.P. The linear ubiquitin-specific deubiquitinase gumby regulates angiogenesis. Nature 2013 498 318 324 4FBT 23876706 Dpo4 post-insertion complex with the N-(deoxyguanosin-8-yl)-1-aminopyrene lesion 2012-05-23 2013-06-12 Kirouac, K.N.,Basu, A.K.,Ling, H. Structural mechanism of replication stalling on a bulky amino-polycyclic aromatic hydrocarbon DNA adduct by a y family DNA polymerase. J.Mol.Biol. 2013 425 4167 4176 4FBU 23876706 Dpo4 polymerase pre-insertion binary complex with the N-(deoxyguanosin-8-yl)-1-aminopyrene lesion 2012-05-23 2013-06-12 Kirouac, K.N.,Basu, A.K.,Ling, H. Structural mechanism of replication stalling on a bulky amino-polycyclic aromatic hydrocarbon DNA adduct by a y family DNA polymerase. J.Mol.Biol. 2013 425 4167 4176 4BHT 23879525 Structural Determinants of Cofactor Specificity and Domain Flexibility in Bacterial Glutamate Dehydrogenases 2013-04-06 2013-06-19 Sharkey, M.A.,Oliveira, T.F.,Engel, P.C.,Khan, A.R. Structure of Nadp(+) -Dependent Glutamate Dehydrogenase from Escherichia Coli: Reflections on the Basis of Coenzyme Specificity in the Family of Glutamate Dehydrogenases. FEBS J. 2013 280 4681 0 4KF7 23795296 Nup188(aa1-1160) from Myceliophthora thermophila 2013-04-26 2013-06-19 Andersen, K.R.,Onischenko, E.,Tang, J.H.,Kumar, P.,Chen, J.Z.,Ulrich, A.,Liphardt, J.T.,Weis, K.,Schwartz, T.U. Scaffold nucleoporins Nup188 and Nup192 share structural and functional properties with nuclear transport receptors. Elife 2013 2 0 0 4KF8 23795296 Nup188(aa1445-1827) from Myceliophthora thermophila 2013-04-26 2013-06-19 Andersen, K.R.,Onischenko, E.,Tang, J.H.,Kumar, P.,Chen, J.Z.,Ulrich, A.,Liphardt, J.T.,Weis, K.,Schwartz, T.U. Scaffold nucleoporins Nup188 and Nup192 share structural and functional properties with nuclear transport receptors. Elife 2013 2 0 0 4K84 23863933 Crystal structure of human ceramide-1-phosphate transfer protein (CPTP) in complex with 16:0 ceramide-1-phosphate (16:0-C1P) 2013-04-17 2013-07-17 Simanshu, D.K.,Kamlekar, R.K.,Wijesinghe, D.S.,Zou, X.,Zhai, X.,Mishra, S.K.,Molotkovsky, J.G.,Malinina, L.,Hinchcliffe, E.H.,Chalfant, C.E.,Brown, R.E.,Patel, D.J. Non-vesicular trafficking by a ceramide-1-phosphate transfer protein regulates eicosanoids. Nature 2013 500 463 467 4K8N 23863933 Crystal structure of human ceramide-1-phosphate transfer protein (CPTP) in complex with 18:1 Ceramide-1-Phosphate (18:1-C1P) 2013-04-18 2013-07-17 Simanshu, D.K.,Kamlekar, R.K.,Wijesinghe, D.S.,Zou, X.,Zhai, X.,Mishra, S.K.,Molotkovsky, J.G.,Malinina, L.,Hinchcliffe, E.H.,Chalfant, C.E.,Brown, R.E.,Patel, D.J. Non-vesicular trafficking by a ceramide-1-phosphate transfer protein regulates eicosanoids. Nature 2013 500 463 467 4KI8 23861496 Crystal structure of a GroEL-ADP complex in the relaxed allosteric state 2013-05-01 2013-07-17 Fei, X.,Yang, D.,Laronde-Leblanc, N.,Lorimer, G.H. Crystal structure of a GroEL-ADP complex in the relaxed allosteric state at 2.7 A resolution. Proc.Natl.Acad.Sci.USA 2013 110 0 0 4L3I 23870126 Structure of the microtubule associated protein PRC1 (Protein Regulator of Cytokinesis 1) 2013-06-06 2013-07-17 Subramanian, R.,Ti, S.C.,Tan, L.,Darst, S.A.,Kapoor, T.M. Marking and Measuring Single Microtubules by PRC1 and Kinesin-4. Cell(Cambridge,Mass.) 2013 154 377 390 4IQ4 23621606 Structure of a 16 nm protein cage designed by fusing symmetric oligomeric domains, triple mutant, P21212 form 2013-01-10 2013-07-24 Lai, Y.T.,Tsai, K.L.,Sawaya, M.R.,Asturias, F.J.,Yeates, T.O. Structure and flexibility of nanoscale protein cages designed by symmetric self-assembly. J.Am.Chem.Soc. 2013 135 7738 7743 4ITV 23621606 Structure of a 16 nm protein cage designed by fusing symmetric oligomeric domains, triple mutant, P212121 form 2013-01-18 2013-07-24 Lai, Y.T.,Tsai, K.L.,Sawaya, M.R.,Asturias, F.J.,Yeates, T.O. Structure and flexibility of nanoscale protein cages designed by symmetric self-assembly. J.Am.Chem.Soc. 2013 135 7738 7743 4KZY 23873042 Rabbit 40S ribosomal subunit in complex with eIF1 and eIF1A. 2013-05-30 2013-07-24 Lomakin, I.B.,Steitz, T.A. The initiation of mammalian protein synthesis and mRNA scanning mechanism. Nature 2013 500 307 311 4KZZ 23873042 Rabbit 40S ribosomal subunit in complex with mRNA, initiator tRNA and eIF1A 2013-05-30 2013-07-24 Lomakin, I.B.,Steitz, T.A. The initiation of mammalian protein synthesis and mRNA scanning mechanism. Nature 2013 500 307 311 4L3N 23903833 Crystal structure of the receptor-binding domain from newly emerged Middle East respiratory syndrome coronavirus 2013-06-06 2013-07-31 Chen, Y.,Rajashankar, K.R.,Yang, Y.,Agnihothram, S.S.,Liu, C.,Lin, Y.L.,Baric, R.S.,Li, F. Crystal structure of the receptor-binding domain from newly emerged middle East respiratory syndrome coronavirus. J.Virol. 2013 87 10777 10783 4L5T 23850291 Crystal structure of the tetrameric p202 HIN2 2013-06-11 2013-07-31 Yin, Q.,Sester, D.P.,Tian, Y.,Hsiao, Y.S.,Lu, A.,Cridland, J.A.,Sagulenko, V.,Thygesen, S.J.,Choubey, D.,Hornung, V.,Walz, T.,Stacey, K.J.,Wu, H. Molecular Mechanism for p202-Mediated Specific Inhibition of AIM2 Inflammasome Activation. Cell Rep 2013 4 327 339 4LCK 23892783 Co-crystal structure of a T-box riboswitch stem I domain in complex with its cognate tRNA 2013-06-21 2013-07-31 Zhang, J.,Ferre-D'Amare, A.R. Co-crystal structure of a T-box riboswitch stem I domain in complex with its cognate tRNA. Nature 2013 500 363 366 3ZD6 23897087 Snapshot 1 of RIG-I scanning on RNA duplex 2012-11-25 2013-08-07 Kohlway, A.,Luo, D.,Rawling, D.C.,Ding, S.C.,Pyle, A.M. Defining the Functional Determinants for RNA Surveillance by Rig-I. Embo Rep. 2013 14 772 0 3ZD7 23897087 Snapshot 3 of RIG-I scanning on RNA duplex 2012-11-25 2013-08-07 Kohlway, A.,Luo, D.,Rawling, D.C.,Ding, S.C.,Pyle, A.M. Defining the Functional Determinants for RNA Surveillance by Rig-I. Embo Rep. 2013 14 772 0 4G8X 23178120 G1 ORF67 / Staphyloccus aureus sigmaA domain 4 complex 2012-07-23 2013-08-07 Osmundson, J.,Montero-Diez, C.,Westblade, L.F.,Hochschild, A.,Darst, S.A. Promoter-specific transcription inhibition in Staphylococcus aureus by a phage protein. Cell(Cambridge,Mass.) 2012 151 1005 1016 4LI1 23891289 Crystal Structures of Lgr4 and its complex with R-spondin1 2013-07-02 2013-08-07 Xu, K.,Xu, Y.,Rajashankar, K.R.,Robev, D.,Nikolov, D.B. Crystal structures of lgr4 and its complex with R-spondin1. Structure 2013 21 1683 1689 4LI2 23891289 Crystal Structures of Lgr4 and its complex with R-spondin1 2013-07-02 2013-08-07 Xu, K.,Xu, Y.,Rajashankar, K.R.,Robev, D.,Nikolov, D.B. Crystal structures of lgr4 and its complex with R-spondin1. Structure 2013 21 1683 1689 4LCD 23936628 Structure of an Rsp5xUbxSna3 complex: Mechanism of ubiquitin ligation and lysine prioritization by a HECT E3 2013-06-21 2013-08-14 Kamadurai, H.B.,Qiu, Y.,Deng, A.,Harrison, J.S.,Macdonald, C.,Actis, M.,Rodrigues, P.,Miller, D.J.,Souphron, J.,Lewis, S.M.,Kurinov, I.,Fujii, N.,Hammel, M.,Piper, R.,Kuhlman, B.,Schulman, B.A. Mechanism of ubiquitin ligation and lysine prioritization by a HECT E3. Elife 2013 2 0 0 4LFQ 23919482 High resolution x-ray crystal structure of L-ShK toxin 2013-06-27 2013-08-14 Dang, B.,Kubota, T.,Mandal, K.,Bezanilla, F.,Kent, S.B. Native Chemical Ligation at Asx-Cys, Glx-Cys: Chemical Synthesis and High-Resolution X-ray Structure of ShK Toxin by Racemic Protein Crystallography. J.Am.Chem.Soc. 2013 135 11911 11919 4LFS 23919482 High resolution x-ray structure of racemic ShK toxin 2013-06-27 2013-08-14 Dang, B.,Kubota, T.,Mandal, K.,Bezanilla, F.,Kent, S.B. Native Chemical Ligation at Asx-Cys, Glx-Cys: Chemical Synthesis and High-Resolution X-ray Structure of ShK Toxin by Racemic Protein Crystallography. J.Am.Chem.Soc. 2013 135 11911 11919 4JNY 23713611 Crystal structure of PutA86-630 mutant D370A complexed with L-Tetrahydro-2-furoic acid 2013-03-16 2013-08-28 Zhu, W.,Haile, A.M.,Singh, R.K.,Larson, J.D.,Smithen, D.,Chan, J.Y.,Tanner, J.J.,Becker, D.F. Involvement of the beta 3-alpha 3 Loop of the Proline Dehydrogenase Domain in Allosteric Regulation of Membrane Association of Proline Utilization A. Biochemistry 2013 52 4482 4491 4JNZ 23713611 Crystal structure of PutA86-630 mutant D370N complexed with L-Tetrahydro-2-furoic acid 2013-03-16 2013-08-28 Zhu, W.,Haile, A.M.,Singh, R.K.,Larson, J.D.,Smithen, D.,Chan, J.Y.,Tanner, J.J.,Becker, D.F. Involvement of the beta 3-alpha 3 Loop of the Proline Dehydrogenase Domain in Allosteric Regulation of Membrane Association of Proline Utilization A. Biochemistry 2013 52 4482 4491 4L01 24013208 Crystal structure of the V658F apo Jak1 pseudokinase domain 2013-05-30 2013-09-04 Toms, A.V.,Deshpande, A.,McNally, R.,Jeong, Y.,Rogers, J.M.,Kim, C.U.,Gruner, S.M.,Ficarro, S.B.,Marto, J.A.,Sattler, M.,Griffin, J.D.,Eck, M.J. Structure of a pseudokinase-domain switch that controls oncogenic activation of Jak kinases. Nat.Struct.Mol.Biol. 2013 20 1221 1223 4JEL 23659472 Structure of MilB Streptomyces rimofaciens CMP N-glycosidase 2013-02-27 2013-09-11 Sikowitz, M.D.,Cooper, L.E.,Begley, T.P.,Kaminski, P.A.,Ealick, S.E. Reversal of the substrate specificity of CMP N-glycosidase to dCMP. Biochemistry 2013 52 4037 4047 4JEM 23659472 Crystal structure of MilB complexed with cytidine 5'-monophosphate 2013-02-27 2013-09-11 Sikowitz, M.D.,Cooper, L.E.,Begley, T.P.,Kaminski, P.A.,Ealick, S.E. Reversal of the substrate specificity of CMP N-glycosidase to dCMP. Biochemistry 2013 52 4037 4047 4JEN 23659472 Structure of Clostridium botulinum CMP N-glycosidase, BcmB 2013-02-27 2013-09-11 Sikowitz, M.D.,Cooper, L.E.,Begley, T.P.,Kaminski, P.A.,Ealick, S.E. Reversal of the substrate specificity of CMP N-glycosidase to dCMP. Biochemistry 2013 52 4037 4047 4LOW 24459150 Structure and identification of a pterin dehydratase-like protein as a RuBisCO assembly factor in the alpha-carboxysome 2013-07-13 2013-09-11 Wheatley, N.M.,Sundberg, C.D.,Gidaniyan, S.D.,Cascio, D.,Yeates, T.O. Structure and Identification of a Pterin Dehydratase-like Protein as a Ribulose-bisphosphate Carboxylase/Oxygenase (RuBisCO) Assembly Factor in the alpha-Carboxysome. J.Biol.Chem. 2014 289 7973 7981 4M48 24037379 X-ray structure of dopamine transporter elucidates antidepressant mechanism 2013-08-06 2013-09-18 Penmatsa, A.,Wang, K.H.,Gouaux, E. X-ray structure of dopamine transporter elucidates antidepressant mechanism. Nature 2013 503 85 90 4M4W 24048025 Mechanistic implications for the bacterial primosome assembly of the structure of a helicase-helicase loader complex 2013-08-07 2013-09-25 Liu, B.,Eliason, W.K.,Steitz, T.A. Structure of a helicase-helicase loader complex reveals insights into the mechanism of bacterial primosome assembly. Nat Commun 2013 4 2495 2495 4M7S 24048029 Crystal structure of SeMet BtrN in an OPEN conformation 2013-08-12 2013-10-02 Goldman, P.J.,Grove, T.L.,Booker, S.J.,Drennan, C.L. X-ray analysis of butirosin biosynthetic enzyme BtrN redefines structural motifs for AdoMet radical chemistry. Proc.Natl.Acad.Sci.USA 2013 110 15949 15954 4M7T 24048029 Crystal structure of BtrN in complex with AdoMet and 2-DOIA 2013-08-12 2013-10-02 Goldman, P.J.,Grove, T.L.,Booker, S.J.,Drennan, C.L. X-ray analysis of butirosin biosynthetic enzyme BtrN redefines structural motifs for AdoMet radical chemistry. Proc.Natl.Acad.Sci.USA 2013 110 15949 15954 4K34 24099674 Crystal structures of CusC review conformational changes accompanying folding and transmembrane channel formation 2013-04-10 2013-10-16 Lei, H.T.,Bolla, J.R.,Bishop, N.R.,Su, C.C.,Yu, E.W. Crystal Structures of CusC Review Conformational Changes Accompanying Folding and Transmembrane Channel Formation. J.Mol.Biol. 2014 426 403 411 4BZC 24141705 Crystal structure of the tetrameric dGTP-bound wild type SAMHD1 catalytic core 2013-07-25 2013-10-23 Ji, X.,Wu, Y.,Yan, J.,Mehrens, J.,Yang, H.,Delucia, M.,Hao, C.,Gronenborn, A.M.,Skowronski, J.,Ahn, J.,Xiong, Y. Mechanism of Allosteric Activation of Samhd1 by Dgtp Nat.Struct.Mol.Biol. 2013 20 1304 0 4LSF 24106986 Ion selectivity of OmpF soaked in 0.1M KBr 2013-07-22 2013-10-23 Dhakshnamoorthy, B.,Ziervogel, B.K.,Blachowicz, L.,Roux, B. A structural study of ion permeation in OmpF porin from anomalous X-ray diffraction and molecular dynamics simulations. J.Am.Chem.Soc. 2013 135 16561 16568 4LSH 24106986 Ion selectivity of OmpF porin soaked in 0.2M KBr 2013-07-22 2013-10-23 Dhakshnamoorthy, B.,Ziervogel, B.K.,Blachowicz, L.,Roux, B. A structural study of ion permeation in OmpF porin from anomalous X-ray diffraction and molecular dynamics simulations. J.Am.Chem.Soc. 2013 135 16561 16568 4LSI 24106986 Ion selectivity of OmpF porin soaked in 0.3M KBr 2013-07-22 2013-10-23 Dhakshnamoorthy, B.,Ziervogel, B.K.,Blachowicz, L.,Roux, B. A structural study of ion permeation in OmpF porin from anomalous X-ray diffraction and molecular dynamics simulations. J.Am.Chem.Soc. 2013 135 16561 16568 4KYS 24079939 Clostridium botulinum thiaminase I in complex with thiamin 2013-05-29 2013-10-30 Sikowitz, M.D.,Shome, B.,Zhang, Y.,Begley, T.P.,Ealick, S.E. Structure of a Clostridium botulinum C143S Thiaminase I/Thiamin Complex Reveals Active Site Architecture. Biochemistry 2013 52 7830 7839 4LO0 24130488 Apo HA17-HA33 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4LO0 24130488 Apo HA17-HA33 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4LO1 24130488 HA17-HA33-Gal 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4LO1 24130488 HA17-HA33-Gal 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4LO7 24130488 HA70(D3)-HA17-HA33 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4LO7 24130488 HA70(D3)-HA17-HA33 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4LO8 24130488 HA70(D3)-HA17 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4LO8 24130488 HA70(D3)-HA17 2013-07-12 2013-10-30 Lee, K.,Gu, S.,Jin, L.,Le, T.T.,Cheng, L.W.,Strotmeier, J.,Kruel, A.M.,Yao, G.,Perry, K.,Rummel, A.,Jin, R. Structure of a Bimodular Botulinum Neurotoxin Complex Provides Insights into Its Oral Toxicity. Plos Pathog. 2013 9 0 0 4M4P 23959867 Crystal structure of EPHA4 ectodomain 2013-08-07 2013-10-30 Xu, K.,Tzvetkova-Robev, D.,Xu, Y.,Goldgur, Y.,Chan, Y.P.,Himanen, J.P.,Nikolov, D.B. Insights into Eph receptor tyrosine kinase activation from crystal structures of the EphA4 ectodomain and its complex with ephrin-A5. Proc.Natl.Acad.Sci.USA 2013 110 14634 14639 4M4R 23959867 Epha4 ectodomain complex with ephrin a5 2013-08-07 2013-10-30 Xu, K.,Tzvetkova-Robev, D.,Xu, Y.,Goldgur, Y.,Chan, Y.P.,Himanen, J.P.,Nikolov, D.B. Insights into Eph receptor tyrosine kinase activation from crystal structures of the EphA4 ectodomain and its complex with ephrin-A5. Proc.Natl.Acad.Sci.USA 2013 110 14634 14639 4JI0 24152548 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-03-05 2013-11-06 Demirci, H.,Wang, L.,Murphy, F.V.,Murphy, E.L.,Carr, J.F.,Blanchard, S.C.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. The central role of protein S12 in organizing the structure of the decoding site of the ribosome. Rna 2013 19 1791 1801 4JI1 24152548 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-03-05 2013-11-06 Demirci, H.,Wang, L.,Murphy, F.V.,Murphy, E.L.,Carr, J.F.,Blanchard, S.C.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. The central role of protein S12 in organizing the structure of the decoding site of the ribosome. Rna 2013 19 1791 1801 4JI2 24152548 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-03-05 2013-11-06 Demirci, H.,Wang, L.,Murphy, F.V.,Murphy, E.L.,Carr, J.F.,Blanchard, S.C.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. The central role of protein S12 in organizing the structure of the decoding site of the ribosome. Rna 2013 19 1791 1801 4JI3 24152548 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-03-05 2013-11-06 Demirci, H.,Wang, L.,Murphy, F.V.,Murphy, E.L.,Carr, J.F.,Blanchard, S.C.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. The central role of protein S12 in organizing the structure of the decoding site of the ribosome. Rna 2013 19 1791 1801 4JI4 24152548 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-03-05 2013-11-06 Demirci, H.,Wang, L.,Murphy, F.V.,Murphy, E.L.,Carr, J.F.,Blanchard, S.C.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. The central role of protein S12 in organizing the structure of the decoding site of the ribosome. Rna 2013 19 1791 1801 4JI6 24152548 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-03-05 2013-11-06 Demirci, H.,Wang, L.,Murphy, F.V.,Murphy, E.L.,Carr, J.F.,Blanchard, S.C.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. The central role of protein S12 in organizing the structure of the decoding site of the ribosome. Rna 2013 19 1791 1801 4LJZ 24218560 Crystal Structure Analysis of the E.coli holoenzyme 2013-07-05 2013-11-13 Bae, B.,Davis, E.,Brown, D.,Campbell, E.A.,Wigneshweraraj, S.,Darst, S.A. Phage T7 Gp2 inhibition of Escherichia coli RNA polymerase involves misappropriation of sigma 70 domain 1.1. Proc.Natl.Acad.Sci.USA 2013 110 19772 19777 4MLI 24161952 Crystal structure of the SpyTag/SpyCatcher complex 2013-09-06 2013-11-13 Li, L.,Fierer, J.O.,Rapoport, T.A.,Howarth, M. Structural Analysis and Optimization of the Covalent Association between SpyCatcher and a Peptide Tag. J.Mol.Biol. 2014 426 309 317 4MLI 24161952 Crystal structure of the SpyTag/SpyCatcher complex 2013-09-06 2013-11-13 Li, L.,Fierer, J.O.,Rapoport, T.A.,Howarth, M. Structural Analysis and Optimization of the Covalent Association between SpyCatcher and a Peptide Tag. J.Mol.Biol. 2014 426 309 317 4MLS 24161952 Crystal structure of the SpyTag and SpyCatcher-deltaN1 complex 2013-09-06 2013-11-13 Li, L.,Fierer, J.O.,Rapoport, T.A.,Howarth, M. Structural Analysis and Optimization of the Covalent Association between SpyCatcher and a Peptide Tag. J.Mol.Biol. 2014 426 309 317 4MLS 24161952 Crystal structure of the SpyTag and SpyCatcher-deltaN1 complex 2013-09-06 2013-11-13 Li, L.,Fierer, J.O.,Rapoport, T.A.,Howarth, M. Structural Analysis and Optimization of the Covalent Association between SpyCatcher and a Peptide Tag. J.Mol.Biol. 2014 426 309 317 4M52 24251446 Structure of Mtb Lpd bound to SL827 2013-08-07 2013-11-27 Bryk, R.,Arango, N.,Maksymiuk, C.,Balakrishnan, A.,Wu, Y.T.,Wong, C.H.,Masquelin, T.,Hipskind, P.,Lima, C.D.,Nathan, C. Lipoamide channel-binding sulfonamides selectively inhibit mycobacterial lipoamide dehydrogenase. Biochemistry 2013 52 9375 9384 4M9T 24164286 NS2B-NS3 protease from dengue virus in the presence of DTNB, a covalent allosteric inhibitor 2013-08-15 2013-11-27 Yildiz, M.,Ghosh, S.,Bell, J.A.,Sherman, W.,Hardy, J.A. Allosteric Inhibition of the NS2B-NS3 Protease from Dengue Virus. Acs Chem.Biol. 2013 8 2744 2752 4FZO 24557139 Crystal Structure of the apo-form uranyl binding protein 2012-07-06 2013-12-11 Zhou, L.,Bosscher, M.,Zhang, C.,Ozcubukcu, S.,Zhang, L.,Zhang, W.,Li, C.J.,Liu, J.,Jensen, M.P.,Lai, L.,He, C. A protein engineered to bind uranyl selectively and with femtomolar affinity. Nat Chem 2014 6 236 241 4FZP 24557139 Crystal Structure of the uranyl binding protein complexed with uranyl 2012-07-06 2013-12-11 Zhou, L.,Bosscher, M.,Zhang, C.,Ozcubukcu, S.,Zhang, L.,Zhang, W.,Li, C.J.,Liu, J.,Jensen, M.P.,Lai, L.,He, C. A protein engineered to bind uranyl selectively and with femtomolar affinity. Nat Chem 2014 6 236 241 4HI9 1.2 structure of integrin-linked kinase ankyrin repeat domain in complex with PINCH1 LIM1 domain collected at wavelength 0.91974 2012-10-11 2013-12-11 Stiegler, A.L.,Jakoncic, J.,Stojanoff, V.,Chiswell, B.P.,Calderwood, D.A.,Boggon, T.J. 1.2 structure of integrin-linked kinase ankyrin repeat domain in complex with PINCH1 LIM1 domain collected at wavelength 0.91974 To be Published 0 0 0 0 4LZB 24316823 Uracil binding pocket in Vaccinia virus uracil DNA glycosylase 2013-07-31 2013-12-11 Schormann, N.,Banerjee, S.,Ricciardi, R.,Chattopadhyay, D. Structure of the uracil complex of Vaccinia virus uracil DNA glycosylase. Acta Crystallogr.,Sect.F 2013 69 1328 1334 4MA4 24295899 S-glutathionylated PFKFB3 2013-08-15 2013-12-11 Seo, M.,Lee, Y.H. PFKFB3 Regulates Oxidative Stress Homeostasis via Its S-Glutathionylation in Cancer. J.Mol.Biol. 2014 426 830 842 4MCT 24257752 P. vulgaris HIGBA structure, crystal form 1 2013-08-21 2013-12-11 Schureck, M.A.,Maehigashi, T.,Miles, S.J.,Marquez, J.,Cho, S.E.,Erdman, R.,Dunham, C.M. Structure of the Proteus vulgaris HigB-(HigA)2-HigB Toxin-Antitoxin Complex. J.Biol.Chem. 2014 289 1060 1070 4MDK 24316736 Cdc34-ubiquitin-CC0651 complex 2013-08-22 2013-12-11 Huang, H.,Ceccarelli, D.F.,Orlicky, S.,St-Cyr, D.J.,Ziemba, A.,Garg, P.,Plamondon, S.,Auer, M.,Sidhu, S.,Marinier, A.,Kleiger, G.,Tyers, M.,Sicheri, F. E2 enzyme inhibition by stabilization of a low-affinity interface with ubiquitin. Nat.Chem.Biol. 2014 10 156 163 4MQE 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor in the apo form 2013-09-16 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4MQF 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor bound to the antagonist 2-hydroxysaclofen 2013-09-16 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4MR7 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor bound to the antagonist CGP54626 2013-09-17 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4MR8 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor bound to the antagonist CGP35348 2013-09-17 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4MR9 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor bound to the antagonist SCH50911 2013-09-17 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4MS1 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor bound to the antagonist CGP46381 2013-09-18 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4MS3 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor bound to the endogenous agonist GABA 2013-09-18 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4MS4 24305054 Crystal structure of the extracellular domain of human GABA(B) receptor bound to the agonist baclofen 2013-09-18 2013-12-11 Geng, Y.,Bush, M.,Mosyak, L.,Wang, F.,Fan, Q.R. Structural mechanism of ligand activation in human GABA(B) receptor. Nature 2013 504 254 259 4NKH 24248594 Crystal structure of SspH1 LRR domain 2013-11-12 2013-12-11 Keszei, A.F.,Tang, X.,McCormick, C.,Zeqiraj, E.,Rohde, J.R.,Tyers, M.,Sicheri, F. Structure of an SspH1-PKN1 Complex Reveals the Basis for Host Substrate Recognition and Mechanism of Activation for a Bacterial E3 Ubiquitin Ligase. Mol.Cell.Biol. 2014 34 362 373 4LQY 24338010 Crystal Structure of Human ENPP4 with AMP 2013-07-19 2013-12-18 Albright, R.A.,Ornstein, D.L.,Cao, W.,Chang, W.C.,Robert, D.,Tehan, M.,Hoyer, D.,Liu, L.,Stabach, P.,Yang, G.,De La Cruz, E.M.,Braddock, D.T. Molecular basis of purinergic signal metabolism by ectonucleotide pyrophosphatase/phosphodiesterases 4 and 1 and implications in stroke. J.Biol.Chem. 2014 289 3294 3306 4LZ0 24517311 A236G Epi-isozizaene synthase: Complex with Mg, inorganic pyrophosphate and benzyl triethyl ammonium cation 2013-07-31 2013-12-18 Li, R.,Chou, W.K.,Himmelberger, J.A.,Litwin, K.M.,Harris, G.G.,Cane, D.E.,Christianson, D.W. Reprogramming the Chemodiversity of Terpenoid Cyclization by Remolding the Active Site Contour of epi-Isozizaene Synthase. Biochemistry 2014 53 1155 1168 4LZC 24517311 W325F Epi-isozizaene synthase: Complex with Mg, inorganic pyrophosphate 2013-07-31 2013-12-18 Li, R.,Chou, W.K.,Himmelberger, J.A.,Litwin, K.M.,Harris, G.G.,Cane, D.E.,Christianson, D.W. Reprogramming the Chemodiversity of Terpenoid Cyclization by Remolding the Active Site Contour of epi-Isozizaene Synthase. Biochemistry 2014 53 1155 1168 4NE3 24390579 Human MHF1-MHF2 complex 2013-10-28 2013-12-25 Zhao, Q.,Saro, D.,Sachpatzidis, A.,Singh, T.R.,Schlingman, D.,Zheng, X.F.,Mack, A.,Tsai, M.S.,Mochrie, S.,Regan, L.,Meetei, A.R.,Sung, P.,Xiong, Y. The MHF complex senses branched DNA by binding a pair of crossover DNA duplexes. Nat Commun 2014 5 2987 2987 4NJH 24362703 Crystal Structure of QueE from Burkholderia multivorans in complex with AdoMet and 6-carboxy-5,6,7,8-tetrahydropterin 2013-11-10 2013-12-25 Dowling, D.P.,Bruender, N.A.,Young, A.P.,McCarty, R.M.,Bandarian, V.,Drennan, C.L. Radical SAM enzyme QueE defines a new minimal core fold and metal-dependent mechanism. Nat.Chem.Biol. 2014 10 106 112 4NJK 24362703 Crystal Structure of QueE from Burkholderia multivorans in complex with AdoMet, 7-carboxy-7-deazaguanine, and Mg2+ 2013-11-10 2013-12-25 Dowling, D.P.,Bruender, N.A.,Young, A.P.,McCarty, R.M.,Bandarian, V.,Drennan, C.L. Radical SAM enzyme QueE defines a new minimal core fold and metal-dependent mechanism. Nat.Chem.Biol. 2014 10 106 112 4M10 24425867 Crystal Structure of Murine Cyclooxygenase-2 Complex with Isoxicam 2013-08-02 2014-01-22 Xu, S.,Hermanson, D.J.,Banerjee, S.,Ghebreselasie, K.,Clayton, G.M.,Garavito, R.M.,Marnett, L.J. Oxicams Bind in a Novel Mode to the Cyclooxygenase Active Site via a Two-water-mediated H-bonding Network. J.Biol.Chem. 2014 289 6799 6808 4M11 24425867 Crystal Structure of Murine Cyclooxygenase-2 Complex with Meloxicam 2013-08-02 2014-01-22 Xu, S.,Hermanson, D.J.,Banerjee, S.,Ghebreselasie, K.,Clayton, G.M.,Garavito, R.M.,Marnett, L.J. Oxicams Bind in a Novel Mode to the Cyclooxygenase Active Site via a Two-water-mediated H-bonding Network. J.Biol.Chem. 2014 289 6799 6808 4OCB 25004957 Z-DNA dodecamer d(CGCGCGCGCGCG)2 at 0.75 A resolution solved by P-SAD 2014-01-08 2014-01-22 Luo, Z.,Dauter, M.,Dauter, Z. Phosphates in the Z-DNA dodecamer are flexible, but their P-SAD signal is sufficient for structure solution Acta Crystallogr.,Sect.D 2014 0 1790 1800 4JDI 24374310 Crystal structure of Serine/threonine-protein kinase PAK 4 in complex with Paktide S peptide substrate 2013-02-25 2014-01-29 Chen, C.,Ha, B.H.,Thevenin, A.F.,Lou, H.J.,Zhang, R.,Yip, K.Y.,Peterson, J.R.,Gerstein, M.,Kim, P.M.,Filippakopoulos, P.,Knapp, S.,Boggon, T.J.,Turk, B.E. Identification of a major determinant for serine-threonine kinase phosphoacceptor specificity. Mol.Cell 2014 53 140 147 4G80 24487958 Crystal structure of voltage sensing domain of Ci-VSP with fragment antibody (WT, 3.8 A) 2012-07-20 2014-02-05 Li, Q.,Wanderling, S.,Paduch, M.,Medovoy, D.,Singharoy, A.,McGreevy, R.,Villalba-Galea, C.A.,Hulse, R.E.,Roux, B.,Schulten, K.,Kossiakoff, A.,Perozo, E. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain. Nat. Struct. Mol. Biol. 2014 21 244 252 4NTI 24412362 Crystal structure of D60N mutant of Arabidopsis ACD11 (accelerated-cell-death 11) complexed with C12 ceramide-1-phosphate (d18:1/12:0) at 2.9 Angstrom resolution 2013-12-02 2014-02-05 Simanshu, D.K.,Zhai, X.,Munch, D.,Hofius, D.,Markham, J.E.,Bielawski, J.,Bielawska, A.,Malinina, L.,Molotkovsky, J.G.,Mundy, J.W.,Patel, D.J.,Brown, R.E. Arabidopsis Accelerated Cell Death 11, ACD11, Is a Ceramide-1-Phosphate Transfer Protein and Intermediary Regulator of Phytoceramide Levels. Cell Rep 2014 6 388 399 4NTO 24412362 Crystal structure of D60A mutant of Arabidopsis ACD11 (accelerated-cell-death 11) complexed with C2 ceramide-1-phosphate (d18:1/2:0) at 2.15 Angstrom resolution 2013-12-02 2014-02-05 Simanshu, D.K.,Zhai, X.,Munch, D.,Hofius, D.,Markham, J.E.,Bielawski, J.,Bielawska, A.,Malinina, L.,Molotkovsky, J.G.,Mundy, J.W.,Patel, D.J.,Brown, R.E. Arabidopsis Accelerated Cell Death 11, ACD11, Is a Ceramide-1-Phosphate Transfer Protein and Intermediary Regulator of Phytoceramide Levels. Cell Rep 2014 6 388 399 4O1O 24462203 Crystal Structure of RNase L in complex with 2-5A 2013-12-16 2014-02-05 Huang, H.,Zeqiraj, E.,Dong, B.,Jha, B.K.,Duffy, N.M.,Orlicky, S.,Thevakumaran, N.,Talukdar, M.,Pillon, M.C.,Ceccarelli, D.F.,Wan, L.C.,Juang, Y.C.,Mao, D.Y.,Gaughan, C.,Brinton, M.A.,Perelygin, A.A.,Kourinov, I.,Guarne, A.,Silverman, R.H.,Sicheri, F. Dimeric structure of pseudokinase RNase L bound to 2-5A reveals a basis for interferon-induced antiviral activity. Mol.Cell 2014 53 221 234 4O1P 24462203 Crystal Structure of RNase L in complex with 2-5A and AMP-PNP 2013-12-16 2014-02-05 Huang, H.,Zeqiraj, E.,Dong, B.,Jha, B.K.,Duffy, N.M.,Orlicky, S.,Thevakumaran, N.,Talukdar, M.,Pillon, M.C.,Ceccarelli, D.F.,Wan, L.C.,Juang, Y.C.,Mao, D.Y.,Gaughan, C.,Brinton, M.A.,Perelygin, A.A.,Kourinov, I.,Guarne, A.,Silverman, R.H.,Sicheri, F. Dimeric structure of pseudokinase RNase L bound to 2-5A reveals a basis for interferon-induced antiviral activity. Mol.Cell 2014 53 221 234 4LFD 24519933 Staphylococcus aureus sortase B-substrate complex 2013-06-26 2014-02-12 Jacobitz, A.W.,Wereszczynski, J.,Yi, S.W.,Amer, B.R.,Huang, G.L.,Nguyen, A.V.,Sawaya, M.R.,Jung, M.E.,McCammon, J.A.,Clubb, R.T. Structural and Computational Studies of the Staphylococcus aureus Sortase B-Substrate Complex Reveal a Substrate-stabilized Oxyanion Hole. J.Biol.Chem. 2014 289 8891 8902 4M1B 24637747 Structural Determination of BA0150, a Polysaccharide Deacetylase from Bacillus anthracis 2013-08-02 2014-02-12 Strunk, R.J.,Piemonte, K.M.,Petersen, N.M.,Koutsioulis, D.,Bouriotis, V.,Perry, K.,Cole, K.E. Structure determination of BA0150, a putative polysaccharide deacetylase from Bacillus anthracis. Acta Crystallogr F Struct Biol 2014 70 156 159 4NV2 24477003 C50A mutant of Synechococcus VKOR, C2221 crystal form 2013-12-04 2014-02-12 Liu, S.,Cheng, W.,Fowle Grider, R.,Shen, G.,Li, W. Structures of an intramembrane vitamin K epoxide reductase homolog reveal control mechanisms for electron transfer. Nat Commun 2014 5 3110 3110 4NV6 24477003 C212A mutant of Synechococcus VKOR 2013-12-04 2014-02-12 Liu, S.,Cheng, W.,Fowle Grider, R.,Shen, G.,Li, W. Structures of an intramembrane vitamin K epoxide reductase homolog reveal control mechanisms for electron transfer. Nat Commun 2014 5 3110 3110 3WIS 24523405 Crystal structure of Burkholderia xenovorans DmrB in complex with FMN: A Cubic Protein Cage for Redox Transfer 2013-09-25 2014-02-19 Mcnamara, D.E.,Cascio, D.,Jorda, J.,Bustos, C.,Wang, T.C.,Rasche, M.E.,Yeates, T.O.,Bobik, T.A. Structure of dihydromethanopterin reductase, a cubic protein cage for redox transfer J.Biol.Chem. 2014 289 8852 8864 4MWG 24523405 Crystal structure of Burkholderia xenovorans DmrB apo form: A Cubic Protein Cage for Redox Transfer 2013-09-24 2014-02-19 Mcnamara, D.E.,Cascio, D.,Jorda, J.,Bustos, C.,Wang, T.C.,Rasche, M.E.,Yeates, T.O.,Bobik, T.A. Structure of dihydromethanopterin reductase, a cubic protein cage for redox transfer J.Biol.Chem. 2014 289 8852 8864 4NM9 24550478 Crystal structure of the resting state of proline utilization A (PutA) from Geobacter sulfurreducens PCA 2013-11-14 2014-02-19 Singh, H.,Arentson, B.W.,Becker, D.F.,Tanner, J.J. Structures of the PutA peripheral membrane flavoenzyme reveal a dynamic substrate-channeling tunnel and the quinone-binding site. Proc.Natl.Acad.Sci.USA 2014 111 3389 3394 4NMD 24550478 Crystal structure of proline utilization A (PutA) from Geobacter sulfurreducens PCA reduced with dithionite 2013-11-14 2014-02-19 Singh, H.,Arentson, B.W.,Becker, D.F.,Tanner, J.J. Structures of the PutA peripheral membrane flavoenzyme reveal a dynamic substrate-channeling tunnel and the quinone-binding site. Proc.Natl.Acad.Sci.USA 2014 111 3389 3394 4NMF 24550478 Crystal structure of proline utilization A (PutA) from Geobacter sulfurreducens PCA inactivated by N-propargylglycine and complexed with menadione bisulfite 2013-11-14 2014-02-19 Singh, H.,Arentson, B.W.,Becker, D.F.,Tanner, J.J. Structures of the PutA peripheral membrane flavoenzyme reveal a dynamic substrate-channeling tunnel and the quinone-binding site. Proc.Natl.Acad.Sci.USA 2014 111 3389 3394 4NPL 24561204 Crystal structure of Zebrafish ALKBH5 in complex with alpha-ketoglutarate 2013-11-21 2014-02-19 Chen, W.,Zhang, L.,Zheng, G.,Fu, Y.,Ji, Q.,Liu, F.,Chen, H.,He, C. Crystal structure of the RNA demethylase ALKBH5 from zebrafish. Febs Lett. 2014 588 892 898 4NPM 24561204 Crystal structure of Zebrafish ALKBH5 in complex with succinic acid 2013-11-21 2014-02-19 Chen, W.,Zhang, L.,Zheng, G.,Fu, Y.,Ji, Q.,Liu, F.,Chen, H.,He, C. Crystal structure of the RNA demethylase ALKBH5 from zebrafish. Febs Lett. 2014 588 892 898 4OE5 24502590 Structure of Human ALDH4A1 Crystallized in Space Group P21 2014-01-11 2014-02-19 Pemberton, T.A.,Srivastava, D.,Sanyal, N.,Henzl, M.T.,Becker, D.F.,Tanner, J.J. Structural Studies of Yeast Delta (1)-Pyrroline-5-carboxylate Dehydrogenase (ALDH4A1): Active Site Flexibility and Oligomeric State. Biochemistry 2014 53 1350 1359 4OE6 24502590 Crystal Structure of Yeast ALDH4A1 2014-01-11 2014-02-19 Pemberton, T.A.,Srivastava, D.,Sanyal, N.,Henzl, M.T.,Becker, D.F.,Tanner, J.J. Structural Studies of Yeast Delta (1)-Pyrroline-5-carboxylate Dehydrogenase (ALDH4A1): Active Site Flexibility and Oligomeric State. Biochemistry 2014 53 1350 1359 4NQA 24561505 Crystal structure of liganded hRXR-alpha/hLXR-beta heterodimer on DNA 2013-11-24 2014-02-26 Lou, X.,Toresson, G.,Benod, C.,Suh, J.H.,Philips, K.J.,Webb, P.,Gustafsson, J.A. Structure of the retinoid X receptor alpha-liver X receptor beta (RXR alpha-LXR beta ) heterodimer on DNA. Nat.Struct.Mol.Biol. 2014 21 277 281 4NGB 24486018 Structure of human Dicer Platform-PAZ-Connector Helix cassette in complex with 12-mer siRNA having UU-3' ends (2.25 Angstrom resolution) 2013-11-01 2014-03-05 Tian, Y.,Simanshu, D.K.,Ma, J.B.,Park, J.E.,Heo, I.,Kim, V.N.,Patel, D.J. A Phosphate-Binding Pocket within the Platform-PAZ-Connector Helix Cassette of Human Dicer. Mol.Cell 2014 53 606 616 4NGG 24486018 Structure of human Dicer Platform-PAZ-Connector Helix cassette in complex with 13-mer siRNA having 5'-A and UU-3' ends (2.6 Angstrom resolution) 2013-11-01 2014-03-05 Tian, Y.,Simanshu, D.K.,Ma, J.B.,Park, J.E.,Heo, I.,Kim, V.N.,Patel, D.J. A Phosphate-Binding Pocket within the Platform-PAZ-Connector Helix Cassette of Human Dicer. Mol.Cell 2014 53 606 616 4NHA 24486018 Structure of human Dicer Platform-PAZ-Connector Helix cassette in complex with 16-mer siRNA having 5'-p and UU-3' ends (3.4 Angstrom resolution) 2013-11-04 2014-03-05 Tian, Y.,Simanshu, D.K.,Ma, J.B.,Park, J.E.,Heo, I.,Kim, V.N.,Patel, D.J. A Phosphate-Binding Pocket within the Platform-PAZ-Connector Helix Cassette of Human Dicer. Mol.Cell 2014 53 606 616 4M7G 24598752 Streptomyces Erythraeus Trypsin 2013-08-12 2014-03-12 Blankenship, E.,Vukoti, K.,Miyagi, M.,Lodowski, D.T. Conformational flexibility in the catalytic triad revealed by the high-resolution crystal structure of Streptomyces erythraeus trypsin in an unliganded state. Acta Crystallogr.,Sect.D 2014 70 833 840 4MWS 24599961 Crystal structure of human PPCA (trigonal crystal form 1) 2013-09-25 2014-03-12 Kolli, N.,Garman, S.C. Proteolytic activation of human cathepsin A. J.Biol.Chem. 2014 289 11592 11600 4MWT 24599961 Crystal structure of human PPCA (trigonal crystal form 2) 2013-09-25 2014-03-12 Kolli, N.,Garman, S.C. Proteolytic activation of human cathepsin A. J.Biol.Chem. 2014 289 11592 11600 4OD4 24558159 Apo structure of a UbiA homolog from Aeropyrum pernix K1 2014-01-09 2014-03-19 Cheng, W.,Li, W. Structural insights into ubiquinone biosynthesis in membranes. Science 2014 343 878 881 4OKR 24639528 Structures of Toxoplasma gondii MIC2 2014-01-22 2014-03-19 Song, G.,Springer, T.A. Structures of the Toxoplasma gliding motility adhesin. Proc.Natl.Acad.Sci.USA 2014 111 4862 4867 4OKU 24639528 Structure of Toxoplasma gondii proMIC2 2014-01-22 2014-03-19 Song, G.,Springer, T.A. Structures of the Toxoplasma gliding motility adhesin. Proc.Natl.Acad.Sci.USA 2014 111 4862 4867 4OU9 24648526 Crystal structure of apocarotenoid oxygenase in the presence of Triton X-100 2014-02-15 2014-03-19 Sui, X.,Kiser, P.D.,Che, T.,Carey, P.R.,Golczak, M.,Shi, W.,von Lintig, J.,Palczewski, K. Analysis of Carotenoid Isomerase Activity in a Prototypical Carotenoid Cleavage Enzyme, Apocarotenoid Oxygenase (ACO). J.Biol.Chem. 2014 289 12286 12299 4NN0 24531000 Crystal structure of the C1QTNF5 globular domain in space group P63 2013-11-15 2014-03-26 Tu, X.,Palczewski, K. The macular degeneration-linked C1QTNF5 (S163) mutation causes higher-order structural rearrangements. J.Struct.Biol. 2014 186 86 94 4LCL 24727900 Simvastatin Synthase (LOVD), from Aspergillus Terreus, LovD6 mutant (simh6208) 2013-06-21 2014-04-02 Jimenez-Oses, G.,Osuna, S.,Gao, X.,Sawaya, M.R.,Gilson, L.,Collier, S.J.,Huisman, G.W.,Yeates, T.O.,Tang, Y.,Houk, K.N. The role of distant mutations and allosteric regulation on LovD active site dynamics. Nat.Chem.Biol. 2014 10 431 436 4M5S 24711386 Human alphaB crystallin core domain in complex with C-terminal peptide 2013-08-08 2014-04-09 Hochberg, G.K.,Ecroyd, H.,Liu, C.,Cox, D.,Cascio, D.,Sawaya, M.R.,Collier, M.P.,Stroud, J.,Carver, J.A.,Baldwin, A.J.,Robinson, C.V.,Eisenberg, D.S.,Benesch, J.L.,Laganowsky, A. The structured core domain of alpha B-crystallin can prevent amyloid fibrillation and associated toxicity. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4M5T 24711386 Disulfide trapped human alphaB crystallin core domain in complex with C-terminal peptide 2013-08-08 2014-04-09 Hochberg, G.K.,Ecroyd, H.,Liu, C.,Cox, D.,Cascio, D.,Sawaya, M.R.,Collier, M.P.,Stroud, J.,Carver, J.A.,Baldwin, A.J.,Robinson, C.V.,Eisenberg, D.S.,Benesch, J.L.,Laganowsky, A. The structured core domain of alpha B-crystallin can prevent amyloid fibrillation and associated toxicity. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4OX9 24717845 Crystal structure of the aminoglycoside resistance methyltransferase NpmA bound to the 30S ribosomal subunit 2014-02-04 2014-04-09 Dunkle, J.A.,Vinal, K.,Desai, P.M.,Zelinskaya, N.,Savic, M.,West, D.M.,Conn, G.L.,Dunham, C.M. Molecular recognition and modification of the 30S ribosome by the aminoglycoside-resistance methyltransferase NpmA. Proc.Natl.Acad.Sci.USA 2014 111 6275 6280 4P8S 21308849 Crystal structure of Nogo-receptor-2 2014-04-01 2014-04-09 Semavina, M.,Saha, N.,Kolev, M.V.,Goldgur, Y.,Giger, R.J.,Himanen, J.P.,Nikolov, D.B. Crystal structure of the Nogo-receptor-2. Protein Sci. 2011 0 684 689 4IRF 26130467 Preliminary structural investigations of a malarial protein secretion system 2013-01-14 2014-04-16 AhYoung, A.P.,Koehl, A.,Cascio, D.,Egea, P.F. Structural mapping of the ClpB ATPases of Plasmodium falciparum: Targeting protein folding and secretion for antimalarial drug design. Protein Sci. 2015 24 1508 1520 4JPZ 25232683 Voltage-gated sodium channel 1.2 C-terminal domain in complex with FGF13U and Ca2+/calmodulin 2013-03-19 2014-04-16 Wang, C.,Chung, B.C.,Yan, H.,Wang, H.G.,Lee, S.Y.,Pitt, G.S. Structural analyses of Ca(2+)/CaM interaction with NaV channel C-termini reveal mechanisms of calcium-dependent regulation. Nat Commun 2014 5 4896 4896 4JMG 24910098 Crystal structure of the synthetic protein in complex with pY peptide 2013-03-14 2014-04-23 Yasui, N.,Findlay, G.M.,Gish, G.D.,Hsiung, M.S.,Huang, J.,Tucholska, M.,Taylor, L.,Smith, L.,Boldridge, W.C.,Koide, A.,Pawson, T.,Koide, S. Directed network wiring identifies a key protein interaction in embryonic stem cell differentiation. Mol.Cell 2014 54 1034 1041 4P5S 24704124 Structure of reduced W45Y mutant of amicyanin 2014-03-19 2014-04-23 Dow, B.A.,Sukumar, N.,Matos, J.O.,Choi, M.,Schulte, A.,Tatulian, S.A.,Davidson, V.L. The sole tryptophan of amicyanin enhances its thermal stability but does not influence the electronic properties of the type 1 copper site. Arch.Biochem.Biophys. 2014 0 20 27 4LR3 24816117 Crystal structure of E. coli YfbU at 2.5 A resolution 2013-07-19 2014-04-30 Wang, J.,Wing, R.A. Diamonds in the rough: a strong case for the inclusion of weak-intensity X-ray diffraction data. Acta Crystallogr.,Sect.D 2014 70 1491 1497 4P91 21308849 Crystal structure of the nogo-receptor-2 (27-330) 2014-04-01 2014-04-30 Semavina, M.,Saha, N.,Kolev, M.V.,Goldgur, Y.,Giger, R.J.,Himanen, J.P.,Nikolov, D.B. Crystal structure of the Nogo-receptor-2. Protein Sci. 2011 20 684 689 4OJ2 The structure of aquaporin 2014-01-20 2014-05-07 Vahedi-Faridi, A.,Lodowski, D.,Schenk, A.,Kaptan, S.,De groot, B.,Walz, T.,Engel, A. The structure of aquaporin To be Published 0 0 0 0 4N6E 24814342 Crystal structure of Amycolatopsis orientalis BexX/CysO complex 2013-10-11 2014-05-14 Sasaki, E.,Zhang, X.,Sun, H.G.,Lu, M.Y.,Liu, T.L.,Ou, A.,Li, J.Y.,Chen, Y.H.,Ealick, S.E.,Liu, H.W. Co-opting sulphur-carrier proteins from primary metabolic pathways for 2-thiosugar biosynthesis. Nature 2014 509 427 431 4O6N 24923293 Structure of AF2299, a CDP-alcohol phosphotransferase (CDP-bound) 2013-12-22 2014-05-14 Sciara, G.,Clarke, O.B.,Tomasek, D.,Kloss, B.,Tabuso, S.,Byfield, R.,Cohn, R.,Banerjee, S.,Rajashankar, K.R.,Slavkovic, V.,Graziano, J.H.,Shapiro, L.,Mancia, F. Structural basis for catalysis in a CDP-alcohol phosphotransferase. Nat Commun 2014 5 4068 4068 4P2S 24747050 Alanine Scanning Mutagenesis Identifies an Asparagine-Arginine-Lysine Triad Essential to Assembly of the Shell of the Pdu Microcompartment 2014-03-03 2014-05-14 Sinha, S.,Cheng, S.,Sung, Y.W.,McNamara, D.E.,Sawaya, M.R.,Yeates, T.O.,Bobik, T.A. Alanine Scanning Mutagenesis Identifies an Asparagine-Arginine-Lysine Triad Essential to Assembly of the Shell of the Pdu Microcompartment. J.Mol.Biol. 2014 426 2328 0 4P42 24847877 Extended-Synaptotagmin 2, SMP - C2A - C2B Domains 2014-03-10 2014-05-14 Schauder, C.M.,Wu, X.,Saheki, Y.,Narayanaswamy, P.,Torta, F.,Wenk, M.R.,De Camilli, P.,Reinisch, K.M. Structure of a lipid-bound extended synaptotagmin indicates a role in lipid transfer. Nature 2014 510 552 555 4PPD 24747050 PduA K26A, crystal form 2 2014-02-26 2014-05-14 Sinha, S.,Cheng, S.,Sung, Y.W.,McNamara, D.E.,Sawaya, M.R.,Yeates, T.O.,Bobik, T.A. Alanine scanning mutagenesis identifies an asparagine-arginine-lysine triad essential to assembly of the shell of the pdu microcompartment. J.Mol.Biol. 2014 426 2328 2345 4NXM Crystal Structure of the 30S ribosomal subunit from a GidB (RsmG) mutant of Thermus thermophilus (HB8) 2013-12-09 2014-05-21 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4NXN Crystal Structure of the 30S ribosomal subunit from a GidB (RsmG) mutant of Thermus thermophilus (HB8), bound with streptomycin 2013-12-09 2014-05-21 Demirci, H.,Murphy IV, F.,Murphy, E.,Gregory, S.T.,Dahlberg, A.E.,Jogl, G. A structural basis for streptomycin resistance To be Published 0 0 0 0 4NWN 24870237 Computationally Designed Two-Component Self-Assembling Tetrahedral Cage T32-28 2013-12-06 2014-05-28 King, N.P.,Bale, J.B.,Sheffler, W.,McNamara, D.E.,Gonen, S.,Gonen, T.,Yeates, T.O.,Baker, D. Accurate design of co-assembling multi-component protein nanomaterials. Nature 2014 510 103 108 4NWO 24870237 Computationally Designed Two-Component Self-Assembling Tetrahedral Cage T33-15 2013-12-06 2014-05-28 King, N.P.,Bale, J.B.,Sheffler, W.,McNamara, D.E.,Gonen, S.,Gonen, T.,Yeates, T.O.,Baker, D. Accurate design of co-assembling multi-component protein nanomaterials. Nature 2014 510 103 108 4NWP 24870237 Computationally Designed Two-Component Self-Assembling Tetrahedral Cage, T33-21, Crystallized in Space Group R32 2013-12-06 2014-05-28 King, N.P.,Bale, J.B.,Sheffler, W.,McNamara, D.E.,Gonen, S.,Gonen, T.,Yeates, T.O.,Baker, D. Accurate design of co-assembling multi-component protein nanomaterials. Nature 2014 510 103 108 4NWQ 24870237 Computationally Designed Two-Component Self-Assembling Tetrahedral Cage, T33-21, Crystallized in Space Group F4132 2013-12-06 2014-05-28 King, N.P.,Bale, J.B.,Sheffler, W.,McNamara, D.E.,Gonen, S.,Gonen, T.,Yeates, T.O.,Baker, D. Accurate design of co-assembling multi-component protein nanomaterials. Nature 2014 510 103 108 4NWR 24870237 Computationally Designed Two-Component Self-Assembling Tetrahedral Cage T33-28 2013-12-06 2014-05-28 King, N.P.,Bale, J.B.,Sheffler, W.,McNamara, D.E.,Gonen, S.,Gonen, T.,Yeates, T.O.,Baker, D. Accurate design of co-assembling multi-component protein nanomaterials. Nature 2014 510 103 108 4NYA 24768306 Crystal structure of the E. coli thiM riboswitch in complex with 5-(azidomethyl)-2-methylpyrimidin-4-amine 2013-12-10 2014-06-04 Warner, K.D.,Homan, P.,Weeks, K.M.,Smith, A.G.,Abell, C.,Ferre-D'Amare, A.R. Validating Fragment-Based Drug Discovery for Biological RNAs: Lead Fragments Bind and Remodel the TPP Riboswitch Specifically. Chem.Biol. 2014 21 591 595 4O9P 25574024 Crystal structure of Thermus thermophilis transhydrogeanse domain II dimer SeMet derivative 2014-01-02 2014-06-11 Leung, J.H.,Schurig-Briccio, L.A.,Yamaguchi, M.,Moeller, A.,Speir, J.A.,Gennis, R.B.,Stout, C.D. Structural biology. Division of labor in transhydrogenase by alternating proton translocation and hydride transfer. Science 2015 347 178 181 4PM4 Structure of a putative periplasmic iron siderophore binding protein (Rv0265c) from Mycobacterium tuberculosis H37Rv 2014-05-20 2014-06-11 Arbing, M.A.,Chan, S.,Tran, N.,Kuo, E.,Lu, J.,Harris, L.R.,Zhou, T.T.,Eisenberg, D. Structure of a putative periplasmic iron siderophore binding protein (Rv0265c) from Mycobacterium tuberculosis H37Rv To Be Published 0 0 0 0 4Q2U 24898247 Crystal structure of the E. coli DinJ-YafQ toxin-antitoxin complex 2014-04-09 2014-06-11 Ruangprasert, A.,Maehigashi, T.,Miles, S.J.,Giridharan, N.,Liu, J.X.,Dunham, C.M. Mechanisms of Toxin Inhibition and Transcriptional Repression by Escherichia coli DinJ-YafQ. J.Biol.Chem. 2014 289 20559 20569 4KZD 24952597 Crystal structure of an RNA aptamer in complex with fluorophore and Fab 2013-05-29 2014-06-18 Huang, H.,Suslov, N.B.,Li, N.S.,Shelke, S.A.,Evans, M.E.,Koldobskaya, Y.,Rice, P.A.,Piccirilli, J.A. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore. Nat.Chem.Biol. 2014 10 686 691 4KZE 24952597 Crystal structure of an RNA aptamer in complex with Fab 2013-05-29 2014-06-18 Huang, H.,Suslov, N.B.,Li, N.S.,Shelke, S.A.,Evans, M.E.,Koldobskaya, Y.,Rice, P.A.,Piccirilli, J.A. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore. Nat.Chem.Biol. 2014 10 686 691 4PLN 24876346 Crystal Structure of Chicken Netrin-1 (LN-LE3) complexed with mouse Neogenin (FN4-5) 2014-05-18 2014-06-18 Xu, K.,Wu, Z.,Renier, N.,Antipenko, A.,Tzvetkova-Robev, D.,Xu, Y.,Minchenko, M.,Nardi-Dei, V.,Rajashankar, K.R.,Himanen, J.,Tessier-Lavigne, M.,Nikolov, D.B. Neural migration. Structures of netrin-1 bound to two receptors provide insight into its axon guidance mechanism. Science 2014 344 1275 1279 4PLO 24876346 Crystal Structure of chicken Netrin-1 (LN-LE3) in complex with mouse DCC (FN4-5) 2014-05-18 2014-06-18 Xu, K.,Wu, Z.,Renier, N.,Antipenko, A.,Tzvetkova-Robev, D.,Xu, Y.,Minchenko, M.,Nardi-Dei, V.,Rajashankar, K.R.,Himanen, J.,Tessier-Lavigne, M.,Nikolov, D.B. Neural migration. Structures of netrin-1 bound to two receptors provide insight into its axon guidance mechanism. Science 2014 344 1275 1279 4OWR 24927547 Vesiculoviral matrix (M) protein occupies nucleic acid binding site at nucleoporin pair Rae1-Nup98 2014-02-03 2014-06-25 Quan, B.,Seo, H.S.,Blobel, G.,Ren, Y. Vesiculoviral matrix (M) protein occupies nucleic acid binding site at nucleoporin pair (Rae1 Nup98). Proc.Natl.Acad.Sci.USA 2014 111 9127 9132 4OY2 24927529 Crystal structure of TAF1-TAF7, a TFIID subcomplex 2014-02-10 2014-06-25 Bhattacharya, S.,Lou, X.,Hwang, P.,Rajashankar, K.R.,Wang, X.,Gustafsson, J.-A.,Fletterick, R.J.,Jacobson, R.H.,Webb, P. Structural and functional insight into TAF1-TAF7, a subcomplex of transcription factor II D. Proc.Natl.Acad.Sci.USA 2014 111 9103 9108 4PAY 24483784 Crystal structure of an N-terminal fragment of the Legionella pneumophila effector protein SidC. 2014-04-10 2014-06-25 Horenkamp, F.A.,Mukherjee, S.,Alix, E.,Schauder, C.M.,Hubber, A.M.,Roy, C.R.,Reinisch, K.M. Legionella pneumophila Subversion of Host Vesicular Transport by SidC Effector Proteins. Traffic 2014 15 488 499 4PLX 24952594 Crystal structure of the triple-helical stability element at the 3' end of MALAT1 2014-05-19 2014-06-25 Brown, J.A.,Bulkley, D.,Wang, J.,Valenstein, M.L.,Yario, T.A.,Steitz, T.A.,Steitz, J.A. Structural insights into the stabilization of MALAT1 noncoding RNA by a bipartite triple helix. Nat.Struct.Mol.Biol. 2014 21 633 640 4PZ7 24939935 PCE1 guanylyltransferase 2014-03-28 2014-06-25 Doamekpor, S.K.,Sanchez, A.M.,Schwer, B.,Shuman, S.,Lima, C.D. How an mRNA capping enzyme reads distinct RNA polymerase II and Spt5 CTD phosphorylation codes. Genes Dev. 2014 28 1323 1336 4LF4 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus To be Published 2013 0 0 0 4LF5 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus To be Published 2013 0 0 0 4LF6 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus To be Published 2013 0 0 0 4LF7 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus To be Published 2013 0 0 0 4LF8 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus to be published 2013 0 0 0 4LF9 Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus to be published 2013 0 0 0 4LFA Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus to be published 2013 0 0 0 4LFB Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. Crystal Structure of 30S ribosomal subunit from Thermus thermophilus to be published 2013 0 0 0 4LFC Crystal Structure of 30S ribosomal subunit from Thermus thermophilus 2013-06-26 2014-07-02 Demirci, H.,Belardinelli, R.,Carr, J.,Murphy IV, F.,Jogl, G.,Dahlberg, A.E.,Gregory, S.T. to be published 2013 0 0 0 4OTP 24948609 Crystal structure of the catalytic domain of the human RioK1 atypical protein kinase in complex with ADP/Mg2+ 2014-02-14 2014-07-02 Ferreira-Cerca, S.,Kiburu, I.,Thomson, E.,LaRonde, N.,Hurt, E. Dominant Rio1 kinase/ATPase catalytic mutant induces trapping of late pre-40S biogenesis factors in 80S-like ribosomes. Nucleic Acids Res. 2014 42 8635 8647 4QLB 24982189 Structural Basis for the Recruitment of Glycogen Synthase by Glycogenin 2014-06-11 2014-07-09 Zeqiraj, E.,Tang, X.,Hunter, R.W.,Garcia-Rocha, M.,Judd, A.,Deak, M.,von Wilamowitz-Moellendorff, A.,Kurinov, I.,Guinovart, J.J.,Tyers, M.,Sakamoto, K.,Sicheri, F. Structural basis for the recruitment of glycogen synthase by glycogenin. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4V6A 19696344 Structure of EF-P bound to the 70S ribosome. 2009-06-15 2014-07-09 Blaha, G.,Stanley, R.E.,Steitz, T.A. Formation of the first peptide bond: the structure of EF-P bound to the 70S ribosome. Science 2009 325 966 970 4V6C 19696352 Crystal structure of the E. coli 70S ribosome in an intermediate state of ratcheting 2009-06-27 2014-07-09 Zhang, W.,Dunkle, J.A.,Cate, J.H. Structures of the ribosome in intermediate States of ratcheting. Science 2009 325 1014 1017 4V6D 19696352 Crystal structure of the E. coli 70S ribosome in an intermediate state of ratcheting 2009-06-27 2014-07-09 Zhang, W.,Dunkle, J.A.,Cate, J.H. Structures of the ribosome in intermediate States of ratcheting. Science 2009 325 1014 1017 4V6E 19696352 Crystal structure of the E. coli 70S ribosome in an intermediate state of ratcheting 2009-06-28 2014-07-09 Zhang, W.,Dunkle, J.A.,Cate, J.H. Structures of the ribosome in intermediate States of ratcheting. Science 2009 325 1014 1017 4V7L 20154709 The structures of viomycin bound to the 70S ribosome. 2009-11-12 2014-07-09 Stanley, R.E.,Blaha, G.,Grodzicki, R.L.,Strickler, M.D.,Steitz, T.A. The structures of the anti-tuberculosis antibiotics viomycin and capreomycin bound to the 70S ribosome. Nat.Struct.Mol.Biol. 2010 17 289 293 4V7M 20154709 The structures of Capreomycin bound to the 70S ribosome. 2009-11-12 2014-07-09 Stanley, R.E.,Blaha, G.,Grodzicki, R.L.,Strickler, M.D.,Steitz, T.A. The structures of the anti-tuberculosis antibiotics viomycin and capreomycin bound to the 70S ribosome. Nat.Struct.Mol.Biol. 2010 17 289 293 4V7W 20876130 Structure of the Thermus thermophilus ribosome complexed with chloramphenicol. 2010-08-16 2014-07-09 Bulkley, D.,Innis, C.A.,Blaha, G.,Steitz, T.A. Revisiting the structures of several antibiotics bound to the bacterial ribosome. Proc.Natl.Acad.Sci.USA 2010 107 17158 17163 4V7X 20876130 Structure of the Thermus thermophilus ribosome complexed with erythromycin. 2010-08-17 2014-07-09 Bulkley, D.,Innis, C.A.,Blaha, G.,Steitz, T.A. Revisiting the structures of several antibiotics bound to the bacterial ribosome. Proc.Natl.Acad.Sci.USA 2010 107 17158 17163 4V7Z 20876130 Structure of the Thermus thermophilus 70S ribosome complexed with telithromycin. 2010-08-18 2014-07-09 Bulkley, D.,Innis, C.A.,Blaha, G.,Steitz, T.A. Revisiting the structures of several antibiotics bound to the bacterial ribosome. Proc.Natl.Acad.Sci.USA 2010 107 17158 17163 4V8J 23630274 Crystal structure of the bacterial ribosome ram mutation G347U. 2011-12-20 2014-07-09 Fagan, C.E.,Dunkle, J.A.,Maehigashi, T.,Dang, M.N.,Devaraj, A.,Miles, S.J.,Qin, D.,Fredrick, K.,Dunham, C.M. Reorganization of an intersubunit bridge induced by disparate 16S ribosomal ambiguity mutations mimics an EF-Tu-bound state. Proc.Natl.Acad.Sci.USA 2013 110 9716 9721 4V97 23630274 Crystal structure of the bacterial ribosome ram mutation G299A. 2012-04-06 2014-07-09 Fagan, C.E.,Dunkle, J.A.,Maehigashi, T.,Dang, M.N.,Devaraj, A.,Miles, S.J.,Qin, D.,Fredrick, K.,Dunham, C.M. Reorganization of an intersubunit bridge induced by disparate 16S ribosomal ambiguity mutations mimics an EF-Tu-bound state. Proc.Natl.Acad.Sci.USA 2013 110 9716 9721 4V9D 21596992 Structures of the bacterial ribosome in classical and hybrid states of tRNA binding 2012-07-31 2014-07-09 Dunkle, J.A.,Wang, L.,Feldman, M.B.,Pulk, A.,Chen, V.B.,Kapral, G.J.,Noeske, J.,Richardson, J.S.,Blanchard, S.C.,Cate, J.H. Structures of the bacterial ribosome in classical and hybrid states of tRNA binding. Science 2011 332 981 984 4V9R 24412368 Crystal structure of antibiotic DITYROMYCIN bound to 70S ribosome 2013-12-05 2014-07-09 Bulkley, D.,Brandi, L.,Polikanov, Y.S.,Fabbretti, A.,O'Connor, M.,Gualerzi, C.O.,Steitz, T.A. The antibiotics dityromycin and GE82832 bind protein S12 and block EF-G-catalyzed translocation. Cell Rep 2014 6 357 365 4V9R 24412368 Crystal structure of antibiotic DITYROMYCIN bound to 70S ribosome 2013-12-05 2014-07-09 Bulkley, D.,Brandi, L.,Polikanov, Y.S.,Fabbretti, A.,O'Connor, M.,Gualerzi, C.O.,Steitz, T.A. The antibiotics dityromycin and GE82832 bind protein S12 and block EF-G-catalyzed translocation. Cell Rep 2014 6 357 365 4V9S 24412368 Crystal structure of antibiotic GE82832 bound to 70S ribosome 2013-12-05 2014-07-09 Bulkley, D.,Brandi, L.,Polikanov, Y.S.,Fabbretti, A.,O'Connor, M.,Gualerzi, C.O.,Steitz, T.A. The antibiotics dityromycin and GE82832 bind protein S12 and block EF-G-catalyzed translocation. Cell Rep 2014 6 357 365 4V9S 24412368 Crystal structure of antibiotic GE82832 bound to 70S ribosome 2013-12-05 2014-07-09 Bulkley, D.,Brandi, L.,Polikanov, Y.S.,Fabbretti, A.,O'Connor, M.,Gualerzi, C.O.,Steitz, T.A. The antibiotics dityromycin and GE82832 bind protein S12 and block EF-G-catalyzed translocation. Cell Rep 2014 6 357 365 4NJ8 24998259 Crystal structure of the human ANKS3 SAM Domain L52A mutant 2013-11-08 2014-07-16 Leettola, C.N.,Knight, M.J.,Cascio, D.,Hoffman, S.,Bowie, J.U. Characterization of the SAM domain of the PKD-related protein ANKS6 and its interaction with ANKS3. Bmc Struct.Biol. 2014 14 17 17 4NL9 24998259 Crystal structure of the human Anks3-SAM/Anks6-SAM heterodimer 2013-11-13 2014-07-16 Leettola, C.N.,Knight, M.J.,Cascio, D.,Hoffman, S.,Bowie, J.U. Characterization of the SAM domain of the PKD-related protein ANKS6 and its interaction with ANKS3. Bmc Struct.Biol. 2014 14 17 17 4P4R 24995984 Structural Basis of Chronic Beryllium Disease: Bridging the Gap Between Allergic Hypersensitivity and Autoimmunity 2014-03-13 2014-07-16 Clayton, G.M.,Wang, Y.,Crawford, F.,Novikov, A.,Wimberly, B.T.,Kieft, J.S.,Falta, M.T.,Bowerman, N.A.,Marrack, P.,Fontenot, A.P.,Dai, S.,Kappler, J.W. Structural basis of chronic beryllium disease: linking allergic hypersensitivity and autoimmunity. Cell 2014 158 132 142 4P57 24995984 MHC TCR peptide complex 2014-03-14 2014-07-16 Clayton, G.M.,Wang, Y.,Crawford, F.,Novikov, A.,Wimberly, B.T.,Kieft, J.S.,Falta, M.T.,Bowerman, N.A.,Marrack, P.,Fontenot, A.P.,Dai, S.,Kappler, J.W. Structural basis of chronic beryllium disease: linking allergic hypersensitivity and autoimmunity. Cell 2014 158 132 142 4TQ4 25051182 Structure of a UbiA homolog from Archaeoglobus fulgidus bound to DMAPP and Mg2+ 2014-06-10 2014-07-16 Huang, H.,Levin, E.J.,Liu, S.,Bai, Y.,Lockless, S.W.,Zhou, M. Structure of a Membrane-Embedded Prenyltransferase Homologous to UBIAD1. Plos Biol. 2014 12 0 0 4TS2 25026079 Crystal structure of the Spinach RNA aptamer in complex with DFHBI, magnesium ions 2014-06-18 2014-07-23 Warner, K.D.,Chen, M.C.,Song, W.,Strack, R.L.,Thorn, A.,Jaffrey, S.R.,Ferre-D'Amare, A.R. Structural basis for activity of highly efficient RNA mimics of green fluorescent protein. Nat.Struct.Mol.Biol. 2014 21 658 663 4OLO 25102080 Ligand-free structure of the GrpU microcompartment shell protein from Clostridiales bacterium 1_7_47FAA 2014-01-24 2014-07-30 Thompson, M.C.,Wheatley, N.M.,Jorda, J.,Sawaya, M.R.,Gidaniyan, S.D.,Ahmed, H.,Yang, Z.,McCarty, K.N.,Whitelegge, J.P.,Yeates, T.O. Identification of a unique fe-s cluster binding site in a glycyl-radical type microcompartment shell protein. J.Mol.Biol. 2014 426 3287 3304 4OLP 25102080 Ligand-free structure of the GrpU microcompartment shell protein from Pectobacterium wasabiae 2014-01-24 2014-07-30 Thompson, M.C.,Wheatley, N.M.,Jorda, J.,Sawaya, M.R.,Gidaniyan, S.D.,Ahmed, H.,Yang, Z.,McCarty, K.N.,Whitelegge, J.P.,Yeates, T.O. Identification of a unique fe-s cluster binding site in a glycyl-radical type microcompartment shell protein. J.Mol.Biol. 2014 426 3287 3304 1VVJ 25128388 Crystal Structure of Frameshift Suppressor tRNA SufA6 bound to Codon CCC-G on the Ribosome 2013-05-24 2014-08-06 Maehigashi, T.,Dunkle, J.A.,Miles, S.J.,Dunham, C.M. Structural insights into +1 frameshifting promoted by expanded or modification-deficient anticodon stem loops. Proc.Natl.Acad.Sci.USA 2014 111 12740 12745 4LEL 25128388 Crystal Structure of Frameshift Suppressor tRNA SufA6 Bound to Codon CCG-G on the Ribosome 2013-06-25 2014-08-06 Maehigashi, T.,Dunkle, J.A.,Miles, S.J.,Dunham, C.M. Structural insights into +1 frameshifting promoted by expanded or modification-deficient anticodon stem loops. Proc.Natl.Acad.Sci.USA 2014 111 12740 12745 4LNT 25128388 Crystal Structure of tRNA Proline (CGG) Bound to Codon CCC-U on the Ribosome 2013-07-12 2014-08-06 Maehigashi, T.,Dunkle, J.A.,Miles, S.J.,Dunham, C.M. Structural insights into +1 frameshifting promoted by expanded or modification-deficient anticodon stem loops. Proc.Natl.Acad.Sci.USA 2014 111 12740 12745 4MT0 24901251 Crystal Structure of the Open State of the Neisseria gonorrhoeae MtrE Outer Membrane Channel 2013-09-18 2014-08-06 Lei, H.T.,Chou, T.H.,Su, C.C.,Bolla, J.R.,Kumar, N.,Radhakrishnan, A.,Long, F.,Delmar, J.A.,Do, S.V.,Rajashankar, K.R.,Shafer, W.M.,Yu, E.W. Crystal structure of the open state of the Neisseria gonorrhoeae MtrE outer membrane channel. Plos One 2014 9 0 0 4MT1 24901251 Crystal Structure of the Neisseria gonorrhoeae MtrD Inner Membrane Multidrug Efflux Pump 2013-09-18 2014-08-06 Lei, H.T.,Chou, T.H.,Su, C.C.,Bolla, J.R.,Kumar, N.,Radhakrishnan, A.,Long, F.,Delmar, J.A.,Do, S.V.,Rajashankar, K.R.,Shafer, W.M.,Yu, E.W. Crystal structure of the open state of the Neisseria gonorrhoeae MtrE outer membrane channel. Plos One 2014 9 0 0 4PB1 25082345 Structure of vcCNT-7C8C bound to ribavirin 2014-04-11 2014-08-13 Johnson, Z.L.,Lee, J.H.,Lee, K.,Lee, M.,Kwon, D.Y.,Hong, J.,Lee, S.Y. Structural basis of nucleoside and nucleoside drug selectivity by concentrative nucleoside transporters. Elife 2014 3 0 0 4PB2 25082345 Structure of vcCNT-7C8C bound to 5-fluorouridine 2014-04-11 2014-08-13 Johnson, Z.L.,Lee, J.H.,Lee, K.,Lee, M.,Kwon, D.Y.,Hong, J.,Lee, S.Y. Structural basis of nucleoside and nucleoside drug selectivity by concentrative nucleoside transporters. Elife 2014 3 0 0 4PD5 25082345 Crystal structure of vcCNT-7C8C bound to gemcitabine 2014-04-17 2014-08-13 Johnson, Z.L.,Lee, J.H.,Lee, K.,Lee, M.,Kwon, D.Y.,Hong, J.,Lee, S.Y. Structural basis of nucleoside and nucleoside drug selectivity by concentrative nucleoside transporters. Elife 2014 3 0 0 4PD6 25082345 Crystal structure of vcCNT-7C8C bound to uridine 2014-04-17 2014-08-13 Johnson, Z.L.,Lee, J.H.,Lee, K.,Lee, M.,Kwon, D.Y.,Hong, J.,Lee, S.Y. Structural basis of nucleoside and nucleoside drug selectivity by concentrative nucleoside transporters. Elife 2014 3 0 0 4PD8 25082345 Structure of vcCNT-7C8C bound to pyrrolo-cytidine 2014-04-17 2014-08-13 Johnson, Z.L.,Lee, J.H.,Lee, K.,Lee, M.,Kwon, D.Y.,Hong, J.,Lee, S.Y. Structural basis of nucleoside and nucleoside drug selectivity by concentrative nucleoside transporters. Elife 2014 3 0 0 4PD9 25082345 Structure of vcCNT-7C8C bound to adenosine 2014-04-17 2014-08-13 Johnson, Z.L.,Lee, J.H.,Lee, K.,Lee, M.,Kwon, D.Y.,Hong, J.,Lee, S.Y. Structural basis of nucleoside and nucleoside drug selectivity by concentrative nucleoside transporters. Elife 2014 3 0 0 4PDA 25082345 Structure of vcCNT-7C8C bound to cytidine 2014-04-17 2014-08-13 Johnson, Z.L.,Lee, J.H.,Lee, K.,Lee, M.,Kwon, D.Y.,Hong, J.,Lee, S.Y. Structural basis of nucleoside and nucleoside drug selectivity by concentrative nucleoside transporters. Elife 2014 3 0 0 4TNV 25143115 C. elegans glutamate-gated chloride channel (GluCl) in complex with Fab in a non-conducting conformation 2014-06-05 2014-08-13 Althoff, T.,Hibbs, R.E.,Banerjee, S.,Gouaux, E. X-ray structures of GluCl in apo states reveal a gating mechanism of Cys-loop receptors. Nature 2014 512 333 337 4TNW 25143115 C. elegans glutamate-gated chloride channel (GluCl) in complex with Fab and POPC in a lipid-modulated conformation 2014-06-05 2014-08-13 Althoff, T.,Hibbs, R.E.,Banerjee, S.,Gouaux, E. X-ray structures of GluCl in apo states reveal a gating mechanism of Cys-loop receptors. Nature 2014 512 333 337 4TPW 25049413 The co-complex structure of the translation initiation factor eIF4E with the inhibitor 4EGI-1 reveals an allosteric mechanism for dissociating eIF4G 2014-06-09 2014-08-13 Papadopoulos, E.,Jenni, S.,Kabha, E.,Takrouri, K.J.,Yi, T.,Salvi, N.,Luna, R.E.,Gavathiotis, E.,Mahalingam, P.,Arthanari, H.,Rodriguez-Mias, R.,Yefidoff-Freedman, R.,Aktas, B.H.,Chorev, M.,Halperin, J.A.,Wagner, G. Structure of the eukaryotic translation initiation factor eIF4E in complex with 4EGI-1 reveals an allosteric mechanism for dissociating eIF4G. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4TQB 25049413 The co-complex structure of the translation initiation factor eIF4E with the inhibitor 4EGI-1 reveals an allosteric mechanism for dissociating eIF4G 2014-06-10 2014-08-13 Papadopoulos, E.,Jenni, S.,Kabha, E.,Takrouri, K.J.,Yi, T.,Salvi, N.,Luna, R.E.,Gavathiotis, E.,Mahalingam, P.,Arthanari, H.,Rodriguez-Mias, R.,Yefidoff-Freedman, R.,Aktas, B.H.,Chorev, M.,Halperin, J.A.,Wagner, G. Structure of the eukaryotic translation initiation factor eIF4E in complex with 4EGI-1 reveals an allosteric mechanism for dissociating eIF4G. Proc.Natl.Acad.Sci.USA 2014 111 0 0 1VY4 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the pre-attack state of peptide bond formation containing acylated tRNA-substrates in the A and P sites. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 1VY4 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the pre-attack state of peptide bond formation containing acylated tRNA-substrates in the A and P sites. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 1VY5 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the post-catalysis state of peptide bond formation containing dipeptydil-tRNA in the A site and deacylated tRNA in the P site. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 1VY5 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the post-catalysis state of peptide bond formation containing dipeptydil-tRNA in the A site and deacylated tRNA in the P site. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 1VY6 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the pre-attack state of peptide bond formation containing short substrate-mimic Cytidine-Puromycin in the A site and acylated tRNA in the P site. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 1VY6 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the pre-attack state of peptide bond formation containing short substrate-mimic Cytidine-Puromycin in the A site and acylated tRNA in the P site. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 1VY7 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the pre-attack state of peptide bond formation containing short substrate-mimic Cytidine-Cytidine-Puromycin in the A site and acylated tRNA in the P site. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 1VY7 25132179 Crystal structure of the Thermus thermophilus 70S ribosome in the pre-attack state of peptide bond formation containing short substrate-mimic Cytidine-Cytidine-Puromycin in the A site and acylated tRNA in the P site. 2014-05-13 2014-08-20 Polikanov, Y.S.,Steitz, T.A.,Innis, C.A. A proton wire to couple aminoacyl-tRNA accommodation and peptide-bond formation on the ribosome. Nat.Struct.Mol.Biol. 2014 21 787 793 4PKN 25136110 Crystal structure of the football-shaped GroEL-GroES2-(ADPBeFx)14 complex containing substrate Rubisco 2014-05-15 2014-08-20 Fei, X.,Ye, X.,LaRonde, N.A.,Lorimer, G.H. Formation and structures of GroEL:GroES2 chaperonin footballs, the protein-folding functional form. Proc.Natl.Acad.Sci.USA 2014 111 12775 12780 4QQX 25132177 Crystal structure of T. fusca Cas3-ATP 2014-06-30 2014-08-20 Huo, Y.,Nam, K.H.,Ding, F.,Lee, H.,Wu, L.,Xiao, Y.,Farchione, M.D.,Zhou, S.,Rajashankar, K.,Kurinov, I.,Zhang, R.,Ke, A. Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation. Nat.Struct.Mol.Biol. 2014 21 771 777 4N0S 25104643 Complex of ERK2 with caffeic acid 2013-10-02 2014-08-27 Yang, G.,Fu, Y.,Malakhova, M.,Kurinov, I.,Zhu, F.,Yao, K.,Li, H.,Chen, H.,Li, W.,Lim, D.Y.,Sheng, Y.,Bode, A.M.,Dong, Z.,Dong, Z. Caffeic Acid Directly Targets ERK1/2 to Attenuate Solar UV-Induced Skin Carcinogenesis. Cancer Prev Res (Phila) 2014 7 1056 1066 4PEF 25123664 Dbr1 in complex with sulfate 2014-04-23 2014-08-27 Montemayor, E.J.,Katolik, A.,Clark, N.E.,Taylor, A.B.,Schuermann, J.P.,Combs, D.J.,Johnsson, R.,Holloway, S.P.,Stevens, S.W.,Damha, M.J.,Hart, P.J. Structural basis of lariat RNA recognition by the intron debranching enzyme Dbr1. Nucleic Acids Res. 2014 42 10845 10855 4PEG 25123664 Dbr1 in complex with guanosine-5'-monophosphate 2014-04-23 2014-08-27 Montemayor, E.J.,Katolik, A.,Clark, N.E.,Taylor, A.B.,Schuermann, J.P.,Combs, D.J.,Johnsson, R.,Holloway, S.P.,Stevens, S.W.,Damha, M.J.,Hart, P.J. Structural basis of lariat RNA recognition by the intron debranching enzyme Dbr1. Nucleic Acids Res. 2014 42 10845 10855 4PEH 25123664 Dbr1 in complex with synthetic linear RNA 2014-04-23 2014-08-27 Montemayor, E.J.,Katolik, A.,Clark, N.E.,Taylor, A.B.,Schuermann, J.P.,Combs, D.J.,Johnsson, R.,Holloway, S.P.,Stevens, S.W.,Damha, M.J.,Hart, P.J. Structural basis of lariat RNA recognition by the intron debranching enzyme Dbr1. Nucleic Acids Res. 2014 42 10845 10855 4PEI 25123664 Dbr1 in complex with synthetic branched RNA analog 2014-04-23 2014-08-27 Montemayor, E.J.,Katolik, A.,Clark, N.E.,Taylor, A.B.,Schuermann, J.P.,Combs, D.J.,Johnsson, R.,Holloway, S.P.,Stevens, S.W.,Damha, M.J.,Hart, P.J. Structural basis of lariat RNA recognition by the intron debranching enzyme Dbr1. Nucleic Acids Res. 2014 42 10845 10855 4QQW 25132177 Crystal structure of T. fusca Cas3 2014-06-30 2014-08-27 Huo, Y.,Nam, K.H.,Ding, F.,Lee, H.,Wu, L.,Xiao, Y.,Farchione, M.D.,Zhou, S.,Rajashankar, K.,Kurinov, I.,Zhang, R.,Ke, A. Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation. Nat.Struct.Mol.Biol. 2014 21 771 777 4QQY 25132177 Crystal structure of T. fusca Cas3-ADP 2014-06-30 2014-08-27 Huo, Y.,Nam, K.H.,Ding, F.,Lee, H.,Wu, L.,Xiao, Y.,Farchione, M.D.,Zhou, S.,Rajashankar, K.,Kurinov, I.,Zhang, R.,Ke, A. Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation. Nat.Struct.Mol.Biol. 2014 21 771 777 4QQZ 25132177 Crystal structure of T. fusca Cas3-AMPPNP 2014-06-30 2014-08-27 Huo, Y.,Nam, K.H.,Ding, F.,Lee, H.,Wu, L.,Xiao, Y.,Farchione, M.D.,Zhou, S.,Rajashankar, K.,Kurinov, I.,Zhang, R.,Ke, A. Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation. Nat.Struct.Mol.Biol. 2014 21 771 777 4TU3 25113029 Crystal structure of yeast Sac1/Vps74 complex 2014-06-23 2014-08-27 Cai, Y.,Deng, Y.,Horenkamp, F.,Reinisch, K.M.,Burd, C.G. Sac1-Vps74 structure reveals a mechanism to terminate phosphoinositide signaling in the Golgi apparatus. J.Cell Biol. 2014 206 485 491 4UNT 25138218 Induced monomer of the Mcg variable domain 2014-05-30 2014-08-27 Brumshtein, B.,Esswein, S.R.,Landau, M.,Ryan, C.M.,Whitelegge, J.P.,Phillips, M.L.,Cascio, D.,Sawaya, M.R.,Eisenberg, D.S. Formation of Amyloid Fibers by Monomeric Light-Chain Variable Domains. J.Biol.Chem. 2014 289 27513 0 4UNU 25138218 MCG - a dimer of lambda variable domains 2014-05-30 2014-08-27 Brumshtein, B.,Esswein, S.R.,Landau, M.,Ryan, C.M.,Whitelegge, J.P.,Phillips, M.L.,Cascio, D.,Sawaya, M.R.,Eisenberg, D.S. Formation of Amyloid Fibers by Monomeric Light-Chain Variable Domains. J.Biol.Chem. 2014 289 27513 0 4K8O 25377891 CRYSTAL STRUCTURE OF THE ATPASE DOMAIN OF TAP1 WITH ATP (D645N, D651A MUTANT) 2013-04-18 2014-09-03 Grossmann, N.,Vakkasoglu, A.S.,Hulpke, S.,Abele, R.,Gaudet, R.,Tampe, R. Mechanistic determinants of the directionality and energetics of active export by a heterodimeric ABC transporter. Nat Commun 2014 5 5419 5419 4PL3 25164867 Crystal structure of murine IRE1 in complex with MKC9989 inhibitor 2014-05-16 2014-09-03 Sanches, M.,Duffy, N.M.,Talukdar, M.,Thevakumaran, N.,Chiovitti, D.,Canny, M.D.,Lee, K.,Kurinov, I.,Uehling, D.,Al-Awar, R.,Poda, G.,Prakesch, M.,Wilson, B.,Tam, V.,Schweitzer, C.,Toro, A.,Lucas, J.L.,Vuga, D.,Lehmann, L.,Durocher, D.,Zeng, Q.,Patterson, J.B.,Sicheri, F. Structure and mechanism of action of the hydroxy-aryl-aldehyde class of IRE1 endoribonuclease inhibitors. Nat Commun 2014 5 4202 4202 4PL4 25164867 Crystal structure of murine IRE1 in complex with OICR464 inhibitor 2014-05-16 2014-09-03 Sanches, M.,Duffy, N.M.,Talukdar, M.,Thevakumaran, N.,Chiovitti, D.,Canny, M.D.,Lee, K.,Kurinov, I.,Uehling, D.,Al-Awar, R.,Poda, G.,Prakesch, M.,Wilson, B.,Tam, V.,Schweitzer, C.,Toro, A.,Lucas, J.L.,Vuga, D.,Lehmann, L.,Durocher, D.,Zeng, Q.,Patterson, J.B.,Sicheri, F. Structure and mechanism of action of the hydroxy-aryl-aldehyde class of IRE1 endoribonuclease inhibitors. Nat Commun 2014 5 4202 4202 4QJD 25157168 Crystal Structure of Twister with the Nucleotide 5'- to the Cleavage Site Disordered at 3.1 A Resolution 2014-06-03 2014-09-03 Eiler, D.,Wang, J.,Steitz, T.A. Structural basis for the fast self-cleavage reaction catalyzed by the twister ribozyme. Proc.Natl.Acad.Sci.USA 2014 111 13028 13033 4QJH 25157168 Crystal Structure of the Twister Ribozyme with the Nucleotide 5'- to the Cleavage Site Ordered at 4.1 A Resolution 2014-06-03 2014-09-03 Eiler, D.,Wang, J.,Steitz, T.A. Structural basis for the fast self-cleavage reaction catalyzed by the twister ribozyme. Proc.Natl.Acad.Sci.USA 2014 111 13028 13033 4QJH 25157168 Crystal Structure of the Twister Ribozyme with the Nucleotide 5'- to the Cleavage Site Ordered at 4.1 A Resolution 2014-06-03 2014-09-03 Eiler, D.,Wang, J.,Steitz, T.A. Structural basis for the fast self-cleavage reaction catalyzed by the twister ribozyme. Proc.Natl.Acad.Sci.USA 2014 111 13028 13033 4QJH 25157168 Crystal Structure of the Twister Ribozyme with the Nucleotide 5'- to the Cleavage Site Ordered at 4.1 A Resolution 2014-06-03 2014-09-03 Eiler, D.,Wang, J.,Steitz, T.A. Structural basis for the fast self-cleavage reaction catalyzed by the twister ribozyme. Proc.Natl.Acad.Sci.USA 2014 111 13028 13033 4TVS 25149450 LAP1(aa356-583), H.sapiens, bound to VHH-BS1 2014-06-27 2014-09-03 Sosa, B.A.,Demircioglu, F.E.,Chen, J.Z.,Ingram, J.,Ploegh, H.L.,Schwartz, T.U. How lamina-associated polypeptide 1 (LAP1) activates Torsin. Elife 2014 3 0 0 4U3E 25157154 Anaerobic ribonucleotide reductase 2014-07-20 2014-09-03 Wei, Y.,Funk, M.A.,Rosado, L.A.,Baek, J.,Drennan, C.L.,Stubbe, J. The class III ribonucleotide reductase from Neisseria bacilliformis can utilize thioredoxin as a reductant. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4QND 25186729 Crystal structure of a SemiSWEET 2014-06-17 2014-09-10 Xu, Y.,Tao, Y.,Cheung, L.S.,Fan, C.,Chen, L.Q.,Xu, S.,Perry, K.,Frommer, W.B.,Feng, L. Structures of bacterial homologues of SWEET transporters in two distinct conformations. Nature 2014 515 448 452 4QXO 25199835 Crystal structure of hSTING(group2) in complex with DMXAA 2014-07-21 2014-09-10 Gao, P.,Zillinger, T.,Wang, W.,Ascano, M.,Dai, P.,Hartmann, G.,Tuschl, T.,Deng, L.,Barchet, W.,Patel, D.J. Binding-Pocket and Lid-Region Substitutions Render Human STING Sensitive to the Species-Specific Drug DMXAA. Cell Rep 2014 8 1668 1676 4QXP 25199835 Crystal structure of hSTING(G230I) in complex with DMXAA 2014-07-21 2014-09-10 Gao, P.,Zillinger, T.,Wang, W.,Ascano, M.,Dai, P.,Hartmann, G.,Tuschl, T.,Deng, L.,Barchet, W.,Patel, D.J. Binding-Pocket and Lid-Region Substitutions Render Human STING Sensitive to the Species-Specific Drug DMXAA. Cell Rep 2014 8 1668 1676 4QXQ 25199835 Crystal structure of hSTING(S162A/Q266I) in complex with DMXAA 2014-07-21 2014-09-10 Gao, P.,Zillinger, T.,Wang, W.,Ascano, M.,Dai, P.,Hartmann, G.,Tuschl, T.,Deng, L.,Barchet, W.,Patel, D.J. Binding-Pocket and Lid-Region Substitutions Render Human STING Sensitive to the Species-Specific Drug DMXAA. Cell Rep 2014 8 1668 1676 4QXR 25199835 Crystal structure of hSTING(S162A/G230I/Q266I) in complex with DMXAA 2014-07-21 2014-09-10 Gao, P.,Zillinger, T.,Wang, W.,Ascano, M.,Dai, P.,Hartmann, G.,Tuschl, T.,Deng, L.,Barchet, W.,Patel, D.J. Binding-Pocket and Lid-Region Substitutions Render Human STING Sensitive to the Species-Specific Drug DMXAA. Cell Rep 2014 8 1668 1676 4TZW 25185828 Co-crystals of the Ternary Complex Containing a T-box Stem I RNA, its Cognate tRNAGly, and B. subtilis YbxF protein, treated by removing lithium sulfate and replacing Mg2+ with Sr2+ post crystallization 2014-07-11 2014-09-10 Zhang, J.,Ferre-D'Amare, A.R. Dramatic Improvement of Crystals of Large RNAs by Cation Replacement and Dehydration. Structure 2014 22 1363 1371 4TZZ 25185828 Co-crystals of the Ternary Complex Containing a T-box Stem I RNA, its Cognate tRNAGly, and B. subtilis YbxF protein, treated by removing lithium sulfate and increasing PEG3350 concentration from 20% to 45% post crystallization 2014-07-11 2014-09-10 Zhang, J.,Ferre-D'Amare, A.R. Dramatic Improvement of Crystals of Large RNAs by Cation Replacement and Dehydration. Structure 2014 22 1363 1371 4TLX 25184411 Kutzneria sp. 744 ornithine N-hydroxylase, KtzI-FADred-NADP+-L-orn 2014-05-30 2014-09-17 Setser, J.W.,Heemstra, J.R.,Walsh, C.T.,Drennan, C.L. Crystallographic Evidence of Drastic Conformational Changes in the Active Site of a Flavin-Dependent N-Hydroxylase. Biochemistry 2014 53 6063 6077 4TLZ 25184411 Kutzneria sp. 744 ornithine N-hydroxylase, KtzI-FADox-NADP+-L-orn 2014-05-30 2014-09-17 Setser, J.W.,Heemstra, J.R.,Walsh, C.T.,Drennan, C.L. Crystallographic Evidence of Drastic Conformational Changes in the Active Site of a Flavin-Dependent N-Hydroxylase. Biochemistry 2014 53 6063 6077 4TM0 25184411 Kutzneria sp. 744 ornithine N-hydroxylase, KtzI-FADred-ox-NADP+-L-orn 2014-05-30 2014-09-17 Setser, J.W.,Heemstra, J.R.,Walsh, C.T.,Drennan, C.L. Crystallographic Evidence of Drastic Conformational Changes in the Active Site of a Flavin-Dependent N-Hydroxylase. Biochemistry 2014 53 6063 6077 4TM1 25184411 Kutzneria sp. 744 ornithine N-hydroxylase, KtzI-FADred-NADP+-Br 2014-05-30 2014-09-17 Setser, J.W.,Heemstra, J.R.,Walsh, C.T.,Drennan, C.L. Crystallographic Evidence of Drastic Conformational Changes in the Active Site of a Flavin-Dependent N-Hydroxylase. Biochemistry 2014 53 6063 6077 4TM3 25184411 Kutzneria sp. 744 ornithine N-hydroxylase, KtzI-FADox-Br 2014-05-30 2014-09-17 Setser, J.W.,Heemstra, J.R.,Walsh, C.T.,Drennan, C.L. Crystallographic Evidence of Drastic Conformational Changes in the Active Site of a Flavin-Dependent N-Hydroxylase. Biochemistry 2014 53 6063 6077 4TM4 25184411 Kutzneria sp. 744 ornithine N-hydroxylase, KtzI-FADox-red-NADP+-Br 2014-05-30 2014-09-17 Setser, J.W.,Heemstra, J.R.,Walsh, C.T.,Drennan, C.L. Crystallographic Evidence of Drastic Conformational Changes in the Active Site of a Flavin-Dependent N-Hydroxylase. Biochemistry 2014 53 6063 6077 4O59 25176140 Co-enzyme Induced Conformational Changes in Bovine Eye Glyceraldehyde 3-Phosphate Dehydrogenase 2013-12-19 2014-09-24 Baker, B.Y.,Shi, W.,Wang, B.,Palczewski, K. High-resolution crystal structures of the photoreceptor glyceraldehyde 3-phosphate dehydrogenase (GAPDH) with three and four-bound NAD molecules. Protein Sci. 2014 23 1629 1639 4O63 25176140 Co-enzyme Induced Conformational Changes in Bovine Eye Glyceraldehyde 3-Phosphate Dehydrogenase 2013-12-20 2014-09-24 Baker, B.Y.,Shi, W.,Wang, B.,Palczewski, K. High-resolution crystal structures of the photoreceptor glyceraldehyde 3-phosphate dehydrogenase (GAPDH) with three and four-bound NAD molecules. Protein Sci. 2014 23 1629 1639 4OCZ 25079952 Crystal structure of human soluble epoxide hydrolase complexed with 1-(1-isobutyrylpiperidin-4-yl)-3-(4-(trifluoromethyl)phenyl)urea 2014-01-09 2014-09-24 Lee, K.S.,Liu, J.Y.,Wagner, K.M.,Pakhomova, S.,Dong, H.,Morisseau, C.,Fu, S.H.,Yang, J.,Wang, P.,Ulu, A.,Mate, C.A.,Nguyen, L.V.,Hwang, S.H.,Edin, M.L.,Mara, A.A.,Wulff, H.,Newcomer, M.E.,Zeldin, D.C.,Hammock, B.D. Optimized inhibitors of soluble epoxide hydrolase improve in vitro target residence time and in vivo efficacy. J.Med.Chem. 2014 57 7016 7030 4P6F 25198768 Crystal structure of the peptolide 12C bound to bacterial ribosome 2014-03-24 2014-10-01 Washington, A.Z.,Benicewicz, D.B.,Canzoneri, J.C.,Fagan, C.E.,Mwakwari, S.C.,Maehigashi, T.,Dunham, C.M.,Oyelere, A.K. Macrolide-Peptide Conjugates as Probes of the Path of Travel of the Nascent Peptides through the Ribosome. Acs Chem.Biol. 2014 9 2621 2631 4R0D 25252982 Crystal structure of a eukaryotic group II intron lariat 2014-07-30 2014-10-01 Robart, A.R.,Chan, R.T.,Peters, J.K.,Rajashankar, K.R.,Toor, N. Crystal structure of a eukaryotic group II intron lariat. Nature 2014 514 193 197 4TNP 25267621 Structural basis of cellular dNTP regulation, SAMHD1-GTP-dCTP-cCTP complex 2014-06-04 2014-10-01 Ji, X.,Tang, C.,Zhao, Q.,Wang, W.,Xiong, Y. Structural basis of cellular dNTP regulation by SAMHD1. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4TNQ 25267621 Structural basis of cellular dNTP regulation, SAMHD1-GTP-dTTP-dTTP complex 2014-06-04 2014-10-01 Ji, X.,Tang, C.,Zhao, Q.,Wang, W.,Xiong, Y. Structural basis of cellular dNTP regulation by SAMHD1. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4TO0 25267621 Structure basis of cellular dNTP regulation, SAMHD1-GTP-dATP-dCTP complex 2014-06-05 2014-10-01 Ji, X.,Tang, C.,Zhao, Q.,Wang, W.,Xiong, Y. Structural basis of cellular dNTP regulation by SAMHD1. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4TO1 25267621 Structure basis of cellular dNTP regulation, SAMHD1-GTP-dATP/dCTP-dCTP complex 2014-06-05 2014-10-01 Ji, X.,Tang, C.,Zhao, Q.,Wang, W.,Xiong, Y. Structural basis of cellular dNTP regulation by SAMHD1. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4U0G 25267638 Crystal Structure of M. tuberculosis ClpP1P2 bound to ADEP and agonist 2014-07-11 2014-10-08 Schmitz, K.R.,Carney, D.W.,Sello, J.K.,Sauer, R.T. Crystal structure of Mycobacterium tuberculosis ClpP1P2 suggests a model for peptidase activation by AAA+ partner binding and substrate delivery. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4PDZ 25268459 Crystal Structure of Calcium-loaded S100B bound to SBi4172 2014-04-22 2014-10-15 Cavalier, M.C.,Pierce, A.D.,Wilder, P.T.,Alasady, M.J.,Hartman, K.G.,Neau, D.B.,Foley, T.L.,Jadhav, A.,Maloney, D.J.,Simeonov, A.,Toth, E.A.,Weber, D.J. Covalent Small Molecule Inhibitors of Ca(2+)-Bound S100B. Biochemistry 2014 53 6628 6640 4QX6 25286935 CRYSTAL STRUCTURE OF GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE FROM STREPTOCOCCUS AGALACTIAE NEM316 at 2.46 ANGSTROM RESOLUTION 2014-07-18 2014-10-15 Ayres, C.A.,Schormann, N.,Senkovich, O.,Fry, A.,Banerjee, S.,Ulett, G.C.,Chattopadhyay, D. Structure of Streptococcus agalactiae glyceraldehyde-3-phosphate dehydrogenase holoenzyme reveals a novel surface. Acta Crystallogr F Struct Biol 2014 70 1333 1339 4W2F 25306919 Crystal structure of the Thermus thermophilus 70S ribosome in complex with amicoumacin, mRNA and three deacylated tRNAs in the A, P and E sites 2014-09-12 2014-10-15 Polikanov, Y.S.,Osterman, I.A.,Szal, T.,Tashlitsky, V.N.,Serebryakova, M.V.,Kusochek, P.,Bulkley, D.,Malanicheva, I.A.,Efimenko, T.A.,Efremenkova, O.V.,Konevega, A.L.,Shaw, K.J.,Bogdanov, A.A.,Rodnina, M.V.,Dontsova, O.A.,Mankin, A.S.,Steitz, T.A.,Sergiev, P.V. Amicoumacin a inhibits translation by stabilizing mRNA interaction with the ribosome. Mol.Cell 2014 56 531 540 4W2F 25306919 Crystal structure of the Thermus thermophilus 70S ribosome in complex with amicoumacin, mRNA and three deacylated tRNAs in the A, P and E sites 2014-09-12 2014-10-15 Polikanov, Y.S.,Osterman, I.A.,Szal, T.,Tashlitsky, V.N.,Serebryakova, M.V.,Kusochek, P.,Bulkley, D.,Malanicheva, I.A.,Efimenko, T.A.,Efremenkova, O.V.,Konevega, A.L.,Shaw, K.J.,Bogdanov, A.A.,Rodnina, M.V.,Dontsova, O.A.,Mankin, A.S.,Steitz, T.A.,Sergiev, P.V. Amicoumacin a inhibits translation by stabilizing mRNA interaction with the ribosome. Mol.Cell 2014 56 531 540 4W2G 25306919 Crystal structure of the Thermus thermophilus 70S ribosome in complex with pactamycin (soaked), mRNA and three deacylated tRNAs in the A, P and E sites 2014-09-12 2014-10-15 Polikanov, Y.S.,Osterman, I.A.,Szal, T.,Tashlitsky, V.N.,Serebryakova, M.V.,Kusochek, P.,Bulkley, D.,Malanicheva, I.A.,Efimenko, T.A.,Efremenkova, O.V.,Konevega, A.L.,Shaw, K.J.,Bogdanov, A.A.,Rodnina, M.V.,Dontsova, O.A.,Mankin, A.S.,Steitz, T.A.,Sergiev, P.V. Amicoumacin a inhibits translation by stabilizing mRNA interaction with the ribosome. Mol.Cell 2014 56 531 540 4W2G 25306919 Crystal structure of the Thermus thermophilus 70S ribosome in complex with pactamycin (soaked), mRNA and three deacylated tRNAs in the A, P and E sites 2014-09-12 2014-10-15 Polikanov, Y.S.,Osterman, I.A.,Szal, T.,Tashlitsky, V.N.,Serebryakova, M.V.,Kusochek, P.,Bulkley, D.,Malanicheva, I.A.,Efimenko, T.A.,Efremenkova, O.V.,Konevega, A.L.,Shaw, K.J.,Bogdanov, A.A.,Rodnina, M.V.,Dontsova, O.A.,Mankin, A.S.,Steitz, T.A.,Sergiev, P.V. Amicoumacin a inhibits translation by stabilizing mRNA interaction with the ribosome. Mol.Cell 2014 56 531 540 4W2H 25306919 Crystal structure of the Thermus thermophilus 70S ribosome in complex with pactamycin (co-crystallized), mRNA and deacylated tRNA in the P site 2014-09-12 2014-10-15 Polikanov, Y.S.,Osterman, I.A.,Szal, T.,Tashlitsky, V.N.,Serebryakova, M.V.,Kusochek, P.,Bulkley, D.,Malanicheva, I.A.,Efimenko, T.A.,Efremenkova, O.V.,Konevega, A.L.,Shaw, K.J.,Bogdanov, A.A.,Rodnina, M.V.,Dontsova, O.A.,Mankin, A.S.,Steitz, T.A.,Sergiev, P.V. Amicoumacin a inhibits translation by stabilizing mRNA interaction with the ribosome. Mol.Cell 2014 56 531 540 4W2H 25306919 Crystal structure of the Thermus thermophilus 70S ribosome in complex with pactamycin (co-crystallized), mRNA and deacylated tRNA in the P site 2014-09-12 2014-10-15 Polikanov, Y.S.,Osterman, I.A.,Szal, T.,Tashlitsky, V.N.,Serebryakova, M.V.,Kusochek, P.,Bulkley, D.,Malanicheva, I.A.,Efimenko, T.A.,Efremenkova, O.V.,Konevega, A.L.,Shaw, K.J.,Bogdanov, A.A.,Rodnina, M.V.,Dontsova, O.A.,Mankin, A.S.,Steitz, T.A.,Sergiev, P.V. Amicoumacin a inhibits translation by stabilizing mRNA interaction with the ribosome. Mol.Cell 2014 56 531 540 4W2I 25306922 Crystal structure of the Thermus thermophilus 70S ribosome in complex with negamycin, mRNA and three deacylated tRNAs in the A, P and E sites 2014-09-12 2014-10-15 Polikanov, Y.S.,Szal, T.,Jiang, F.,Gupta, P.,Matsuda, R.,Shiozuka, M.,Steitz, T.A.,Vazquez-Laslop, N.,Mankin, A.S. Negamycin Interferes with Decoding and Translocation by Simultaneous Interaction with rRNA and tRNA. Mol.Cell 2014 56 541 550 4MYP 25315777 Structure of the central NEAT domain, N2, of the listerial Hbp2 protein complexed with heme 2013-09-27 2014-10-22 Malmirchegini, G.R.,Sjodt, M.,Shnitkind, S.,Sawaya, M.R.,Rosinski, J.,Newton, S.M.,Klebba, P.E.,Clubb, R.T. Novel Mechanism of Hemin Capture by Hbp2, the Hemoglobin-binding Hemophore from Listeria monocytogenes. J.Biol.Chem. 2014 289 34886 34899 4NLA 25315777 Structure of the central NEAT domain, N2, of the listerial Hbp2 protein, apo form 2013-11-14 2014-10-22 Malmirchegini, G.R.,Sjodt, M.,Shnitkind, S.,Sawaya, M.R.,Rosinski, J.,Newton, S.M.,Klebba, P.E.,Clubb, R.T. Novel Mechanism of Hemin Capture by Hbp2, the Hemoglobin-binding Hemophore from Listeria monocytogenes. J.Biol.Chem. 2014 289 34886 34899 4QAK Crystal structure of phosphoesterase 2014-05-05 2014-10-22 Remus, B.S.,Shuman, S. Structure of phosphoesterase To be Published 0 0 0 0 4TVW 25313043 Resorufin ligase with bound resorufin-AMP analog 2014-06-28 2014-10-22 Liu, D.S.,Nivon, L.G.,Richter, F.,Goldman, P.J.,Deerinck, T.J.,Yao, J.Z.,Richardson, D.,Phipps, W.S.,Ye, A.Z.,Ellisman, M.H.,Drennan, C.L.,Baker, D.,Ting, A.Y. Computational design of a red fluorophore ligase for site-specific protein labeling in living cells. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4TVY 25313043 Apo resorufin ligase 2014-06-28 2014-10-22 Liu, D.S.,Nivon, L.G.,Richter, F.,Goldman, P.J.,Deerinck, T.J.,Yao, J.Z.,Richardson, D.,Phipps, W.S.,Ye, A.Z.,Ellisman, M.H.,Drennan, C.L.,Baker, D.,Ting, A.Y. Computational design of a red fluorophore ligase for site-specific protein labeling in living cells. Proc.Natl.Acad.Sci.USA 2014 111 0 0 4U6I 25484204 Crystal Structure of the EutL Microcompartment Shell Protein from Clostridium Perfringens Bound to Vitamin B12 2014-07-29 2014-10-22 Thompson, M.C.,Crowley, C.S.,Kopstein, J.,Bobik, T.A.,Yeates, T.O. Structure of a bacterial microcompartment shell protein bound to a cobalamin cofactor. Acta Crystallogr.,Sect.F 2014 70 1584 1590 4Q95 25383759 Crystal structure of HRASLS3/LRAT chimeric protein 2014-04-29 2014-10-29 Golczak, M.,Sears, A.E.,Kiser, P.D.,Palczewski, K. LRAT-specific domain facilitates vitamin A metabolism by domain swapping in HRASLS3. Nat.Chem.Biol. 2015 11 26 32 4R2Y 25306923 Crystal structure of APC11 RING domain 2014-08-13 2014-10-29 Brown, N.G.,Watson, E.R.,Weissmann, F.,Jarvis, M.A.,VanderLinden, R.,Grace, C.R.,Frye, J.J.,Qiao, R.,Dube, P.,Petzold, G.,Cho, S.E.,Alsharif, O.,Bao, J.,Davidson, I.F.,Zheng, J.J.,Nourse, A.,Kurinov, I.,Peters, J.M.,Stark, H.,Schulman, B.A. Mechanism of Polyubiquitination by Human Anaphase-Promoting Complex: RING Repurposing for Ubiquitin Chain Assembly. Mol.Cell 2014 56 246 260 4W7S 25303995 Crystal structure of the yeast DEAD-box splicing factor Prp28 at 2.54 Angstroms resolution 2014-08-22 2014-10-29 Jacewicz, A.,Schwer, B.,Smith, P.,Shuman, S. Crystal structure, mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28. Nucleic Acids Res. 2014 42 12885 12898 4QWN 25128496 Histone demethylase KDM2A-H3K36ME1-alpha-KG complex structure 2014-07-16 2014-11-05 Cheng, Z.,Cheung, P.,Kuo, A.J.,Yukl, E.T.,Wilmot, C.M.,Gozani, O.,Patel, D.J. A molecular threading mechanism underlies Jumonji lysine demethylase KDM2A regulation of methylated H3K36. Genes Dev. 2014 28 1758 1771 4QX7 25128496 Crystal structure of histone demethylase kdm2a-h3k36me2 with alpha-kg 2014-07-18 2014-11-05 Cheng, Z.,Cheung, P.,Kuo, A.J.,Yukl, E.T.,Wilmot, C.M.,Gozani, O.,Patel, D.J. A molecular threading mechanism underlies Jumonji lysine demethylase KDM2A regulation of methylated H3K36. Genes Dev. 2014 28 1758 1771 4QX8 25128496 Crystal structure of histone demethylase kdm2a-h3k36me3 complex with alpha-kg 2014-07-19 2014-11-05 Cheng, Z.,Cheung, P.,Kuo, A.J.,Yukl, E.T.,Wilmot, C.M.,Gozani, O.,Patel, D.J. A molecular threading mechanism underlies Jumonji lysine demethylase KDM2A regulation of methylated H3K36. Genes Dev. 2014 28 1758 1771 4QXB 25128496 crystal structure of histone demethylase KDM2A-H3K36ME3 with NOG 2014-07-19 2014-11-05 Cheng, Z.,Cheung, P.,Kuo, A.J.,Yukl, E.T.,Wilmot, C.M.,Gozani, O.,Patel, D.J. A molecular threading mechanism underlies Jumonji lysine demethylase KDM2A regulation of methylated H3K36. Genes Dev. 2014 28 1758 1771 4QXC 25128496 Crystal structure of histone demethylase KDM2A-H3K36ME2 with NOG 2014-07-19 2014-11-05 Cheng, Z.,Cheung, P.,Kuo, A.J.,Yukl, E.T.,Wilmot, C.M.,Gozani, O.,Patel, D.J. A molecular threading mechanism underlies Jumonji lysine demethylase KDM2A regulation of methylated H3K36. Genes Dev. 2014 28 1758 1771 4QXH 25128496 Crystal structure of histone demethylase KDM2A-H3K36ME1 with NOG 2014-07-20 2014-11-05 Cheng, Z.,Cheung, P.,Kuo, A.J.,Yukl, E.T.,Wilmot, C.M.,Gozani, O.,Patel, D.J. A molecular threading mechanism underlies Jumonji lysine demethylase KDM2A regulation of methylated H3K36. Genes Dev. 2014 28 1758 1771 4RC1 25372812 Structure of the methanofuran/methanopterin biosynthetic enzyme MJ1099 from Methanocaldococcus jannaschii with PRPP 2014-09-14 2014-11-12 Bobik, T.A.,Morales, E.J.,Shin, A.,Cascio, D.,Sawaya, M.R.,Arbing, M.,Yeates, T.O.,Rasche, M.E. Structure of the methanofuran/methanopterin-biosynthetic enzyme MJ1099 from Methanocaldococcus jannaschii. Acta Crystallogr F Struct Biol 2014 70 1472 1479 4TQD 25385624 Crystal Structure of the C-terminal domain of IFRS bound with 3-iodo-L-Phe and ATP 2014-06-11 2014-11-12 Guo, L.T.,Wang, Y.S.,Nakamura, A.,Eiler, D.,Kavran, J.M.,Wong, M.,Kiessling, L.L.,Steitz, T.A.,O'Donoghue, P.,Soll, D. Polyspecific pyrrolysyl-tRNA synthetases from directed evolution. Proc.Natl.Acad.Sci.USA 2014 111 16724 16729 4TQF 25385624 Crystal Structure of the C-terminal domain of IFRS bound with 2-(5-bromothienyl)-L-Ala and ATP 2014-06-11 2014-11-12 Guo, L.T.,Wang, Y.S.,Nakamura, A.,Eiler, D.,Kavran, J.M.,Wong, M.,Kiessling, L.L.,Steitz, T.A.,O'Donoghue, P.,Soll, D. Polyspecific pyrrolysyl-tRNA synthetases from directed evolution. Proc.Natl.Acad.Sci.USA 2014 111 16724 16729 4U9P 25372812 Structure of the methanofuran/methanopterin biosynthetic enzyme MJ1099 from Methanocaldococcus jannaschii 2014-08-06 2014-11-12 Bobik, T.A.,Morales, E.J.,Shin, A.,Cascio, D.,Sawaya, M.R.,Arbing, M.,Yeates, T.O.,Rasche, M.E. Structure of the methanofuran/methanopterin-biosynthetic enzyme MJ1099 from Methanocaldococcus jannaschii. Acta Crystallogr.,Sect.F 2014 70 1472 1479 4Q5V 25429975 Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and aphidicolin 2014-04-17 2014-11-26 Baranovskiy, A.G.,Babayeva, N.D.,Suwa, Y.,Gu, J.,Pavlov, Y.I.,Tahirov, T.H. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 2014 42 14013 14021 4RGE 25410397 Crystal structure of the in-line aligned env22 twister ribozyme 2014-09-30 2014-12-03 Ren, A.,Kosutic, M.,Rajashankar, K.R.,Frener, M.,Santner, T.,Westhof, E.,Micura, R.,Patel, D.J. In-line alignment and Mg(2+) coordination at the cleavage site of the env22 twister ribozyme. Nat Commun 2014 5 5534 5534 4RGF 25410397 Crystal structure of the in-line aligned env22 twister ribozyme soaked with Mn2+ 2014-09-30 2014-12-03 Ren, A.,Kosutic, M.,Rajashankar, K.R.,Frener, M.,Santner, T.,Westhof, E.,Micura, R.,Patel, D.J. In-line alignment and Mg(2+) coordination at the cleavage site of the env22 twister ribozyme. Nat Commun 2014 5 5534 5534 4RI8 25430771 FAN1 Nuclease bound to 5' phosphorylated p(dG)/3'(dT-dT-dT-dT) double flap DNA 2014-10-05 2014-12-03 Wang, R.,Persky, N.S.,Yoo, B.,Ouerfelli, O.,Smogorzewska, A.,Elledge, S.J.,Pavletich, N.P. DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science 2014 346 1127 1130 4RIB 25430771 FAN1 Nuclease bound to 5' phosphorylated p(dT) single flap DNA 2014-10-05 2014-12-03 Wang, R.,Persky, N.S.,Yoo, B.,Ouerfelli, O.,Smogorzewska, A.,Elledge, S.J.,Pavletich, N.P. DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science 2014 346 1127 1130 4RIC 25430771 FAN1 Nuclease bound to 5' hydroxyl (dT-dT) single flap DNA 2014-10-05 2014-12-03 Wang, R.,Persky, N.S.,Yoo, B.,Ouerfelli, O.,Smogorzewska, A.,Elledge, S.J.,Pavletich, N.P. DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science 2014 346 1127 1130 4RID 25430771 Human FAN1 nuclease 2014-10-05 2014-12-03 Wang, R.,Persky, N.S.,Yoo, B.,Ouerfelli, O.,Smogorzewska, A.,Elledge, S.J.,Pavletich, N.P. DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science 2014 346 1127 1130 4WFG 25471887 Human TRAAK K+ channel in a Tl+ bound conductive conformation 2014-09-15 2014-12-03 Brohawn, S.G.,Campbell, E.B.,MacKinnon, R. Physical mechanism for gating and mechanosensitivity of the human TRAAK K+ channel. Nature 2014 516 126 130 4WFH 25471887 Human TRAAK K+ channel in a Tl+ bound nonconductive conformation 2014-09-15 2014-12-03 Brohawn, S.G.,Campbell, E.B.,MacKinnon, R. Physical mechanism for gating and mechanosensitivity of the human TRAAK K+ channel. Nature 2014 516 126 130 4L19 25330343 Matrix metalloproteinase-13 complexed with selective inhibitor compound Q1 2013-06-02 2014-12-10 Spicer, T.P.,Jiang, J.,Taylor, A.B.,Choi, J.Y.,Hart, P.J.,Roush, W.R.,Fields, G.B.,Hodder, P.S.,Minond, D. Characterization of selective exosite-binding inhibitors of matrix metalloproteinase 13 that prevent articular cartilage degradation in vitro. J.Med.Chem. 2014 57 9598 9611 4RI9 25430771 FAN1 Nuclease bound to 5' phosphorylated p(dT)/3'(dT-dT-dT-dT-dT-dT-dT-dT) double flap DNA 2014-10-05 2014-12-10 Wang, R.,Persky, N.S.,Yoo, B.,Ouerfelli, O.,Smogorzewska, A.,Elledge, S.J.,Pavletich, N.P. DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science 2014 346 1127 1130 4RIA 25430771 FAN1 Nuclease bound to 5' phosphorylated nicked DNA 2014-10-05 2014-12-10 Wang, R.,Persky, N.S.,Yoo, B.,Ouerfelli, O.,Smogorzewska, A.,Elledge, S.J.,Pavletich, N.P. DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science 2014 346 1127 1130 4RKZ 25422158 Crystal Structure of Mevalonate-3-Kinase from Thermoplasma acidophilum (Mevalonate 3-Phosphate/ADP Bound) 2014-10-14 2014-12-10 Vinokur, J.M.,Korman, T.P.,Sawaya, M.R.,Collazo, M.,Cascio, D.,Bowie, J.U. Structural analysis of mevalonate-3-kinase provides insight into the mechanisms of isoprenoid pathway decarboxylases. Protein Sci. 2015 24 212 220 4WAI 25423369 Structural characterization of the late competence protein ComFB from Bacillus subtilis. 2014-08-29 2014-12-10 Sysoeva, T.A.,Bane, L.B.,Xiao, D.Y.,Bose, B.,Chilton, S.S.,Gaudet, R.,Burton, B.M. Structural characterization of the late competence protein ComFB from Bacillus subtilis. Biosci.Rep. 2015 35 0 0 4WYM 25518861 Structural basis of HIV-1 capsid recognition by CPSF6 2014-11-17 2014-12-17 Bhattacharya, A.,Alam, S.L.,Fricke, T.,Zadrozny, K.,Sedzicki, J.,Taylor, A.B.,Demeler, B.,Pornillos, O.,Ganser-Pornillos, B.K.,Diaz-Griffero, F.,Ivanov, D.N.,Yeager, M. Structural basis of HIV-1 capsid recognition by PF74 and CPSF6. Proc.Natl.Acad.Sci.USA 2014 111 18625 18630 4O32 25475729 Structure of a malarial protein 2013-12-17 2014-12-24 Peng, M.,Cascio, D.,Egea, P.F. Crystal structure and solution characterization of the thioredoxin-2 from Plasmodium falciparum, a constituent of an essential parasitic protein export complex. Biochem.Biophys.Res.Commun. 2015 456 403 409 4P6K 25525248 Crystal Structure of the Computationally Designed Transmembrane Metallotransporter with 4-bromophenylalanine in Lipidic Cubic Phase 2014-03-25 2014-12-24 Joh, N.H.,Wang, T.,Bhate, M.P.,Acharya, R.,Wu, Y.,Grabe, M.,Hong, M.,Grigoryan, G.,DeGrado, W.F. De novo design of a transmembrane Zn2+-transporting four-helix bundle. Science 2014 346 1520 1524 4RG6 25490258 Crystal structure of APC3-APC16 complex 2014-09-29 2014-12-24 Yamaguchi, M.,Yu, S.,Qiao, R.,Weissmann, F.,Miller, D.J.,VanderLinden, R.,Brown, N.G.,Frye, J.J.,Peters, J.M.,Schulman, B.A. Structure of an APC3-APC16 Complex: Insights into Assembly of the Anaphase-Promoting Complex/Cyclosome. J.Mol.Biol. 2015 427 1748 1764 4RG7 25490258 Crystal structure of APC3 2014-09-29 2014-12-24 Yamaguchi, M.,Yu, S.,Qiao, R.,Weissmann, F.,Miller, D.J.,VanderLinden, R.,Brown, N.G.,Frye, J.J.,Peters, J.M.,Schulman, B.A. Structure of an APC3-APC16 Complex: Insights into Assembly of the Anaphase-Promoting Complex/Cyclosome. J.Mol.Biol. 2015 427 1748 1764 4MV3 26020841 Crystal Structure of Biotin Carboxylase from Haemophilus influenzae in Complex with AMPPCP and Bicarbonate 2013-09-23 2015-01-14 Broussard, T.C.,Pakhomova, S.,Neau, D.B.,Bonnot, R.,Waldrop, G.L. Structural Analysis of Substrate, Reaction Intermediate, and Product Binding in Haemophilus influenzae Biotin Carboxylase. Biochemistry 2015 54 3860 3870 4MV4 26020841 Crystal Structure of Biotin Carboxylase from Haemophilus influenzae in Complex with AMPPCP and Mg2 2013-09-23 2015-01-14 Broussard, T.C.,Pakhomova, S.,Neau, D.B.,Bonnot, R.,Waldrop, G.L. Structural Analysis of Substrate, Reaction Intermediate, and Product Binding in Haemophilus influenzae Biotin Carboxylase. Biochemistry 2015 54 3860 3870 4MV6 26020841 Crystal Structure of Biotin Carboxylase from Haemophilus influenzae in Complex with Phosphonoacetamide 2013-09-23 2015-01-14 Broussard, T.C.,Pakhomova, S.,Neau, D.B.,Bonnot, R.,Waldrop, G.L. Structural Analysis of Substrate, Reaction Intermediate, and Product Binding in Haemophilus influenzae Biotin Carboxylase. Biochemistry 2015 54 3860 3870 4MV7 26020841 Crystal Structure of Biotin Carboxylase form Haemophilus influenzae in Complex with Phosphonoformate 2013-09-23 2015-01-14 Broussard, T.C.,Pakhomova, S.,Neau, D.B.,Bonnot, R.,Waldrop, G.L. Structural Analysis of Substrate, Reaction Intermediate, and Product Binding in Haemophilus influenzae Biotin Carboxylase. Biochemistry 2015 54 3860 3870 4MV8 26020841 Crystal Structure of Biotin Carboxylase from Haemophilus influenzae in Complex with AMPPCP and Phosphate 2013-09-23 2015-01-14 Broussard, T.C.,Pakhomova, S.,Neau, D.B.,Bonnot, R.,Waldrop, G.L. Structural Analysis of Substrate, Reaction Intermediate, and Product Binding in Haemophilus influenzae Biotin Carboxylase. Biochemistry 2015 54 3860 3870 4OT9 25349408 crystal structure of the C-terminal domain of p100/NF-kB2 2014-02-13 2015-01-14 Tao, Z.,Fusco, A.,Huang, D.B.,Gupta, K.,Young Kim, D.,Ware, C.F.,Van Duyne, G.D.,Ghosh, G. p100/I kappa B delta sequesters and inhibits NF-kappa B through kappaBsome formation. Proc.Natl.Acad.Sci.USA 2014 111 15946 15951 4PBD 25553844 Crystal structure of the N-terminal CS domain of human Shq1 2014-04-12 2015-01-14 Singh, M.,Wang, Z.,Cascio, D.,Feigon, J. Structure and Interactions of the CS Domain of Human H/ACA RNP Assembly Protein Shq1. J.Mol.Biol. 2015 427 807 823 4PCK 25553844 Crystal structure of the P22S mutant of N-terminal CS domain of human Shq1 2014-04-15 2015-01-14 Singh, M.,Wang, Z.,Cascio, D.,Feigon, J. Structure and Interactions of the CS Domain of Human H/ACA RNP Assembly Protein Shq1. J.Mol.Biol. 2015 427 807 823 4RR2 25550159 Crystal structure of human primase 2014-11-05 2015-01-21 Baranovskiy, A.G.,Zhang, Y.,Suwa, Y.,Babayeva, N.D.,Gu, J.,Pavlov, Y.I.,Tahirov, T.H. Crystal structure of the human primase. J.Biol.Chem. 2015 290 5635 5646 4WQF 25594181 Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G and fusidic acid in the post-translocational state 2014-10-21 2015-01-28 Lin, J.,Gagnon, M.G.,Bulkley, D.,Steitz, T.A. Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation. Cell 2015 160 219 227 4WQU 25594181 Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G trapped by the antibiotic dityromycin 2014-10-22 2015-01-28 Lin, J.,Gagnon, M.G.,Bulkley, D.,Steitz, T.A. Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation. Cell 2015 160 219 227 4NH0 25865481 Cytoplasmic domain of the Thermomonospora curvata Type VII Secretion ATPase EccC 2013-11-03 2015-02-11 Rosenberg, O.S.,Dovala, D.,Li, X.,Connolly, L.,Bendebury, A.,Finer-Moore, J.,Holton, J.,Cheng, Y.,Stroud, R.M.,Cox, J.S. Substrates Control Multimerization and Activation of the Multi-Domain ATPase Motor of Type VII Secretion. Cell(Cambridge,Mass.) 2015 161 501 512 4PWM 25632825 Crystal structure of Dickerson Drew Dodecamer with 5-carboxycytosine 2014-03-20 2015-02-11 Szulik, M.W.,Pallan, P.S.,Nocek, B.,Voehler, M.,Banerjee, S.,Brooks, S.,Joachimiak, A.,Egli, M.,Eichman, B.F.,Stone, M.P. Differential stabilities and sequence-dependent base pair opening dynamics of watson-crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine. Biochemistry 2015 54 1294 1305 4RUT 25648895 crystal structure of murine cyclooxygenase-2 with 13-methyl-arachidonic Acid 2014-11-21 2015-02-11 Kudalkar, S.N.,Nikas, S.P.,Kingsley, P.J.,Xu, S.,Galligan, J.J.,Rouzer, C.A.,Banerjee, S.,Ji, L.,Eno, M.R.,Makriyannis, A.,Marnett, L.J. 13-methylarachidonic Acid is a positive allosteric modulator of endocannabinoid oxygenation by cyclooxygenase. J.Biol.Chem. 2015 290 7897 7909 4WY4 25686604 Crystal structure of autophagic SNARE complex 2014-11-15 2015-02-11 Diao, J.,Liu, R.,Rong, Y.,Zhao, M.,Zhang, J.,Lai, Y.,Zhou, Q.,Wilz, L.M.,Li, J.,Vivona, S.,Pfuetzner, R.A.,Brunger, A.T.,Zhong, Q. ATG14 promotes membrane tethering and fusion of autophagosomes to endolysosomes. Nature 2015 520 563 566 4XC6 25675500 Isobutyryl-CoA mutase fused with bound adenosylcobalamin, GDP, and Mg (holo-IcmF/GDP) 2014-12-17 2015-02-11 Jost, M.,Cracan, V.,Hubbard, P.A.,Banerjee, R.,Drennan, C.L. Visualization of a radical B12 enzyme with its G-protein chaperone. Proc.Natl.Acad.Sci.USA 2015 112 2419 2424 4XC7 25675500 Isobutyryl-CoA mutase fused with bound butyryl-CoA and without cobalamin or GDP (apo-IcmF) 2014-12-17 2015-02-11 Jost, M.,Cracan, V.,Hubbard, P.A.,Banerjee, R.,Drennan, C.L. Visualization of a radical B12 enzyme with its G-protein chaperone. Proc.Natl.Acad.Sci.USA 2015 112 2419 2424 4XC8 25675500 Isobutyryl-CoA mutase fused with bound butyryl-CoA, GDP, and Mg and without cobalamin (apo-IcmF/GDP) 2014-12-17 2015-02-11 Jost, M.,Cracan, V.,Hubbard, P.A.,Banerjee, R.,Drennan, C.L. Visualization of a radical B12 enzyme with its G-protein chaperone. Proc.Natl.Acad.Sci.USA 2015 112 2419 2424 4QIF 25713376 Crystal Structure of PduA with edge mutation K26A and pore mutation S40H 2014-05-30 2015-02-18 Chowdhury, C.,Chun, S.,Pang, A.,Sawaya, M.R.,Sinha, S.,Yeates, T.O.,Bobik, T.A. Selective molecular transport through the protein shell of a bacterial microcompartment organelle. Proc.Natl.Acad.Sci.USA 2015 112 2990 2995 4QIG 25713376 Crystal Structure of PduA with edge mutation K26A and pore mutation S40C 2014-05-30 2015-02-18 Chowdhury, C.,Chun, S.,Pang, A.,Sawaya, M.R.,Sinha, S.,Yeates, T.O.,Bobik, T.A. Selective molecular transport through the protein shell of a bacterial microcompartment organelle. Proc.Natl.Acad.Sci.USA 2015 112 2990 2995 4RBT 25713376 PduA K26A S40L mutant, from Salmonella enterica serovar Typhimurium LT2 2014-09-12 2015-02-18 Chowdhury, C.,Chun, S.,Pang, A.,Sawaya, M.R.,Sinha, S.,Yeates, T.O.,Bobik, T.A. Selective molecular transport through the protein shell of a bacterial microcompartment organelle. Proc.Natl.Acad.Sci.USA 2015 112 2990 2995 4RBU 25713376 PduA K26A S40Q mutant, from Salmonella enterica serovar Typhimurium LT2 2014-09-13 2015-02-18 Chowdhury, C.,Chun, S.,Pang, A.,Sawaya, M.R.,Sinha, S.,Yeates, T.O.,Bobik, T.A. Selective molecular transport through the protein shell of a bacterial microcompartment organelle. Proc.Natl.Acad.Sci.USA 2015 112 2990 2995 4RBV 25713376 PduA K26A S40GSG mutant, from Salmonella enterica serovar Typhimurium LT2 2014-09-13 2015-02-18 Chowdhury, C.,Chun, S.,Pang, A.,Sawaya, M.R.,Sinha, S.,Yeates, T.O.,Bobik, T.A. Selective molecular transport through the protein shell of a bacterial microcompartment organelle. Proc.Natl.Acad.Sci.USA 2015 112 2990 2995 4W69 26278175 Crystal Structure of Full-Length Split GFP Mutant Q157C Disulfide Dimer, P 43 21 2 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6A 26278175 Crystal Structure of Full-Length Split GFP Mutant Q157C Disulfide Dimer, P 32 2 1 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6B 26278175 Crystal Structure of a Superfolder GFP Mutant K26C Disulfide Dimer, P 21 21 21 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6C 26278175 Crystal Structure of Full-Length Split GFP Mutant K26C Disulfide Dimer, P 21 21 21 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6D 26278175 Crystal Structure of Full-Length Split GFP Mutant K26C Disulfide Dimer, P 32 2 1 Space Group, Form 1 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6F 26278175 Crystal Structure of Full-Length Split GFP Mutant K26C Disulfide Dimer, P 32 2 1 Space Group, Form 2 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6G 26278175 Crystal Structure of Full-Length Split GFP Mutant D190C Disulfide Dimer, P 61 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6H 26278175 Crystal Structure of Full-Length Split GFP Mutant D190C Disulfide Dimer, P 65 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6I 26278175 Crystal Structure of Full-Length Split GFP Mutant D190C Disulfide Dimer, P 21 21 21 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6J 26278175 Crystal Structure of Full-Length Split GFP Mutant D117C Disulfide Dimer, P 31 2 1 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6K 26278175 Crystal Structure of Full-Length Split GFP Mutant D117C Disulfide Dimer, P 41 21 2 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6L 26278175 Crystal Structure of Full-Length Split GFP Mutant D117C Disulfide Dimer, I 41 2 2 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6M 26278175 Crystal Structure of Full-Length Split GFP Mutant D117C Disulfide Dimer, P 63 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6N 26278175 Crystal Structure of Full-Length Split GFP Mutant D117C Disulfide Dimer, C 1 2 1 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6O 26278175 Crystal Structure of Full-Length Split GFP Mutant D117C Disulfide Dimer, P 64 2 2 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6P 26278175 Crystal Structure of Full-Length Split GFP Mutant D102C Disulfide Dimer, P 21 21 21 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6R 26278175 Crystal Structure of Full-Length Split GFP Mutant D102C Disulfide Dimer, P 1 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6S 26278175 Crystal Structure of Full-Length Split GFP Mutant K126C Disulfide Dimer, P 43 21 2 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6T 26278175 Crystal Structure of Full-Length Split GFP Mutant E115H/T118H With Copper Mediated Crystal Contacts, P 43 21 2 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W6U 26278175 Crystal Structure of Full-Length Split GFP Mutant E115H/T118H With Nickel Mediated Crystal Contacts, P 21 21 21 Space Group 2014-08-20 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W72 26278175 Crystal Structure of Full-Length Split GFP Mutant E115C/T118H Disulfide Dimer With Copper Mediated Crystal Contacts, P 21 21 21, Form 1 2014-08-21 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W73 26278175 Crystal Structure of Full-Length Split GFP Mutant E115C/T118H Disulfide Dimer P 21 21 21 2014-08-21 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W74 26278175 Crystal Structure of Full-Length Split GFP Mutant E115C/T118H With Metal Mediated Crystal Contacts, P 1 21 1 Space Group 2014-08-21 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W76 26278175 Crystal Structure of Full-Length Split GFP Mutant D21H/K26C Disulfide and Metal-Mediated Dimer, P 21 21 21 Space Group, Form 2 2014-08-21 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W77 26278175 Crystal Structure of Full-Length Split GFP Mutant D21H/K26C Disulfide and Metal-Mediated Dimer, P 21 21 21 Space Group, Form 3 2014-08-21 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W7A 26278175 Crystal Structure of Full-Length Split GFP Mutant D21H/K26C Disulfide and Metal-Mediated Dimer, P 21 21 21 Space Group, Form 4 2014-08-21 2015-02-18 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W7E 26278175 Crystal Structure of Full-Length Split GFP Mutant E124H/K126H With Copper Mediated Crystal Contacts, P 41 21 2 Space Group 2014-08-21 2015-02-25 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W75 26278175 Crystal Structure of Full-Length Split GFP Mutant D21H/K26C Disulfide and Metal-Mediated Dimer, P 21 21 21 Space Group, Form 1 2014-08-21 2015-03-04 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W7C 26278175 Crystal Structure of Full-Length Split GFP Mutant D21H/K26C Disulfide and Metal-Mediated Dimer, C 2 Space Group 2014-08-21 2015-03-04 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W7R 26278175 Crystal Structure of Full-Length Split GFP Mutant E124H/K126H Copper Mediated Dimer, P 21 Space Group 2014-08-22 2015-03-04 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4XPZ 25883047 Structure of fission yeast RNA polymerase II CTD phosphatase Fcp1-R271A bound to aluminum fluoride 2015-01-18 2015-03-04 Schwer, B.,Ghosh, A.,Sanchez, A.M.,Lima, C.D.,Shuman, S. Genetic and structural analysis of the essential fission yeast RNA polymerase II CTD phosphatase Fcp1. Rna 2015 21 1135 1146 4XQ0 25883047 Structure of fission yeast RNA polymerase II CTD phosphatase Fcp1-R271A bound to beryllium fluoride 2015-01-18 2015-03-04 Schwer, B.,Ghosh, A.,Sanchez, A.M.,Lima, C.D.,Shuman, S. Genetic and structural analysis of the essential fission yeast RNA polymerase II CTD phosphatase Fcp1. Rna 2015 21 1135 1146 4YCG 25751889 Pro-bone morphogenetic protein 9 2015-02-20 2015-03-04 Mi, L.Z.,Brown, C.T.,Gao, Y.,Tian, Y.,Le, V.Q.,Walz, T.,Springer, T.A. Structure of bone morphogenetic protein 9 procomplex. Proc.Natl.Acad.Sci.USA 2015 112 3710 3715 4W7D 26278175 Crystal Structure of Full-Length Split GFP Mutant D21H/K26H With Copper Mediated Crystal Contacts, P 21 21 21 Space Group 2014-08-21 2015-03-11 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W7F 26278175 Crystal Structure of Full-Length Split GFP Mutant E124H/K126H With Copper Mediated Crystal Contacts, C 2 2 21 Space Group 2014-08-21 2015-03-11 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4W7X 26278175 Crystal Structure of Full-Length Split GFP Mutant E115C Disulfide Dimer, P 1 21 1 Space Group 2014-08-22 2015-03-11 Leibly, D.J.,Arbing, M.A.,Pashkov, I.,DeVore, N.,Waldo, G.S.,Terwilliger, T.C.,Yeates, T.O. A Suite of Engineered GFP Molecules for Oligomeric Scaffolding. Structure 2015 23 1754 1768 4TSE 25747658 Crystal Structure of the Mib Repeat Domain of Mind bomb 1 2014-06-18 2015-03-18 McMillan, B.J.,Schnute, B.,Ohlenhard, N.,Zimmerman, B.,Miles, L.,Beglova, N.,Klein, T.,Blacklow, S.C. A tail of two sites: a bipartite mechanism for recognition of notch ligands by mind bomb e3 ligases. Mol.Cell 2015 57 912 924 4XI6 25747658 Crystal structure of the MZM-REP domains of Mind bomb 1 2015-01-06 2015-03-18 McMillan, B.J.,Schnute, B.,Ohlenhard, N.,Zimmerman, B.,Miles, L.,Beglova, N.,Klein, T.,Blacklow, S.C. A tail of two sites: a bipartite mechanism for recognition of notch ligands by mind bomb e3 ligases. Mol.Cell 2015 57 912 924 4XTR 25745174 Structure of Get3 bound to the transmembrane domain of Pep12 2015-01-23 2015-03-18 Mateja, A.,Paduch, M.,Chang, H.Y.,Szydlowska, A.,Kossiakoff, A.A.,Hegde, R.S.,Keenan, R.J. Protein targeting. Structure of the Get3 targeting factor in complex with its membrane protein cargo. Science 2015 347 1152 1155 4XVU 25745174 Structure of Get3 bound to the transmembrane domain of Nyv1 2015-01-28 2015-03-18 Mateja, A.,Paduch, M.,Chang, H.Y.,Szydlowska, A.,Kossiakoff, A.A.,Hegde, R.S.,Keenan, R.J. Protein targeting. Structure of the Get3 targeting factor in complex with its membrane protein cargo. Science 2015 347 1152 1155 4Y4O 25775268 Crystal structure of the Thermus thermophilus 70S ribosome with rRNA modifications and bound to protein Y (YfiA) at 2.3A resolution 2015-02-10 2015-03-18 Polikanov, Y.S.,Melnikov, S.V.,Soll, D.,Steitz, T.A. Structural insights into the role of rRNA modifications in protein synthesis and ribosome assembly. Nat.Struct.Mol.Biol. 2015 22 342 344 4Y4P 25775268 Crystal structure of the Thermus thermophilus 70S ribosome with rRNA modifications and bound to mRNA and A-, P- and E-site tRNAs at 2.5A resolution 2015-02-10 2015-03-18 Polikanov, Y.S.,Melnikov, S.V.,Soll, D.,Steitz, T.A. Structural insights into the role of rRNA modifications in protein synthesis and ribosome assembly. Nat.Struct.Mol.Biol. 2015 22 342 344 4TM6 25752492 Crystal Structure of EutL from Clostridium Perfringens at 298K 2014-05-31 2015-03-25 Thompson, M.C.,Cascio, D.,Leibly, D.J.,Yeates, T.O. An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein. Protein Sci. 2015 24 956 975 4TME 25752492 Crystal Structure of EutL from Clostridium Perfringens bound to ethanolamine 2014-06-01 2015-03-25 Thompson, M.C.,Cascio, D.,Leibly, D.J.,Yeates, T.O. An allosteric model for control of pore opening by substrate binding in the EutL microcompartment shell protein. Protein Sci. 2015 24 956 975 4XWO 25745174 Structure of Get3 bound to the transmembrane domain of Sec22 2015-01-29 2015-03-25 Mateja, A.,Paduch, M.,Chang, H.Y.,Szydlowska, A.,Kossiakoff, A.A.,Hegde, R.S.,Keenan, R.J. Protein targeting. Structure of the Get3 targeting factor in complex with its membrane protein cargo. Science 2015 347 1152 1155 4YCZ 25822992 Y-COMPLEX HUB (NUP85-NUP120-NUP145C-SEC13 COMPLEX) FROM M. THERMOPHILA (A.K.A. T. HETEROTHALLICA) 2015-02-20 2015-04-01 Kelley, K.,Knockenhauer, K.E.,Kabachinski, G.,Schwartz, T.U. Atomic structure of the Y complex of the nuclear pore. Nat.Struct.Mol.Biol. 2015 22 425 431 4OTJ 27588346 The complex of murine cyclooxygenase-2 with a conjugate of indomefathin and podophyllotoxin, N-{(succinylpodophyllotoxinyl)but-4-yl}-2-{1-(4-chlorobenzoyl)-5-methoxy-2-methyl-1H-indol-3-yl}acetamide 2014-02-13 2015-04-08 Uddin, M.J.,Crews, B.C.,Xu, S.,Ghebreselasie, K.,Daniel, C.K.,Kingsley, P.J.,Banerjee, S.,Marnett, L.J. Antitumor Activity of Cytotoxic Cyclooxygenase-2 Inhibitors. Acs Chem.Biol. 2016 11 3052 3060 4R1I 25818299 Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps 2014-08-06 2015-04-08 Su, C.C.,Bolla, J.R.,Kumar, N.,Radhakrishnan, A.,Long, F.,Delmar, J.A.,Chou, T.H.,Rajashankar, K.R.,Shafer, W.M.,Yu, E.W. Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps. Cell Rep 2015 11 61 70 4S25 25813242 Crystal structure of Arabidopsis thaliana ThiC with bound imidazole ribonucleotide, S-adenosylhomocysteine, Fe4S4 cluster and Zn (trigonal crystal form) 2015-01-19 2015-04-08 Fenwick, M.K.,Mehta, A.P.,Zhang, Y.,Abdelwahed, S.H.,Begley, T.P.,Ealick, S.E. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase. Nat Commun 0 6 6480 6480 4S26 25813242 Crystal structure of Arabidopsis thaliana ThiC with bound imidazole ribonucleotide, S-adenosylhomocysteine, Fe4S4 cluster and Zn (monoclinic crystal form) 2015-01-19 2015-04-08 Fenwick, M.K.,Mehta, A.P.,Zhang, Y.,Abdelwahed, S.H.,Begley, T.P.,Ealick, S.E. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase. Nat Commun 0 6 6480 6480 4S27 25813242 Crystal structure of Arabidopsis thaliana ThiC with bound aminoimidazole ribonucleotide, 5'-deoxyadenosine, L-methionine, Fe4S4 cluster and Fe 2015-01-19 2015-04-08 Fenwick, M.K.,Mehta, A.P.,Zhang, Y.,Abdelwahed, S.H.,Begley, T.P.,Ealick, S.E. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase. Nat Commun 0 6 6480 6480 4S28 25813242 Crystal structure of Arabidopsis thaliana ThiC with bound aminoimidazole ribonucleotide, S-adenosylhomocysteine, Fe4S4 cluster and Fe 2015-01-19 2015-04-08 Fenwick, M.K.,Mehta, A.P.,Zhang, Y.,Abdelwahed, S.H.,Begley, T.P.,Ealick, S.E. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase. Nat Commun 0 6 6480 6480 4S29 25813242 Crystal structure of Arabidopsis thaliana ThiC with bound imidazole ribonucleotide and Fe 2015-01-19 2015-04-08 Fenwick, M.K.,Mehta, A.P.,Zhang, Y.,Abdelwahed, S.H.,Begley, T.P.,Ealick, S.E. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase. Nat Commun 0 6 6480 6480 4S2A 25813242 Crystal structure of Caulobacter crescentus ThiC with Fe4S4 cluster at remote site (holo form) 2015-01-19 2015-04-08 Fenwick, M.K.,Mehta, A.P.,Zhang, Y.,Abdelwahed, S.H.,Begley, T.P.,Ealick, S.E. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase. Nat Commun 0 6 6480 6480 4TLV 25848012 CARDS TOXIN, NICKED 2014-05-30 2015-04-08 Becker, A.,Kannan, T.R.,Taylor, A.B.,Pakhomova, O.N.,Zhang, Y.,Somarajan, S.R.,Galaleldeen, A.,Holloway, S.P.,Baseman, J.B.,Hart, P.J. Structure of CARDS toxin, a unique ADP-ribosylating and vacuolating cytotoxin from Mycoplasma pneumoniae. Proc.Natl.Acad.Sci.USA 2015 112 5165 5170 4Y1I 25794619 Lactococcus lactis yybP-ykoY Mn riboswitch bound to Mn2+ 2015-02-07 2015-04-08 Price, I.R.,Gaballa, A.,Ding, F.,Helmann, J.D.,Ke, A. Mn(2+)-Sensing Mechanisms of yybP-ykoY Orphan Riboswitches. Mol.Cell 2015 57 1110 1123 4Y1J 25794619 Lactococcus lactis yybP-ykoY Mn riboswitch A41U binding site mutant in presence of Mn2+ 2015-02-07 2015-04-08 Price, I.R.,Gaballa, A.,Ding, F.,Helmann, J.D.,Ke, A. Mn(2+)-Sensing Mechanisms of yybP-ykoY Orphan Riboswitches. Mol.Cell 2015 57 1110 1123 4Y1M 25794619 An Escherichia coli yybP-ykoY Mn riboswitch in the Mn2+-free state 2015-02-08 2015-04-08 Price, I.R.,Gaballa, A.,Ding, F.,Helmann, J.D.,Ke, A. Mn(2+)-Sensing Mechanisms of yybP-ykoY Orphan Riboswitches. Mol.Cell 2015 57 1110 1123 4YII Structure of an APC2-UBCH10 complex reveals distinctive cullin-RING ligase mechanism for Anaphase-promoting complex/Cyclosome 2015-03-02 2015-04-08 Brown, N.G.,Cho, S.E.,Schulman, B.A. Crystal Structure of E2 Complex Proc.Natl.Acad.Sci.USA 2015 0 0 0 4XJK 25597447 Crystal structure of Mn(II) Ca(II) Na(I) bound calprotectin 2015-01-08 2015-04-15 Gagnon, D.M.,Brophy, M.B.,Bowman, S.E.,Stich, T.A.,Drennan, C.L.,Britt, R.D.,Nolan, E.M. Manganese Binding Properties of Human Calprotectin under Conditions of High and Low Calcium: X-ray Crystallographic and Advanced Electron Paramagnetic Resonance Spectroscopic Analysis. J.Am.Chem.Soc. 2015 137 3004 3016 4YAZ 25818298 3',3'-cGAMP riboswitch bound with 3',3'-cGAMP 2015-02-18 2015-04-15 Ren, A.,Wang, X.C.,Kellenberger, C.A.,Rajashankar, K.R.,Jones, R.A.,Hammond, M.C.,Patel, D.J. Structural Basis for Molecular Discrimination by a 3',3'-cGAMP Sensing Riboswitch. Cell Rep 2015 11 1 12 4YB0 25818298 3',3'-cGAMP riboswitch bound with c-di-GMP 2015-02-18 2015-04-15 Ren, A.,Wang, X.C.,Kellenberger, C.A.,Rajashankar, K.R.,Jones, R.A.,Hammond, M.C.,Patel, D.J. Structural Basis for Molecular Discrimination by a 3',3'-cGAMP Sensing Riboswitch. Cell Rep 2015 11 1 12 4YB1 25818298 20A Mutant c-di-GMP Vc2 Riboswitch bound with 3',3'-cGAMP 2015-02-18 2015-04-15 Ren, A.,Wang, X.C.,Kellenberger, C.A.,Rajashankar, K.R.,Jones, R.A.,Hammond, M.C.,Patel, D.J. Structural Basis for Molecular Discrimination by a 3',3'-cGAMP Sensing Riboswitch. Cell Rep 2015 11 1 12 4YN0 25838500 Crystal structure of APP E2 domain in complex with DR6 CRD domain 2015-03-08 2015-04-15 Xu, K.,Olsen, O.,Tzvetkova-Robev, D.,Tessier-Lavigne, M.,Nikolov, D.B. The crystal structure of DR6 in complex with the amyloid precursor protein provides insight into death receptor activation. Genes Dev. 2015 29 785 790 4R0C 25892120 Crystal structure of the Alcanivorax borkumensis YdaH transporter reveals an unusual topology 2014-07-30 2015-04-29 Bolla, J.R.,Su, C.C.,Delmar, J.A.,Radhakrishnan, A.,Kumar, N.,Chou, T.H.,Long, F.,Rajashankar, K.R.,Yu, E.W. Crystal structure of the Alcanivorax borkumensis YdaH transporter reveals an unusual topology. Nat Commun 2015 6 6874 6874 4YQH 25863433 2-[2-(4-Phenyl-1H-imidazol-2-yl)ethyl]quinoxaline (Sunovion Compound 14) co-crystallized with PDE10A 2015-03-13 2015-04-29 Burdi, D.F.,Campbell, J.E.,Wang, J.,Zhao, S.,Zhong, H.,Wei, J.,Campbell, U.,Shao, L.,Herman, L.,Koch, P.,Jones, P.G.,Hewitt, M.C. Evolution and synthesis of novel orally bioavailable inhibitors of PDE10A. Bioorg.Med.Chem.Lett. 2015 25 1864 1868 4YS7 25863433 Co-crystal structure of 2-[2-(5,8-dimethyl[1,2,4]triazolo[1,5-a]pyrazin-2-yl)ethyl]-3-methyl-3H-imidazo[4,5-f]quinoline (compound 39) with PDE10A 2015-03-16 2015-04-29 Burdi, D.F.,Campbell, J.E.,Wang, J.,Zhao, S.,Zhong, H.,Wei, J.,Campbell, U.,Shao, L.,Herman, L.,Koch, P.,Jones, P.G.,Hewitt, M.C. Evolution and synthesis of novel orally bioavailable inhibitors of PDE10A. Bioorg.Med.Chem.Lett. 2015 25 1864 1868 4ZAR Crystal Structure of Proteinase K from Engyodontium albuminhibited by METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE at 1.15 A resolution 2015-04-14 2015-05-06 Sawaya, M.R.,Cascio, D.,Collazo, M.,Bond, C.,Cohen, A.,DeNicola, A.,Eden, K.,Jain, K.,Leung, C.,Lubock, N.,McCormick, J.,Rosinski, J.,Spiegelman, L.,Athar, Y.,Tibrewal, N.,Winter, J.,Solomon, S. Crystal Structure of Proteinase K from Engyodontium album inhibited by METHOXYSUCCINYL-ALA-ALA-PRO-PHE-CHLOROMETHYL KETONE at 1.15 A resolution to be published 0 0 0 0 4QC9 Crystal structure of Vaccinia virus uracil-DNA glycosylase mutant 3GD4 2014-05-09 2015-05-13 Sartmatova, D.,Nash, T.,Schormann, N.,Nuth, M.,Ricciardi, R.,Banerjee, S.,Chattopadhyay, D. Crystal structure of Vaccinia virus uracil-DNA glycosylase mutant 3GD4 To be Published 0 0 0 0 4QCA 23519808 Crystal structure of Vaccinia virus uracil-DNA glycosylase mutant R167AD4 2014-05-09 2015-05-13 Sartmatova, D.,Nash, T.,Schormann, N.,Nuth, M.,Ricciardi, R.,Banerjee, S.,Chattopadhyay, D. Crystallization and preliminary X-ray diffraction analysis of three recombinant mutants of Vaccinia virus uracil DNA glycosylase. Acta Crystallogr.,Sect.F 2013 69 295 301 4TUA 25352689 Crystal structure of ASL-Thr bound to Codon ACC-A on the Ribosome 2014-06-24 2015-05-13 Fagan, C.E.,Maehigashi, T.,Dunkle, J.A.,Miles, S.J.,Dunham, C.M. Structural insights into translational recoding by frameshift suppressor tRNASufJ. Rna 2014 20 1944 1954 4TUB 25352689 Crystal structure of tRNA-Thr bound to Codon ACC-C on the Ribosome 2014-06-24 2015-05-13 Fagan, C.E.,Maehigashi, T.,Dunkle, J.A.,Miles, S.J.,Dunham, C.M. Structural insights into translational recoding by frameshift suppressor tRNASufJ. Rna 2014 20 1944 1954 4XNU 25961798 X-ray structure of Drosophila dopamine transporter in complex with nisoxetine 2015-01-16 2015-05-13 Penmatsa, A.,Wang, K.H.,Gouaux, E. X-ray structures of Drosophila dopamine transporter in complex with nisoxetine and reboxetine. Nat.Struct.Mol.Biol. 2015 22 506 508 4XNX 25961798 X-ray structure of Drosophila dopamine transporter in complex with reboxetine 2015-01-16 2015-05-13 Penmatsa, A.,Wang, K.H.,Gouaux, E. X-ray structures of Drosophila dopamine transporter in complex with nisoxetine and reboxetine. Nat.Struct.Mol.Biol. 2015 22 506 508 4XYN 25945582 X-ray structure of Ca(2+)-S100B with human RAGE-derived W61 peptide 2015-02-02 2015-05-13 Jensen, J.L.,Indurthi, V.S.,Neau, D.B.,Vetter, S.W.,Colbert, C.L. Structural insights into the binding of the human receptor for advanced glycation end products (RAGE) by S100B, as revealed by an S100B-RAGE-derived peptide complex. Acta Crystallogr.,Sect.D 2015 71 1176 1183 4ZJM Crystal Structure of Mycobacterium tuberculosis LpqH (Rv3763) 2015-04-29 2015-05-13 Arbing, M.A.,Chan, S.,Kuo, E.,Harris, L.R.,Zhou, T.T.,Eisenberg, D. Crystal Structure of Mycobacterium tuberculosis LpqH (Rv3763) To Be Published 0 0 0 0 4D0G 26032412 Structure of Rab14 in complex with Rab-Coupling Protein (RCP) 2014-04-25 2015-05-20 Lall, P.,Lindsay, A.J.,Hanscom, S.,Kecman, T.,Taglauer, E.S.,Mcveigh, U.M.,Franklin, E.,Mccaffrey, M.W.,Khan, A.R. Structure-Function Analyses of the Interactions between Rab11 and Rab14 Small Gtpases with Their Shared Effector Rab Coupling Protein (Rcp). J.Biol.Chem. 2015 290 18817 0 4QES Structure of a 16 nm protein cage designed by fusing symmetric oligomeric domains, quadruple mutant, I222 form 2014-05-18 2015-05-20 Lai, Y.-T.,Yeates, T.O. Structural transition of a protein nanocage as a function of pH and salt concentration. To be Published 0 0 0 0 4QF0 Structure of a 16 nm protein cage designed by fusing symmetric oligomeric domains, quadruple mutant, P21212 form 2014-05-19 2015-05-20 Lai, Y.-T.,Yeates, T.O. Structural transition of a protein nanocage as a function of pH and salt concentration. To be Published 0 0 0 0 4Z8C 25984972 Crystal structure of the Thermus thermophilus 70S ribosome bound to translation inhibitor oncocin 2015-04-08 2015-05-20 Roy, R.N.,Lomakin, I.B.,Gagnon, M.G.,Steitz, T.A. The mechanism of inhibition of protein synthesis by the proline-rich peptide oncocin. Nat.Struct.Mol.Biol. 2015 22 466 469 4RYX 26075817 Crystal structure of RPE65 in complex with emixustat and palmitate, P6522 crystal form 2014-12-17 2015-05-27 Zhang, J.,Kiser, P.D.,Badiee, M.,Palczewska, G.,Dong, Z.,Golczak, M.,Tochtrop, G.P.,Palczewski, K. Molecular pharmacodynamics of emixustat in protection against retinal degeneration. J.Clin.Invest. 2015 125 2781 2794 4RYZ 26075817 Crystal structure of RPE65 in complex with S-emixustat and palmitate 2014-12-17 2015-05-27 Zhang, J.,Kiser, P.D.,Badiee, M.,Palczewska, G.,Dong, Z.,Golczak, M.,Tochtrop, G.P.,Palczewski, K. Molecular pharmacodynamics of emixustat in protection against retinal degeneration. J.Clin.Invest. 2015 125 2781 2794 4YJ0 26005864 Crystal structure of the DM domain of human DMRT1 bound to 25mer target DNA 2015-03-02 2015-05-27 Murphy, M.W.,Lee, J.K.,Rojo, S.,Gearhart, M.D.,Kurahashi, K.,Banerjee, S.,Loeuille, G.A.,Bashamboo, A.,McElreavey, K.,Zarkower, D.,Aihara, H.,Bardwell, V.J. An ancient protein-DNA interaction underlying metazoan sex determination. Nat.Struct.Mol.Biol. 2015 22 442 451 4YJ2 25970265 Crystal structure of tubulin bound to MI-181 2015-03-03 2015-05-27 McNamara, D.E.,Senese, S.,Yeates, T.O.,Torres, J.Z. Structures of potent anticancer compounds bound to tubulin. Protein Sci. 2015 24 1164 1172 4YJ3 25970265 Crystal structure of tubulin bound to compound 2 2015-03-03 2015-05-27 McNamara, D.E.,Senese, S.,Yeates, T.O.,Torres, J.Z. Structures of potent anticancer compounds bound to tubulin. Protein Sci. 2015 24 1164 1172 4XBA 26007660 Hnt3 2014-12-16 2015-06-03 Chauleau, M.,Jacewicz, A.,Shuman, S. DNA3'pp5'G de-capping activity of aprataxin: effect of cap nucleoside analogs and structural basis for guanosine recognition. Nucleic Acids Res. 2015 43 6075 6083 4YKL 26007660 Hnt3 in complex with DNA and guanosine 2015-03-04 2015-06-03 Chauleau, M.,Jacewicz, A.,Shuman, S. DNA3'pp5'G de-capping activity of aprataxin: effect of cap nucleoside analogs and structural basis for guanosine recognition. Nucleic Acids Res. 2015 43 6075 6083 4YS0 25982945 Conformational changes of the clamp of the protein translocation ATPase SecA from Thermotoga maritima 2015-03-16 2015-06-03 Chen, Y.,Bauer, B.W.,Rapoport, T.A.,Gumbart, J.C. Conformational Changes of the Clamp of the Protein Translocation ATPase SecA. J.Mol.Biol. 2015 427 2348 2359 4Z3S 26028538 Crystal structure of the Thermus thermophilus 70S ribosome in complex with antibiotic A201A, mRNA and three tRNAs in the A, P and E sites at 2.65A resolution 2015-03-31 2015-06-03 Polikanov, Y.S.,Starosta, A.L.,Juette, M.F.,Altman, R.B.,Terry, D.S.,Lu, W.,Burnett, B.J.,Dinos, G.,Reynolds, K.A.,Blanchard, S.C.,Steitz, T.A.,Wilson, D.N. Distinct tRNA Accommodation Intermediates Observed on the Ribosome with the Antibiotics Hygromycin A and A201A. Mol.Cell 2015 58 832 844 4QCB 26031450 Protein-DNA complex of Vaccinia virus D4 with double-stranded non-specific DNA 2014-05-09 2015-06-10 Schormann, N.,Banerjee, S.,Ricciardi, R.,Chattopadhyay, D. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA Glycosylase. BMC Struct. Biol. 2015 15 10 10 4QIE Crystal Structure of PduA with edge mutation K26D 2014-05-30 2015-06-10 Pang, A.H.,Sawaya, M.R.,Bobik, T.A.,Yeates, T.O. Crystal Structure of PduA with edge mutation K26D To be Published 0 0 0 0 4TLH Monoclinic Crystal Structure of EutL from Clostridium Perfringens 2014-05-29 2015-06-10 Thompson, M.C.,Cascio, D.,Yeates, T.O. Microfocus diffraction from different regions of a protein crystal: structural variations and unit-cell polymorphism Acta Crystallogr.,Sect.D 2018 0 0 0 4Z0L 26088701 The murine cyclooxygenase-2 complexed with a nido-dicarbaborate-containing indomethacin derivative 2015-03-26 2015-06-10 Neumann, W.,Xu, S.,Sarosi, M.B.,Scholz, M.S.,Crews, B.C.,Ghebreselasie, K.,Banerjee, S.,Marnett, L.J.,Hey-Hawkins, E. nido-Dicarbaborate Induces Potent and Selective Inhibition of Cyclooxygenase-2. Chemmedchem 2016 11 175 178 4RNK 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAAAATTTGGAG) 2014-10-24 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4RO4 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAAACGTTGGAG) 2014-10-27 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4RO7 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAAAGCTTGGAG) 2014-10-28 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4RO8 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGAATCGATGGAG) 2014-10-28 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4ROG 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACACGTGGGAG) 2014-10-28 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4ROK 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACAGCTGGGAG) 2014-10-28 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4RON 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACCATGGGGAG) 2014-10-28 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4ROO 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACCGCGGGGAG) 2014-10-28 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4ROY 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACGATCGGGAG) 2014-10-29 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4ROZ 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGACGGCCGGGAG) 2014-10-29 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4RP0 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGATAATTAGGAG) 2014-10-29 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4RP1 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGATACGTAGGAG) 2014-10-29 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 4RP2 26015367 Sequence and structure of a self-assembled 3-D DNA crystal: D(GGATAGCTAGGAG) 2014-10-29 2015-06-17 Saoji, M.,Zhang, D.,Paukstelis, P.J. Probing the role of sequence in the assembly of three-dimensional DNA crystals. Biopolymers 2015 103 618 626 5BO0 26167883 Crystal structure of Human MCM2 HBD and ASF1b chaperoning a histone H3.2-H4 dimer 2015-05-26 2015-06-17 Huang, H.,Strmme, C.B.,Saredi, G.,Hodl, M.,Strandsby, A.,Gonzalez-Aguilera, C.,Chen, S.,Groth, A.,Patel, D.J. A unique binding mode enables MCM2 to chaperone histones H3-H4 at replication forks. Nat.Struct.Mol.Biol. 2015 22 618 626 5BRF 26778112 Crystal structure of Trypanosoma cruzi glucokinase in complex with inhibitor HPOP-GlcN 2015-05-30 2015-06-17 D'Antonio, E.L.,Deinema, M.S.,Kearns, S.P.,Frey, T.A.,Tanghe, S.,Perry, K.,Roy, T.A.,Gracz, H.S.,Rodriguez, A.,D'Antonio, J. Structure-based approach to the identification of a novel group of selective glucosamine analogue inhibitors of Trypanosoma cruzi glucokinase. Mol.Biochem.Parasitol. 2016 204 64 76 5BRH 26778112 Crystal structure of Trypanosoma cruzi glucokinase in complex with inhibitor DBT-GlcN 2015-05-30 2015-06-17 D'Antonio, E.L.,Deinema, M.S.,Kearns, S.P.,Frey, T.A.,Tanghe, S.,Perry, K.,Roy, T.A.,Gracz, H.S.,Rodriguez, A.,D'Antonio, J. Structure-based approach to the identification of a novel group of selective glucosamine analogue inhibitors of Trypanosoma cruzi glucokinase. Mol.Biochem.Parasitol. 2016 204 64 76 4YD8 26085087 Bardet-Biedl Syndrome 9 Protein (aa1-407), Homo sapiens 2015-02-21 2015-06-24 Knockenhauer, K.E.,Schwartz, T.U. Structural Characterization of Bardet-Biedl Syndrome 9 Protein (BBS9). J.Biol.Chem. 2015 290 19569 19583 4YMK 26098370 Crystal Structure of Stearoyl-Coenzyme A Desaturase 1 2015-03-06 2015-06-24 Bai, Y.,McCoy, J.G.,Levin, E.J.,Sobrado, P.,Rajashankar, K.R.,Fox, B.G.,Zhou, M. X-ray structure of a mammalian stearoyl-CoA desaturase. Nature 2015 524 252 256 4YMK 26098370 Crystal Structure of Stearoyl-Coenzyme A Desaturase 1 2015-03-06 2015-06-24 Bai, Y.,McCoy, J.G.,Levin, E.J.,Sobrado, P.,Rajashankar, K.R.,Fox, B.G.,Zhou, M. X-ray structure of a mammalian stearoyl-CoA desaturase. Nature 2015 524 252 256 4XGZ 26087144 Crystal structure of human paxillin LD2 motif in complex with Fab fragment 2015-01-04 2015-07-01 Nocula-Lugowska, M.,Lugowski, M.,Salgia, R.,Kossiakoff, A.A. Engineering Synthetic Antibody Inhibitors Specific for LD2 or LD4 Motifs of Paxillin. J.Mol.Biol. 2015 427 2532 2547 4XH2 26087144 Crystal structure of human paxillin LD4 motif in complex with Fab fragment 2015-01-04 2015-07-01 Nocula-Lugowska, M.,Lugowski, M.,Salgia, R.,Kossiakoff, A.A. Engineering Synthetic Antibody Inhibitors Specific for LD2 or LD4 Motifs of Paxillin. J.Mol.Biol. 2015 427 2532 2547 5C4I 26061898 Structure of an Oxalate Oxidoreductase 2015-06-18 2015-07-01 Gibson, M.I.,Brignole, E.J.,Pierce, E.,Can, M.,Ragsdale, S.W.,Drennan, C.L. The Structure of an Oxalate Oxidoreductase Provides Insight into Microbial 2-Oxoacid Metabolism. Biochemistry 2015 54 4112 4120 4TKP 26212332 Complex of Ubc13 with the RING domain of the TRIM5alpha retroviral restriction factor 2014-05-27 2015-07-22 Yudina, Z.,Roa, A.,Johnson, R.,Biris, N.,de Souza Aranha Vieira, D.A.,Tsiperson, V.,Reszka, N.,Taylor, A.B.,Hart, P.J.,Demeler, B.,Diaz-Griffero, F.,Ivanov, D.N. RING Dimerization Links Higher-Order Assembly of TRIM5 alpha to Synthesis of K63-Linked Polyubiquitin. Cell Rep 2015 12 788 797 4X9R 26152807 PLK-1 polo-box domain in complex with Bioactive Imidazolium-containing phosphopeptide macrocycle 3B 2014-12-11 2015-07-29 Qian, W.J.,Park, J.E.,Grant, R.,Lai, C.C.,Kelley, J.A.,Yaffe, M.B.,Lee, K.S.,Burke, T.R. Neighbor-directed histidine N ( tau )-alkylation: A route to imidazolium-containing phosphopeptide macrocycles. Biopolymers 2015 104 663 673 4X9V 26152807 PLK-1 polo-box domain in complex with Bioactive Imidazolium-containing phosphopeptide macrocycle 3C 2014-12-11 2015-07-29 Qian, W.J.,Park, J.E.,Grant, R.,Lai, C.C.,Kelley, J.A.,Yaffe, M.B.,Lee, K.S.,Burke, T.R. Neighbor-directed histidine N ( tau )-alkylation: A route to imidazolium-containing phosphopeptide macrocycles. Biopolymers 2015 104 663 673 4X9W 26152807 PLK-1 polo-box domain in complex with Bioactive Imidazolium-containing phosphopeptide macrocycle 4C 2014-12-11 2015-07-29 Qian, W.J.,Park, J.E.,Grant, R.,Lai, C.C.,Kelley, J.A.,Yaffe, M.B.,Lee, K.S.,Burke, T.R. Neighbor-directed histidine N ( tau )-alkylation: A route to imidazolium-containing phosphopeptide macrocycles. Biopolymers 2015 104 663 673 4XBI 26130467 Structure Of A Malarial Protein Involved in Proteostasis 2014-12-17 2015-07-29 AhYoung, A.P.,Koehl, A.,Cascio, D.,Egea, P.F. Structural mapping of the ClpB ATPases of Plasmodium falciparum: Targeting protein folding and secretion for antimalarial drug design. Protein Sci. 2015 24 1508 1520 4ZCF 26067164 Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I 2015-04-15 2015-07-29 Gupta, Y.K.,Chan, S.H.,Xu, S.Y.,Aggarwal, A.K. Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun 2015 6 7363 7363 4ZCK 26163516 Crystal Structure of C-terminal Fragment of Escherichia coli BipA/TypA 2015-04-16 2015-07-29 Fan, H.,Hahm, J.,Diggs, S.,Perry, J.J.,Blaha, G. Structural and Functional Analysis of BipA, a Regulator of Virulence in Enteropathogenic Escherichia coli. J.Biol.Chem. 2015 290 20856 20864 4ZK7 26174163 Crystal structure of rescued two-component self-assembling tetrahedral cage T33-31 2015-04-30 2015-07-29 Bale, J.B.,Park, R.U.,Liu, Y.,Gonen, S.,Gonen, T.,Cascio, D.,King, N.P.,Yeates, T.O.,Baker, D. Structure of a designed tetrahedral protein assembly variant engineered to have improved soluble expression. Protein Sci. 2015 24 1695 1701 4QIV Crystal structure of hexameric microcomparment shell protein from Aeromonas hydrophila 2014-06-02 2015-08-12 Pang, A.H.,Sawaya, M.R.,Yeates, T.O. Crystal structure of a hexameric microcomparment protein from Aeromonas hydrophila To be Published 0 0 0 0 4ZJV 26280531 crystal structure of EGFR kinase domain in complex with Mitogen-inducible gene 6 protein 2015-04-29 2015-08-12 Park, E.,Kim, N.,Ficarro, S.B.,Zhang, Y.,Lee, B.I.,Cho, A.,Kim, K.,Park, A.K.,Park, W.Y.,Murray, B.,Meyerson, M.,Beroukhim, R.,Marto, J.A.,Cho, J.,Eck, M.J. Structure and mechanism of activity-based inhibition of the EGF receptor by Mig6. Nat.Struct.Mol.Biol. 2015 22 703 711 5C7U 26223188 5'-monophosphate wt Guanine Riboswitch bound to hypoxanthine. 2015-06-24 2015-08-12 Hernandez, A.R.,Shao, Y.,Hoshika, S.,Yang, Z.,Shelke, S.A.,Herrou, J.,Kim, H.J.,Kim, M.J.,Piccirilli, J.A.,Benner, S.A. A Crystal Structure of a Functional RNA Molecule Containing an Artificial Nucleobase Pair. Angew.Chem.Int.Ed.Engl. 2015 54 9853 9856 5CCH 26280336 Structure of the Ca2+-bound synaptotagmin-1 SNARE complex (short unit cell form) 2015-07-02 2015-08-12 Zhou, Q.,Lai, Y.,Bacaj, T.,Zhao, M.,Lyubimov, A.Y.,Uervirojnangkoorn, M.,Zeldin, O.B.,Brewster, A.S.,Sauter, N.K.,Cohen, A.E.,Soltis, S.M.,Alonso-Mori, R.,Chollet, M.,Lemke, H.T.,Pfuetzner, R.A.,Choi, U.B.,Weis, W.I.,Diao, J.,Sudhof, T.C.,Brunger, A.T. Architecture of the synaptotagmin-SNARE machinery for neuronal exocytosis. Nature 2015 525 62 67 5CCI 26280336 Structure of the Mg2+-bound synaptotagmin-1 SNARE complex (short unit cell form) 2015-07-02 2015-08-12 Zhou, Q.,Lai, Y.,Bacaj, T.,Zhao, M.,Lyubimov, A.Y.,Uervirojnangkoorn, M.,Zeldin, O.B.,Brewster, A.S.,Sauter, N.K.,Cohen, A.E.,Soltis, S.M.,Alonso-Mori, R.,Chollet, M.,Lemke, H.T.,Pfuetzner, R.A.,Choi, U.B.,Weis, W.I.,Diao, J.,Sudhof, T.C.,Brunger, A.T. Architecture of the synaptotagmin-SNARE machinery for neuronal exocytosis. Nature 2015 525 62 67 5CCJ 26280336 Crystal structure of the quintuple mutant of the synaptotagmin-1 C2B domain 2015-07-02 2015-08-12 Zhou, Q.,Lai, Y.,Bacaj, T.,Zhao, M.,Lyubimov, A.Y.,Uervirojnangkoorn, M.,Zeldin, O.B.,Brewster, A.S.,Sauter, N.K.,Cohen, A.E.,Soltis, S.M.,Alonso-Mori, R.,Chollet, M.,Lemke, H.T.,Pfuetzner, R.A.,Choi, U.B.,Weis, W.I.,Diao, J.,Sudhof, T.C.,Brunger, A.T. Architecture of the synaptotagmin-SNARE machinery for neuronal exocytosis. Nature 2015 525 62 67 5CYU 26922638 Structure of the soluble domain of EccB1 from the Mycobacterium smegmatis ESX-1 secretion system. 2015-07-30 2015-08-12 Wagner, J.M.,Chan, S.,Evans, T.J.,Kahng, S.,Kim, J.,Arbing, M.A.,Eisenberg, D.,Korotkov, K.V. Structures of EccB1 and EccD1 from the core complex of the mycobacterial ESX-1 type VII secretion system. Bmc Struct.Biol. 2016 16 5 5 4WYB 26118535 Structure of the Bud6 flank domain in complex with actin 2014-11-17 2015-08-19 Park, E.,Graziano, B.R.,Zheng, W.,Garabedian, M.,Goode, B.L.,Eck, M.J. Structure of a Bud6/Actin Complex Reveals a Novel WH2-like Actin Monomer Recruitment Motif. Structure 2015 23 1492 1499 4ZSV 26243886 Structure of a fusion protein with a helix linker, 2ARH-3-3KAW-1.0 2015-05-14 2015-08-19 Lai, Y.T.,Jiang, L.,Chen, W.,Yeates, T.O. On the predictability of the orientation of protein domains joined by a spanning alpha-helical linker. Protein Eng.Des.Sel. 2015 28 491 500 4ZSX 26243886 Structure of a fusion protein with a helix linker, 2ARH-3-3KAW-2.0 2015-05-14 2015-08-19 Lai, Y.T.,Jiang, L.,Chen, W.,Yeates, T.O. On the predictability of the orientation of protein domains joined by a spanning alpha-helical linker. Protein Eng.Des.Sel. 2015 28 491 500 4YGA 26305940 CDPK1, from Toxoplasma gondii, bound to inhibitory VHH-1B7 2015-02-26 2015-08-26 Ingram, J.R.,Knockenhauer, K.E.,Markus, B.M.,Mandelbaum, J.,Ramek, A.,Shan, Y.,Shaw, D.E.,Schwartz, T.U.,Ploegh, H.L.,Lourido, S. Allosteric activation of apicomplexan calcium-dependent protein kinases. Proc.Natl.Acad.Sci.USA 2015 112 0 0 4ZWE 26294762 Crystal structure of the dGTP-bound catalytic core of SAMHD1 T592V mutant 2015-05-19 2015-09-02 Tang, C.,Ji, X.,Wu, L.,Xiong, Y. Impaired dNTPase Activity of SAMHD1 by Phosphomimetic Mutation of Thr-592. J.Biol.Chem. 2015 290 26352 26359 4ZWG 26294762 Crystal structure of the GTP-dATP-bound catalytic core of SAMHD1 phosphomimetic T592E mutant 2015-05-19 2015-09-02 Tang, C.,Ji, X.,Wu, L.,Xiong, Y. Impaired dNTPase Activity of SAMHD1 by Phosphomimetic Mutation of Thr-592. J.Biol.Chem. 2015 290 26352 26359 5BP5 26272706 Crystal structure of HA17-HA33-IPT 2015-05-27 2015-09-02 Lee, K.,Lam, K.H.,Kruel, A.M.,Mahrhold, S.,Perry, K.,Cheng, L.W.,Rummel, A.,Jin, R. Inhibiting oral intoxication of botulinum neurotoxin A complex by carbohydrate receptor mimics. Toxicon 2015 107 43 49 4RO5 26172141 Crystal structure of the SAT domain from the non-reducing fungal polyketide synthase CazM 2014-10-27 2015-09-09 Winter, J.M.,Cascio, D.,Dietrich, D.,Sato, M.,Watanabe, K.,Sawaya, M.R.,Vederas, J.C.,Tang, Y. Biochemical and Structural Basis for Controlling Chemical Modularity in Fungal Polyketide Biosynthesis. J.Am.Chem.Soc. 2015 137 9885 9893 4RPM 26172141 Crystal structure of the SAT domain from the non-reducing fungal polyketide synthase CazM with bound hexanoyl 2014-10-30 2015-09-09 Winter, J.M.,Cascio, D.,Dietrich, D.,Sato, M.,Watanabe, K.,Sawaya, M.R.,Vederas, J.C.,Tang, Y. Biochemical and Structural Basis for Controlling Chemical Modularity in Fungal Polyketide Biosynthesis. J.Am.Chem.Soc. 2015 137 9885 9893 5CJT 26318610 Isobutyryl-CoA mutase fused with bound adenosylcobalamin, GDP, Mg (holo-IcmF/GDP), and substrate isobutyryl-coenzyme A 2015-07-15 2015-09-09 Jost, M.,Born, D.A.,Cracan, V.,Banerjee, R.,Drennan, C.L. Structural Basis for Substrate Specificity in Adenosylcobalamin-dependent Isobutyryl-CoA Mutase and Related Acyl-CoA Mutases. J.Biol.Chem. 2015 290 26882 26898 5CJU 26318610 Isobutyryl-CoA mutase fused with bound adenosylcobalamin, GDP, Mg (holo-IcmF/GDP), and substrate n-butyryl-coenzyme A 2015-07-15 2015-09-09 Jost, M.,Born, D.A.,Cracan, V.,Banerjee, R.,Drennan, C.L. Structural Basis for Substrate Specificity in Adenosylcobalamin-dependent Isobutyryl-CoA Mutase and Related Acyl-CoA Mutases. J.Biol.Chem. 2015 290 26882 26898 5CJV 26318610 Isobutyryl-CoA mutase fused with bound adenosylcobalamin, GDP, Mg (holo-IcmF/GDP), and substrate isovaleryl-coenzyme A 2015-07-15 2015-09-09 Jost, M.,Born, D.A.,Cracan, V.,Banerjee, R.,Drennan, C.L. Structural Basis for Substrate Specificity in Adenosylcobalamin-dependent Isobutyryl-CoA Mutase and Related Acyl-CoA Mutases. J.Biol.Chem. 2015 290 26882 26898 5CJW 26318610 Isobutyryl-CoA mutase fused with bound adenosylcobalamin, GDP, Mg (holo-IcmF/GDP), and substrate pivalyl-coenzyme A 2015-07-15 2015-09-09 Jost, M.,Born, D.A.,Cracan, V.,Banerjee, R.,Drennan, C.L. Structural Basis for Substrate Specificity in Adenosylcobalamin-dependent Isobutyryl-CoA Mutase and Related Acyl-CoA Mutases. J.Biol.Chem. 2015 290 26882 26898 5COS 26313375 Crystal Structure of the Cytoplasmic Domain of the Pseudomonas putida Anti-sigma Factor PupR 2015-07-20 2015-09-09 Jensen, J.L.,Balbo, A.,Neau, D.B.,Chakravarthy, S.,Zhao, H.,Sinha, S.C.,Colbert, C.L. Mechanistic Implications of the Unique Structural Features and Dimerization of the Cytoplasmic Domain of the Pseudomonas Sigma Regulator, PupR. Biochemistry 2015 54 5867 5877 5CQC 26343456 Crystal structure of the legionella pneumophila effector protein RavZ 2015-07-21 2015-09-09 Horenkamp, F.A.,Kauffman, K.J.,Kohler, L.J.,Sherwood, R.K.,Krueger, K.P.,Shteyn, V.,Roy, C.R.,Melia, T.J.,Reinisch, K.M. The Legionella Anti-autophagy Effector RavZ Targets the Autophagosome via PI3P- and Curvature-Sensing Motifs. Dev.Cell 2015 34 569 576 4YEU ELIC-GLIC chimera in the resting conformation 2015-02-24 2015-09-16 Chakrapani, S.,Schmandt, N.T.,Lodowski, D.T.,Yee, V.C.,Talley, L.,Parker, M.D.,Phanindra, V.,Chalamalasetti, S.V.,Stein, R.A.,Bonner, R.,Mchaourab, H.S. An ELIC-GLIC Chimera Reveals Distinct Pathways of Activation in the Cys-loop receptors To Be Published 0 0 0 0 5CW3 26344097 Structure of CfBRCC36-CfKIAA0157 complex (Zn Edge) 2015-07-27 2015-09-16 Zeqiraj, E.,Tian, L.,Piggott, C.A.,Pillon, M.C.,Duffy, N.M.,Ceccarelli, D.F.,Keszei, A.F.,Lorenzen, K.,Kurinov, I.,Orlicky, S.,Gish, G.D.,Heck, A.J.,Guarne, A.,Greenberg, R.A.,Sicheri, F. Higher-Order Assembly of BRCC36-KIAA0157 Is Required for DUB Activity and Biological Function. Mol.Cell 2015 59 970 983 5CW4 26344097 Structure of CfBRCC36-CfKIAA0157 complex (Selenium Edge) 2015-07-27 2015-09-16 Zeqiraj, E.,Tian, L.,Piggott, C.A.,Pillon, M.C.,Duffy, N.M.,Ceccarelli, D.F.,Keszei, A.F.,Lorenzen, K.,Kurinov, I.,Orlicky, S.,Gish, G.D.,Heck, A.J.,Guarne, A.,Greenberg, R.A.,Sicheri, F. Higher-Order Assembly of BRCC36-KIAA0157 Is Required for DUB Activity and Biological Function. Mol.Cell 2015 59 970 983 5CW5 26344097 Structure of CfBRCC36-CfKIAA0157 complex (QSQ mutant) 2015-07-27 2015-09-16 Zeqiraj, E.,Tian, L.,Piggott, C.A.,Pillon, M.C.,Duffy, N.M.,Ceccarelli, D.F.,Keszei, A.F.,Lorenzen, K.,Kurinov, I.,Orlicky, S.,Gish, G.D.,Heck, A.J.,Guarne, A.,Greenberg, R.A.,Sicheri, F. Higher-Order Assembly of BRCC36-KIAA0157 Is Required for DUB Activity and Biological Function. Mol.Cell 2015 59 970 983 5CW6 26344097 Structure of metal dependent enzyme DrBRCC36 2015-07-27 2015-09-16 Zeqiraj, E.,Tian, L.,Piggott, C.A.,Pillon, M.C.,Duffy, N.M.,Ceccarelli, D.F.,Keszei, A.F.,Lorenzen, K.,Kurinov, I.,Orlicky, S.,Gish, G.D.,Heck, A.J.,Guarne, A.,Greenberg, R.A.,Sicheri, F. Higher-Order Assembly of BRCC36-KIAA0157 Is Required for DUB Activity and Biological Function. Mol.Cell 2015 59 970 983 5DLB 30419243 Crystal structure of chaperone EspG3 of ESX-3 type VII secretion system from Mycobacterium marinum M 2015-09-04 2015-09-23 Tuukkanen, A.T.,Freire, D.,Chan, S.,Arbing, M.A.,Reed, R.W.,Evans, T.J.,Zenkeviciute, G.,Kim, J.,Kahng, S.,Sawaya, M.R.,Chaton, C.T.,Wilmanns, M.,Eisenberg, D.,Parret, A.H.A.,Korotkov, K.V. Structural Variability of EspG Chaperones from Mycobacterial ESX-1, ESX-3, and ESX-5 Type VII Secretion Systems. J. Mol. Biol. 2019 431 289 307 4RF3 26644568 Crystal Structure of ketoreductase from Lactobacillus kefir, mutant A94F 2014-09-24 2015-09-30 Noey, E.L.,Tibrewal, N.,Jimenez-Oses, G.,Osuna, S.,Park, J.,Bond, C.M.,Cascio, D.,Liang, J.,Zhang, X.,Huisman, G.W.,Tang, Y.,Houk, K.N. Origins of stereoselectivity in evolved ketoreductases. Proc.Natl.Acad.Sci.USA 2015 112 0 0 4RF4 26644568 Crystal structure of ketoreductase from Lactobacillus kefir 2014-09-24 2015-09-30 Noey, E.L.,Tibrewal, N.,Jimenez-Oses, G.,Osuna, S.,Park, J.,Bond, C.M.,Cascio, D.,Liang, J.,Zhang, X.,Huisman, G.W.,Tang, Y.,Houk, K.N. Origins of stereoselectivity in evolved ketoreductases. Proc.Natl.Acad.Sci.USA 2015 112 0 0 4RF5 26644568 Crystal structure of ketoreductase from Lactobacillus kefir, E145S mutant 2014-09-24 2015-09-30 Noey, E.L.,Tibrewal, N.,Jimenez-Oses, G.,Osuna, S.,Park, J.,Bond, C.M.,Cascio, D.,Liang, J.,Zhang, X.,Huisman, G.W.,Tang, Y.,Houk, K.N. Origins of stereoselectivity in evolved ketoreductases. Proc.Natl.Acad.Sci.USA 2015 112 0 0 5BYJ 26485649 Schistosoma mansoni (Blood Fluke) Sulfotransferase/R-oxamniquine Complex 2015-06-10 2015-09-30 Taylor, A.B.,Pica-Mattoccia, L.,Polcaro, C.M.,Donati, E.,Cao, X.,Basso, A.,Guidi, A.,Rugel, A.R.,Holloway, S.P.,Anderson, T.J.,Hart, P.J.,Cioli, D.,LoVerde, P.T. Structural and Functional Characterization of the Enantiomers of the Antischistosomal Drug Oxamniquine. Plos Negl Trop Dis 2015 9 0 0 5BYK 26485649 Schistosoma mansoni (Blood Fluke) Sulfotransferase/S-oxamniquine Complex 2015-06-10 2015-09-30 Taylor, A.B.,Pica-Mattoccia, L.,Polcaro, C.M.,Donati, E.,Cao, X.,Basso, A.,Guidi, A.,Rugel, A.R.,Holloway, S.P.,Anderson, T.J.,Hart, P.J.,Cioli, D.,LoVerde, P.T. Structural and Functional Characterization of the Enantiomers of the Antischistosomal Drug Oxamniquine. Plos Negl Trop Dis 2015 9 0 0 5C8A 26416754 Crystal structure of a truncated form of Thermus thermophilus CarH bound to adenosylcobalamin (dark state) 2015-06-25 2015-09-30 Jost, M.,Fernandez-Zapata, J.,Polanco, M.C.,Ortiz-Guerrero, J.M.,Chen, P.Y.,Kang, G.,Padmanabhan, S.,Elias-Arnanz, M.,Drennan, C.L. Structural basis for gene regulation by a B12-dependent photoreceptor. Nature 2015 526 536 541 5C8D 26416754 Crystal structure of full-length Thermus thermophilus CarH bound to adenosylcobalamin (dark state) 2015-06-25 2015-09-30 Jost, M.,Fernandez-Zapata, J.,Polanco, M.C.,Ortiz-Guerrero, J.M.,Chen, P.Y.,Kang, G.,Padmanabhan, S.,Elias-Arnanz, M.,Drennan, C.L. Structural basis for gene regulation by a B12-dependent photoreceptor. Nature 2015 526 536 541 5C8E 26416754 Crystal structure of Thermus thermophilus CarH bound to adenosylcobalamin and a 26-bp DNA segment 2015-06-25 2015-09-30 Jost, M.,Fernandez-Zapata, J.,Polanco, M.C.,Ortiz-Guerrero, J.M.,Chen, P.Y.,Kang, G.,Padmanabhan, S.,Elias-Arnanz, M.,Drennan, C.L. Structural basis for gene regulation by a B12-dependent photoreceptor. Nature 2015 526 536 541 5C8F 26416754 Crystal structure of light-exposed full-length Thermus thermophilus CarH bound to cobalamin 2015-06-25 2015-09-30 Jost, M.,Fernandez-Zapata, J.,Polanco, M.C.,Ortiz-Guerrero, J.M.,Chen, P.Y.,Kang, G.,Padmanabhan, S.,Elias-Arnanz, M.,Drennan, C.L. Structural basis for gene regulation by a B12-dependent photoreceptor. Nature 2015 526 536 541 5CYJ 26347403 X-ray structure of human RBPMS 2015-07-30 2015-09-30 Teplova, M.,Farazi, T.A.,Tuschl, T.,Patel, D.J. Structural basis underlying CAC RNA recognition by the RRM domain of dimeric RNA-binding protein RBPMS. Q. Rev. Biophys. 2016 49 0 0 5D1R 26396194 Crystal structure of Mycobacterium tuberculosis Rv1816 transcriptional regulator. 2015-08-04 2015-09-30 Delmar, J.A.,Chou, T.H.,Wright, C.C.,Licon, M.H.,Doh, J.K.,Radhakrishnan, A.,Kumar, N.,Lei, H.T.,Bolla, J.R.,Rajashankar, K.R.,Su, C.C.,Purdy, G.E.,Yu, E.W. Structural Basis for the Regulation of the MmpL Transporters of Mycobacterium tuberculosis. J.Biol.Chem. 2015 290 28559 28574 5D1W 26396194 Crystal structure of Mycobacterium tuberculosis Rv3249c transcriptional regulator. 2015-08-04 2015-09-30 Delmar, J.A.,Chou, T.H.,Wright, C.C.,Licon, M.H.,Doh, J.K.,Radhakrishnan, A.,Kumar, N.,Lei, H.T.,Bolla, J.R.,Rajashankar, K.R.,Su, C.C.,Purdy, G.E.,Yu, E.W. Structural Basis for the Regulation of the MmpL Transporters of Mycobacterium tuberculosis. J.Biol.Chem. 2015 290 28559 28574 5CQH 26416889 Crystal Structure of the Cancer Genomic DNA Mutator APOBEC3B 2015-07-21 2015-10-07 Shi, K.,Carpenter, M.A.,Kurahashi, K.,Harris, R.S.,Aihara, H. Crystal Structure of the DNA Deaminase APOBEC3B Catalytic Domain. J.Biol.Chem. 2015 290 28120 28130 5D18 26362239 Crystal structure of Mycobacterium tuberculosis Rv0302, form I 2015-08-04 2015-10-07 Chou, T.H.,Delmar, J.A.,Wright, C.C.,Kumar, N.,Radhakrishnan, A.,Doh, J.K.,Licon, M.H.,Reddy Bolla, J.,Lei, H.T.,Rajashankar, K.R.,Su, C.C.,Purdy, G.E.,Yu, E.W. Crystal structure of the Mycobacterium tuberculosis transcriptional regulator Rv0302. Protein Sci. 2015 0 0 0 5D19 26362239 Crystal structure of Mycobacterium tuberculosis Rv0302, form II 2015-08-04 2015-10-07 Chou, T.H.,Delmar, J.A.,Wright, C.C.,Kumar, N.,Radhakrishnan, A.,Doh, J.K.,Licon, M.H.,Reddy Bolla, J.,Lei, H.T.,Rajashankar, K.R.,Su, C.C.,Purdy, G.E.,Yu, E.W. Crystal structure of the Mycobacterium tuberculosis transcriptional regulator Rv0302. Protein Sci. 2015 0 0 0 5DH7 26398724 Two divalent metal ions and conformational changes play roles in the hammerhead ribozyme cleavage reaction-G12A mutant in Mn2+ 2015-08-29 2015-10-07 Mir, A.,Chen, J.,Robinson, K.,Lendy, E.,Goodman, J.,Neau, D.,Golden, B.L. Two Divalent Metal Ions and Conformational Changes Play Roles in the Hammerhead Ribozyme Cleavage Reaction. Biochemistry 2015 54 6369 6381 4Y1N 26502156 Oceanobacillus iheyensis group II intron domain 1 with iridium hexamine 2015-02-08 2015-10-14 Zhao, C.,Rajashankar, K.R.,Marcia, M.,Pyle, A.M. Crystal structure of group II intron domain 1 reveals a template for RNA assembly. Nat.Chem.Biol. 2015 11 967 972 4Y1O 26502156 Oceanobacillus iheyensis group II intron domain 1 2015-02-08 2015-10-14 Zhao, C.,Rajashankar, K.R.,Marcia, M.,Pyle, A.M. Crystal structure of group II intron domain 1 reveals a template for RNA assembly. Nat.Chem.Biol. 2015 11 967 972 5BQU 26272706 Crystal structure of HA17-HA33-Lactulose 2015-05-29 2015-10-14 Lee, K.,Lam, K.H.,Kruel, A.M.,Mahrhold, S.,Perry, K.,Cheng, L.W.,Rummel, A.,Jin, R. Inhibiting oral intoxication of botulinum neurotoxin A complex by carbohydrate receptor mimics. Toxicon 2015 107 43 49 4TKW 26459562 Crystal Structure of Human Transthyretin Leu55Pro Mutant 2014-05-27 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4TL4 26459562 Crystal Structure of Human Transthyretin Val30Met Mutant 2014-05-28 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4TL5 26459562 Crystal Structure of Human Transthyretin Ser85Pro Mutant 2014-05-28 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4TLK 26459562 Crystal Structure of Human Transthyretin Ser85Pro/Glu92Pro Mutant 2014-05-30 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4TLS 26459562 Crystal Structure of Human Transthyretin Glu92Pro Mutant 2014-05-30 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4TLT 26459562 Crystal structure of human transthyretin 2014-05-30 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4TM9 26459562 Crystal Structure of Human Transthyretin Thr119Trp Mutant 2014-05-31 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4TNE 26459562 Crystal Structure of Human Transthyretin Thr119Tyr Mutant 2014-06-03 2015-10-21 Saelices, L.,Johnson, L.M.,Liang, W.Y.,Sawaya, M.R.,Cascio, D.,Ruchala, P.,Whitelegge, J.,Jiang, L.,Riek, R.,Eisenberg, D.S. Uncovering the Mechanism of Aggregation of Human Transthyretin. J.Biol.Chem. 2015 290 28932 28943 4W4G 26508639 Postcleavage state of 70S bound to HigB toxin and AAA (lysine) codon 2014-08-14 2015-10-21 Schureck, M.A.,Dunkle, J.A.,Maehigashi, T.,Miles, S.J.,Dunham, C.M. Defining the mRNA recognition signature of a bacterial toxin protein. Proc.Natl.Acad.Sci.USA 2015 112 13862 13867 4YPB 26508639 Precleavage 70S structure of the P. vulgaris HigB DeltaH92 toxin bound to the AAA codon 2015-03-12 2015-10-21 Schureck, M.A.,Dunkle, J.A.,Maehigashi, T.,Miles, S.J.,Dunham, C.M. Defining the mRNA recognition signature of a bacterial toxin protein. Proc.Natl.Acad.Sci.USA 2015 112 13862 13867 5DAH 26439302 Crystal structure of PZP domain of human AF10 protein fused with Histone H3 peptide 2015-08-19 2015-10-21 Chen, S.,Yang, Z.,Wilkinson, A.W.,Deshpande, A.J.,Sidoli, S.,Krajewski, K.,Strahl, B.D.,Garcia, B.A.,Armstrong, S.A.,Patel, D.J.,Gozani, O. The PZP Domain of AF10 Senses Unmodified H3K27 to Regulate DOT1L-Mediated Methylation of H3K79. Mol.Cell 2015 60 319 327 4ZI8 26481813 Structure of mouse clustered PcdhgC3 EC1-3 2015-04-27 2015-10-28 Nicoludis, J.M.,Lau, S.Y.,Scharfe, C.P.,Marks, D.S.,Weihofen, W.A.,Gaudet, R. Structure and Sequence Analyses of Clustered Protocadherins Reveal Antiparallel Interactions that Mediate Homophilic Specificity. Structure 2015 23 2087 2098 5COU 26512110 Structure and mechanism of a eukaryal nick-sealing RNA ligase K170M+ATP 2015-07-20 2015-10-28 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Structure and two-metal mechanism of a eukaryal nick-sealing RNA ligase. Proc.Natl.Acad.Sci.USA 2015 112 13868 13873 5COV 26512110 Structure and mechanism of a eukaryal nick-sealing RNA ligase K170M+Mn 2015-07-20 2015-10-28 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Structure and two-metal mechanism of a eukaryal nick-sealing RNA ligase. Proc.Natl.Acad.Sci.USA 2015 112 13868 13873 5CTG 26479032 The 3.1 A resolution structure of a eukaryotic SWEET transporter 2015-07-24 2015-10-28 Tao, Y.,Cheung, L.S.,Li, S.,Eom, J.S.,Chen, L.Q.,Xu, Y.,Perry, K.,Frommer, W.B.,Feng, L. Structure of a eukaryotic SWEET transporter in a homotrimeric complex. Nature 2015 527 259 263 5DFM 26472759 Structure of Tetrahymena telomerase p19 fused to MBP 2015-08-27 2015-10-28 Jiang, J.,Chan, H.,Cash, D.D.,Miracco, E.J.,Ogorzalek Loo, R.R.,Upton, H.E.,Cascio, D.,O'Brien Johnson, R.,Collins, K.,Loo, J.A.,Zhou, Z.H.,Feigon, J. Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions. Science 2015 350 0 0 5DFN 26472759 Structure of Tetrahymena Telomerase P45 C-terminal domain 2015-08-27 2015-10-28 Jiang, J.,Chan, H.,Cash, D.D.,Miracco, E.J.,Ogorzalek Loo, R.R.,Upton, H.E.,Cascio, D.,O'Brien Johnson, R.,Collins, K.,Loo, J.A.,Zhou, Z.H.,Feigon, J. Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions. Science 2015 350 0 0 4X1H 26526852 Opsin/G(alpha) peptide complex stabilized by nonyl-glucoside 2014-11-24 2015-11-04 Blankenship, E.,Vahedi-Faridi, A.,Lodowski, D.T. The High-Resolution Structure of Activated Opsin Reveals a Conserved Solvent Network in the Transmembrane Region Essential for Activation. Structure 2015 23 2358 2364 5D92 26510127 Structure of a phosphatidylinositolphosphate (PIP) synthase from Renibacterium Salmoninarum 2015-08-18 2015-11-04 Clarke, O.B.,Tomasek, D.,Jorge, C.D.,Dufrisne, M.B.,Kim, M.,Banerjee, S.,Rajashankar, K.R.,Shapiro, L.,Hendrickson, W.A.,Santos, H.,Mancia, F. Structural basis for phosphatidylinositol-phosphate biosynthesis. Nat Commun 2015 6 8505 8505 4Z3U 26511020 PRV nuclear egress complex 2015-03-31 2015-11-11 Bigalke, J.M.,Heldwein, E.E. Structural basis of membrane budding by the nuclear egress complex of herpesviruses. Embo J. 2015 34 2921 2936 5BXW 26627654 X-ray crystal structure of a continuously hydrogen bonded 14mer DNA lattice. 2015-06-09 2015-11-11 Saoji, M.,Paukstelis, P.J. Sequence-dependent structural changes in a self-assembling DNA oligonucleotide. Acta Crystallogr.,Sect.D 2015 71 2471 2478 5BZ7 26627654 X-ray crystal structure of a continuously hydrogen bonded 14mer DNA lattice. 2015-06-11 2015-11-11 Saoji, M.,Paukstelis, P.J. Sequence-dependent structural changes in a self-assembling DNA oligonucleotide. Acta Crystallogr.,Sect.D 2015 71 2471 2478 5BZ9 26627654 X-ray crystal structure of a continuously hydrogen bonded 14mer DNA lattice. 2015-06-11 2015-11-11 Saoji, M.,Paukstelis, P.J. Sequence-dependent structural changes in a self-assembling DNA oligonucleotide. Acta Crystallogr.,Sect.D 2015 71 2471 2478 5BZY 26627654 X-ray crystal structure of a continuously hydrogen bonded 14mer DNA lattice. 2015-06-11 2015-11-11 Saoji, M.,Paukstelis, P.J. Sequence-dependent structural changes in a self-assembling DNA oligonucleotide. Acta Crystallogr.,Sect.D 2015 71 2471 2478 5D91 26510127 Structure of a phosphatidylinositolphosphate (PIP) synthase from Renibacterium Salmoninarum 2015-08-18 2015-11-11 Clarke, O.B.,Tomasek, D.,Jorge, C.D.,Dufrisne, M.B.,Kim, M.,Banerjee, S.,Rajashankar, K.R.,Shapiro, L.,Hendrickson, W.A.,Santos, H.,Mancia, F. Structural basis for phosphatidylinositol-phosphate biosynthesis. Nat Commun 2015 6 8505 8505 4ZC9 25999370 Crystal Structure of the BRD4a/DB-2-190 complex 2015-04-15 2015-11-18 Winter, G.E.,Buckley, D.L.,Paulk, J.,Roberts, J.M.,Souza, A.,Dhe-Paganon, S.,Bradner, J.E. DRUG DEVELOPMENT. Phthalimide conjugation as a strategy for in vivo target protein degradation. Science 2015 348 1376 1381 5EAN 26491943 Crystal structure of Dna2 in complex with a 5' overhang DNA 2015-10-16 2015-11-18 Zhou, C.,Pourmal, S.,Pavletich, N.P. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa. Elife 2015 4 0 0 5EAW 26491943 Crystal structure of Dna2 nuclease-helicase 2015-10-17 2015-11-18 Zhou, C.,Pourmal, S.,Pavletich, N.P. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa. Elife 2015 4 0 0 5EAX 26491943 Crystal structure of Dna2 in complex with an ssDNA 2015-10-17 2015-11-18 Zhou, C.,Pourmal, S.,Pavletich, N.P. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa. Elife 2015 4 0 0 5DJ4 26586190 Leucine-bound Sestrin2 from Homo sapiens 2015-09-01 2015-11-25 Saxton, R.A.,Knockenhauer, K.E.,Wolfson, R.L.,Chantranupong, L.,Pacold, M.E.,Wang, T.,Schwartz, T.U.,Sabatini, D.M. Structural basis for leucine sensing by the Sestrin2-mTORC1 pathway. Science 2016 351 53 58 5DOE 26511021 Crystal structure of the Human Cytomegalovirus UL53 (residues 72-292) 2015-09-11 2015-11-25 Lye, M.F.,Sharma, M.,El Omari, K.,Filman, D.J.,Schuermann, J.P.,Hogle, J.M.,Coen, D.M. Unexpected features and mechanism of heterodimer formation of a herpesvirus nuclear egress complex. Embo J. 2015 34 2937 2952 5EIQ 26552697 Human OSCAR ligand-binding domain 2015-10-30 2015-11-25 Zhou, L.,Hinerman, J.M.,Blaszczyk, M.,Miller, J.L.,Conrady, D.G.,Barrow, A.D.,Chirgadze, D.Y.,Bihan, D.,Farndale, R.W.,Herr, A.B. Structural basis for collagen recognition by the immune receptor OSCAR. Blood 2016 127 529 537 5ACL 26576950 Mcg immunoglobulin variable domain with sulfasalazine 2015-08-17 2015-12-02 Brumshtein, B.,Esswein, S.R.,Salwinski, L.,Phillips, M.L.,Ly, A.T.,Cascio, D.,Sawaya, M.R.,Eisenberg, D.S. Inhibition by small-molecule ligands of formation of amyloid fibrils of an immunoglobulin light chain variable domain. Elife 2015 4 0 0 5ACM 26576950 Mcg immunoglobulin variable domain with methylene blue 2015-08-17 2015-12-02 Brumshtein, B.,Esswein, S.R.,Salwinski, L.,Phillips, M.L.,Ly, A.T.,Cascio, D.,Sawaya, M.R.,Eisenberg, D.S. Inhibition by small-molecule ligands of formation of amyloid fibrils of an immunoglobulin light chain variable domain. Elife 2015 4 0 0 5ELH 26641712 Crystal structure of mouse Unkempt zinc fingers 1-3 (ZnF1-3), bound to RNA 2015-11-04 2015-12-09 Murn, J.,Teplova, M.,Zarnack, K.,Shi, Y.,Patel, D.J. Recognition of distinct RNA motifs by the clustered CCCH zinc fingers of neuronal protein Unkempt. Nat.Struct.Mol.Biol. 2016 23 16 23 5ELK 26641712 Crystal structure of mouse Unkempt zinc fingers 4-6 (ZnF4-6), bound to RNA 2015-11-04 2015-12-09 Murn, J.,Teplova, M.,Zarnack, K.,Shi, Y.,Patel, D.J. Recognition of distinct RNA motifs by the clustered CCCH zinc fingers of neuronal protein Unkempt. Nat.Struct.Mol.Biol. 2016 23 16 23 5EVM 26646856 Crystal Structure of Nipah Virus Fusion Glycoprotein in the Prefusion State 2015-11-20 2015-12-16 Xu, K.,Chan, Y.P.,Bradel-Tretheway, B.,Akyol-Ataman, Z.,Zhu, Y.,Dutta, S.,Yan, L.,Feng, Y.,Wang, L.F.,Skiniotis, G.,Lee, B.,Zhou, Z.H.,Broder, C.C.,Aguilar, H.C.,Nikolov, D.B. Crystal Structure of the Pre-fusion Nipah Virus Fusion Glycoprotein Reveals a Novel Hexamer-of-Trimers Assembly. Plos Pathog. 2015 11 0 0 4RZS 26689263 Lac repressor engineered to bind sucralose, unliganded tetramer 2014-12-24 2015-12-23 Taylor, N.D.,Garruss, A.S.,Moretti, R.,Chan, S.,Arbing, M.A.,Cascio, D.,Rogers, J.K.,Isaacs, F.J.,Kosuri, S.,Baker, D.,Fields, S.,Church, G.M.,Raman, S. Engineering an allosteric transcription factor to respond to new ligands. Nat.Methods 2016 13 177 183 4RZT 26689263 Lac repressor engineered to bind sucralose, sucralose-bound tetramer 2014-12-24 2015-12-23 Taylor, N.D.,Garruss, A.S.,Moretti, R.,Chan, S.,Arbing, M.A.,Cascio, D.,Rogers, J.K.,Isaacs, F.J.,Kosuri, S.,Baker, D.,Fields, S.,Church, G.M.,Raman, S. Engineering an allosteric transcription factor to respond to new ligands. Nat.Methods 2016 13 177 183 4TLU Crystal Structure of Human Transthyretin Ala108Trp Mutant 2014-05-30 2015-12-30 Saelices, L.,Cascio, D.,Sawaya, M.,Eisenberg, D.S. Crystal Structure of Human Transthyretin Ala108Trp Mutant to be published 0 0 0 0 4TNF Crystal Structure of Human Transthyretin Lys15Trp Mutant 2014-06-03 2015-12-30 Saelices, L.,Cascio, D.,Sawaya, M.,Eisenberg, D.S. Crystal Structure of Human Transthyretin Lys15Trp Mutant to be published 0 0 0 0 4TNG Crystal Structure of Human Transthyretin Thr119Met Mutant 2014-06-04 2015-12-30 Saelices, L.,Cascio, D.,Sawaya, M.,Eisenberg, D.S. Crystal Structure of Human Transthyretin Thr119Met Mutant to be published 0 0 0 0 5DOY 26028538 Crystal structure of the Thermus thermophilus 70S ribosome in complex with antibiotic Hygromycin A, mRNA and three tRNAs in the A, P and E sites at 2.6A resolution 2015-09-11 2015-12-30 Polikanov, Y.S.,Starosta, A.L.,Juette, M.F.,Altman, R.B.,Terry, D.S.,Lu, W.,Burnett, B.J.,Dinos, G.,Reynolds, K.A.,Blanchard, S.C.,Steitz, T.A.,Wilson, D.N. Distinct tRNA Accommodation Intermediates Observed on the Ribosome with the Antibiotics Hygromycin A and A201A. Mol.Cell 2015 58 832 844 5EN2 26651946 Molecular basis for antibody-mediated neutralization of New World hemorrhagic fever mammarenaviruses 2015-11-09 2015-12-30 Mahmutovic, S.,Clark, L.,Levis, S.C.,Briggiler, A.M.,Enria, D.A.,Harrison, S.C.,Abraham, J. Molecular Basis for Antibody-Mediated Neutralization of New World Hemorrhagic Fever Mammarenaviruses. Cell Host Microbe 2015 18 705 713 5EXD 26712008 Crystal structure of oxalate oxidoreductase from Moorella thermoacetica bound with carboxy-di-oxido-methyl-TPP (COOM-TPP) intermediate 2015-11-23 2015-12-30 Gibson, M.I.,Chen, P.Y.,Johnson, A.C.,Pierce, E.,Can, M.,Ragsdale, S.W.,Drennan, C.L. One-carbon chemistry of oxalate oxidoreductase captured by X-ray crystallography. Proc.Natl.Acad.Sci.USA 2016 113 320 325 5EXE 26712008 Crystal structure of oxalate oxidoreductase from Moorella thermoacetica bound with carboxy-TPP adduct 2015-11-23 2015-12-30 Gibson, M.I.,Chen, P.Y.,Johnson, A.C.,Pierce, E.,Can, M.,Ragsdale, S.W.,Drennan, C.L. One-carbon chemistry of oxalate oxidoreductase captured by X-ray crystallography. Proc.Natl.Acad.Sci.USA 2016 113 320 325 5EN9 26707939 High resolution x-ray crystal structure of isotope-labeled ester-insulin 2015-11-09 2016-01-13 Mandal, K.,Dhayalan, B.,Avital-Shmilovici, M.,Tokmakoff, A.,Kent, S.B. Crystallization of Enantiomerically Pure Proteins from Quasi-Racemic Mixtures: Structure Determination by X-Ray Diffraction of Isotope-Labeled Ester Insulin and Human Insulin. Chembiochem 2016 17 421 425 5ENA 26707939 Xray crystal structure of isotope-labeled human insulin 2015-11-09 2016-01-13 Mandal, K.,Dhayalan, B.,Avital-Shmilovici, M.,Tokmakoff, A.,Kent, S.B. Crystallization of Enantiomerically Pure Proteins from Quasi-Racemic Mixtures: Structure Determination by X-Ray Diffraction of Isotope-Labeled Ester Insulin and Human Insulin. Chembiochem 2016 17 421 425 5F6I 26725118 Crystal Structure of Tier 2 Neutralizing Antibody DH428 from a Rhesus Macaque 2015-12-06 2016-01-13 Bradley, T.,Fera, D.,Bhiman, J.,Eslamizar, L.,Lu, X.,Anasti, K.,Zhang, R.,Sutherland, L.L.,Scearce, R.M.,Bowman, C.M.,Stolarchuk, C.,Lloyd, K.E.,Parks, R.,Eaton, A.,Foulger, A.,Nie, X.,Karim, S.S.,Barnett, S.,Kelsoe, G.,Kepler, T.B.,Alam, S.M.,Montefiori, D.C.,Moody, M.A.,Liao, H.X.,Morris, L.,Santra, S.,Harrison, S.C.,Haynes, B.F. Structural Constraints of Vaccine-Induced Tier-2 Autologous HIV Neutralizing Antibodies Targeting the Receptor-Binding Site. Cell Rep 2016 14 43 54 5CNS 26754917 Crystal structure of the dATP inhibited E. coli class Ia ribonucleotide reductase complex bound to CDP and dATP at 2.97 Angstroms resolution 2015-07-18 2016-01-20 Zimanyi, C.M.,Chen, P.Y.,Kang, G.,Funk, M.A.,Drennan, C.L. Molecular basis for allosteric specificity regulation in class Ia ribonucleotide reductase from Escherichia coli. Elife 2016 5 0 0 5CNT 26754917 Crystal structure of the dATP inhibited E. coli class Ia ribonucleotide reductase complex bound to UDP and dATP at 3.25 Angstroms resolution 2015-07-18 2016-01-20 Zimanyi, C.M.,Chen, P.Y.,Kang, G.,Funk, M.A.,Drennan, C.L. Molecular basis for allosteric specificity regulation in class Ia ribonucleotide reductase from Escherichia coli. Elife 2016 5 0 0 5CNU 26754917 Crystal structure of the dATP inhibited E. coli class Ia ribonucleotide reductase complex bound to ADP and dGTP at 3.40 Angstroms resolution 2015-07-18 2016-01-20 Zimanyi, C.M.,Chen, P.Y.,Kang, G.,Funk, M.A.,Drennan, C.L. Molecular basis for allosteric specificity regulation in class Ia ribonucleotide reductase from Escherichia coli. Elife 2016 5 0 0 5CNV 26754917 Crystal structure of the dATP inhibited E. coli class Ia ribonucleotide reductase complex bound to GDP and TTP at 3.20 Angstroms resolution 2015-07-18 2016-01-20 Zimanyi, C.M.,Chen, P.Y.,Kang, G.,Funk, M.A.,Drennan, C.L. Molecular basis for allosteric specificity regulation in class Ia ribonucleotide reductase from Escherichia coli. Elife 2016 5 0 0 5ERM 26734760 Crystal structure of cyclization domain of Phomopsis amygdali fusicoccadiene synthase complexed with magnesium ions and pamidronate 2015-11-14 2016-01-20 Chen, M.,Chou, W.K.,Toyomasu, T.,Cane, D.E.,Christianson, D.W. Structure and Function of Fusicoccadiene Synthase, a Hexameric Bifunctional Diterpene Synthase. Acs Chem.Biol. 2016 11 889 899 4RQM 29290488 Crystal structure of the SeMET BICC1 SAM Domain R924E mutant 2014-11-03 2016-01-27 Rothe, B.,Leettola, C.N.,Leal-Esteban, L.,Cascio, D.,Fortier, S.,Isenschmid, M.,Bowie, J.U.,Constam, D.B. Crystal Structure of Bicc1 SAM Polymer and Mapping of Interactions between the Ciliopathy-Associated Proteins Bicc1, ANKS3, and ANKS6. Structure 2018 26 209 0 4RQN 29290488 Crystal structure of the native BICC1 SAM Domain R924E mutant 2014-11-03 2016-01-27 Rothe, B.,Leettola, C.N.,Leal-Esteban, L.,Cascio, D.,Fortier, S.,Isenschmid, M.,Bowie, J.U.,Constam, D.B. Crystal Structure of Bicc1 SAM Polymer and Mapping of Interactions between the Ciliopathy-Associated Proteins Bicc1, ANKS3, and ANKS6. Structure 2018 26 209 0 5CDH 26380880 Structure of Legionella pneumophila Histidine Acid Phosphatase complexed with L(+)-tartrate 2015-07-04 2016-01-27 Dhatwalia, R.,Singh, H.,Reilly, T.J.,Tanner, J.J. Crystal structure and tartrate inhibition of Legionella pneumophila histidine acid phosphatase. Arch.Biochem.Biophys. 2015 585 32 38 5D7G 26812546 Structure of human ATG5 E122D-ATG16L1 complex at 3.0 Angstroms 2015-08-13 2016-02-03 Kim, M.,Sandford, E.,Gatica, D.,Qiu, Y.,Liu, X.,Zheng, Y.,Schulman, B.A.,Xu, J.,Semple, I.,Ro, S.H.,Kim, B.,Mavioglu, R.N.,Tolun, A.,Jipa, A.,Takats, S.,Karpati, M.,Li, J.Z.,Yapici, Z.,Juhasz, G.,Lee, J.H.,Klionsky, D.J.,Burmeister, M. Mutation in ATG5 reduces autophagy and leads to ataxia with developmental delay. Elife 2016 5 0 0 5DC6 26806311 Crystal structure of D176N-Y306F HDAC8 in complex with a tetrapeptide substrate 2015-08-23 2016-02-03 Gantt, S.M.,Decroos, C.,Lee, M.S.,Gullett, L.E.,Bowman, C.M.,Christianson, D.W.,Fierke, C.A. General Base-General Acid Catalysis in Human Histone Deacetylase 8. Biochemistry 2016 55 820 832 5DC8 26806311 Crystal structure of H142A-Y306F HDAC8 in complex with a tetrapeptide substrate 2015-08-23 2016-02-03 Gantt, S.M.,Decroos, C.,Lee, M.S.,Gullett, L.E.,Bowman, C.M.,Christianson, D.W.,Fierke, C.A. General Base-General Acid Catalysis in Human Histone Deacetylase 8. Biochemistry 2016 55 820 832 5HMC 26731610 Crystal structure of S. sahachiroi AziG complexed with 5-methyl naphthoic acid 2016-01-15 2016-02-03 Mori, S.,Simkhada, D.,Zhang, H.,Erb, M.S.,Zhang, Y.,Williams, H.,Fedoseyenko, D.,Russell, W.K.,Kim, D.,Fleer, N.,Ealick, S.E.,Watanabe, C.M. Polyketide Ring Expansion Mediated by a Thioesterase, Chain Elongation and Cyclization Domain, in Azinomycin Biosynthesis: Characterization of AziB and AziG. Biochemistry 2016 55 704 714 5EJK 26887497 Crystal structure of the Rous sarcoma virus intasome 2015-11-02 2016-02-17 Yin, Z.,Shi, K.,Banerjee, S.,Pandey, K.K.,Bera, S.,Grandgenett, D.P.,Aihara, H. Crystal structure of the Rous sarcoma virus intasome. Nature 2016 530 362 366 5EZM 26912703 Crystal Structure of ArnT from Cupriavidus metallidurans in the apo state 2015-11-26 2016-02-17 Petrou, V.I.,Herrera, C.M.,Schultz, K.M.,Clarke, O.B.,Vendome, J.,Tomasek, D.,Banerjee, S.,Rajashankar, K.R.,Belcher Dufrisne, M.,Kloss, B.,Kloppmann, E.,Rost, B.,Klug, C.S.,Trent, M.S.,Shapiro, L.,Mancia, F. Structures of aminoarabinose transferase ArnT suggest a molecular basis for lipid A glycosylation. Science 2016 351 608 612 5F15 26912703 Crystal Structure of ArnT from Cupriavidus metallidurans bound to Undecaprenyl phosphate 2015-11-30 2016-02-17 Petrou, V.I.,Herrera, C.M.,Schultz, K.M.,Clarke, O.B.,Vendome, J.,Tomasek, D.,Banerjee, S.,Rajashankar, K.R.,Belcher Dufrisne, M.,Kloss, B.,Kloppmann, E.,Rost, B.,Klug, C.S.,Trent, M.S.,Shapiro, L.,Mancia, F. Structures of aminoarabinose transferase ArnT suggest a molecular basis for lipid A glycosylation. Science 2016 351 608 612 5H9E 26863189 Crystal structure of E. coli Cascade bound to a PAM-containing dsDNA target (32-nt spacer) at 3.20 angstrom resolution. 2015-12-28 2016-02-17 Hayes, R.P.,Xiao, Y.,Ding, F.,van Erp, P.B.,Rajashankar, K.,Bailey, S.,Wiedenheft, B.,Ke, A. Structural basis for promiscuous PAM recognition in type I-E Cascade from E. coli. Nature 2016 530 499 503 5H9F 26863189 Crystal structure of E. coli Cascade bound to a PAM-containing dsDNA target at 2.45 angstrom resolution. 2015-12-28 2016-02-17 Hayes, R.P.,Xiao, Y.,Ding, F.,van Erp, P.B.,Rajashankar, K.,Bailey, S.,Wiedenheft, B.,Ke, A. Structural basis for promiscuous PAM recognition in type I-E Cascade from E. coli. Nature 2016 530 499 503 4ZIB 26582921 Crystal Structure of the C-terminal domain of PylRS mutant bound with 3-benzothienyl-l-alanine and ATP 2015-04-28 2016-03-02 Englert, M.,Nakamura, A.,Wang, Y.S.,Eiler, D.,Soll, D.,Guo, L.T. Probing the active site tryptophan of Staphylococcus aureus thioredoxin with an analog. Nucleic Acids Res. 2015 43 11061 11067 4ZIB 26582921 Crystal Structure of the C-terminal domain of PylRS mutant bound with 3-benzothienyl-l-alanine and ATP 2015-04-28 2016-03-02 Englert, M.,Nakamura, A.,Wang, Y.S.,Eiler, D.,Soll, D.,Guo, L.T. Probing the active site tryptophan of Staphylococcus aureus thioredoxin with an analog. Nucleic Acids Res. 2015 43 11061 11067 5BS8 26792525 Crystal structure of a topoisomerase II complex 2015-06-01 2016-03-02 Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA 2016 113 1706 1713 5BTA 26792525 Crystal structure of a topoisomerase II complex 2015-06-02 2016-03-02 Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA 2016 113 1706 1713 5BTC 26792525 Crystal structure of a topoisomerase II complex 2015-06-02 2016-03-02 Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA 2016 113 1706 1713 5BTF 26792525 Crystal structure of a topoisomerase II complex 2015-06-03 2016-03-02 Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA 2016 113 1706 1713 5BTI 26792525 Crystal structure of a topoisomerase II complex 2015-06-03 2016-03-02 Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA 2016 113 1706 1713 5BTL 26792525 Crystal structure of a topoisomerase II complex 2015-06-03 2016-03-02 Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA 2016 113 1706 1713 5BTN 26792525 Crystal structure of a topoisomerase II complex 2015-06-03 2016-03-02 Blower, T.R.,Williamson, B.H.,Kerns, R.J.,Berger, J.M. Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis. Proc.Natl.Acad.Sci.USA 2016 113 1706 1713 5DC4 26912659 CRYSTAL STRUCTURE OF MONOBODY AS25/ABL1 SH2 DOMAIN COMPLEX, CRYSTAL A 2015-08-23 2016-03-02 Wojcik, J.,Lamontanara, A.J.,Grabe, G.,Koide, A.,Akin, L.,Gerig, B.,Hantschel, O.,Koide, S. Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface. J.Biol.Chem. 2016 291 8836 8847 5DC9 26912659 CRYSTAL STRUCTURE OF MONOBODY AS25/ABL1 SH2 DOMAIN COMPLEX, CRYSTAL B 2015-08-23 2016-03-02 Wojcik, J.,Lamontanara, A.J.,Grabe, G.,Koide, A.,Akin, L.,Gerig, B.,Hantschel, O.,Koide, S. Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface. J.Biol.Chem. 2016 291 8836 8847 5H8T 26900151 Crystal structure of human cellular retinol binding protein 1 in complex with all-trans-retinol 2015-12-23 2016-03-02 Silvaroli, J.A.,Arne, J.M.,Chelstowska, S.,Kiser, P.D.,Banerjee, S.,Golczak, M. Ligand Binding Induces Conformational Changes in Human Cellular Retinol-binding Protein 1 (CRBP1) Revealed by Atomic Resolution Crystal Structures. J.Biol.Chem. 2016 291 8528 8540 5H9A 26900151 Crystal structure of the Apo form of human cellular retinol binding protein 1 2015-12-26 2016-03-02 Silvaroli, J.A.,Arne, J.M.,Chelstowska, S.,Kiser, P.D.,Banerjee, S.,Golczak, M. Ligand Binding Induces Conformational Changes in Human Cellular Retinol-binding Protein 1 (CRBP1) Revealed by Atomic Resolution Crystal Structures. J.Biol.Chem. 2016 291 8528 8540 4Y4L 26919468 Crystal structure of yeast Thi4-C205S 2015-02-10 2016-03-09 Zhang, X.,Eser, B.E.,Chanani, P.K.,Begley, T.P.,Ealick, S.E. Structural Basis for Iron-Mediated Sulfur Transfer in Archael and Yeast Thiazole Synthases. Biochemistry 2016 55 1826 1838 4Y4M 26919468 Thiazole synthase Thi4 from Methanocaldococcus jannaschii 2015-02-10 2016-03-09 Zhang, X.,Eser, B.E.,Chanani, P.K.,Begley, T.P.,Ealick, S.E. Structural Basis for Iron-Mediated Sulfur Transfer in Archael and Yeast Thiazole Synthases. Biochemistry 2016 55 1826 1838 4Y4N 26919468 Thiazole synthase Thi4 from Methanococcus igneus 2015-02-10 2016-03-09 Zhang, X.,Eser, B.E.,Chanani, P.K.,Begley, T.P.,Ealick, S.E. Structural Basis for Iron-Mediated Sulfur Transfer in Archael and Yeast Thiazole Synthases. Biochemistry 2016 55 1826 1838 5DTD 26959646 Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT) 2015-09-17 2016-03-09 Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One 2016 11 0 0 5E3N 26959646 Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT) 2015-10-03 2016-03-09 Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One 2016 11 0 0 5E3O 26959646 Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT) 2015-10-03 2016-03-09 Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One 2016 11 0 0 5HPL 26949039 System-wide modulation of HECT E3 ligases with selective ubiquitin variant probes: Rsp5 and UbV R5.4 2016-01-20 2016-03-16 Zhang, W.,Wu, K.P.,Sartori, M.A.,Kamadurai, H.B.,Ordureau, A.,Jiang, C.,Mercredi, P.Y.,Murchie, R.,Hu, J.,Persaud, A.,Mukherjee, M.,Li, N.,Doye, A.,Walker, J.R.,Sheng, Y.,Hao, Z.,Li, Y.,Brown, K.R.,Lemichez, E.,Chen, J.,Tong, Y.,Harper, J.W.,Moffat, J.,Rotin, D.,Schulman, B.A.,Sidhu, S.S. System-Wide Modulation of HECT E3 Ligases with Selective Ubiquitin Variant Probes. Mol.Cell 2016 62 121 136 5HPS 26949039 System-wide modulation of HECT E3 ligases with selective ubiquitin variant probes: WWP1 and UbV P1.1 2016-01-20 2016-03-16 Zhang, W.,Wu, K.P.,Sartori, M.A.,Kamadurai, H.B.,Ordureau, A.,Jiang, C.,Mercredi, P.Y.,Murchie, R.,Hu, J.,Persaud, A.,Mukherjee, M.,Li, N.,Doye, A.,Walker, J.R.,Sheng, Y.,Hao, Z.,Li, Y.,Brown, K.R.,Lemichez, E.,Chen, J.,Tong, Y.,Harper, J.W.,Moffat, J.,Rotin, D.,Schulman, B.A.,Sidhu, S.S. System-Wide Modulation of HECT E3 Ligases with Selective Ubiquitin Variant Probes. Mol.Cell 2016 62 121 136 5E3L 26959646 Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT) 2015-10-03 2016-03-23 Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One 2016 11 0 0 5EXR 26975377 Crystal structure of human primosome 2015-11-24 2016-03-23 Baranovskiy, A.G.,Babayeva, N.D.,Zhang, Y.,Gu, J.,Suwa, Y.,Pavlov, Y.I.,Tahirov, T.H. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome. J.Biol.Chem. 2016 291 10006 10020 5F0Q 26975377 Crystal structure of C-terminal domain of the human DNA primase large subunit with bound DNA template/RNA primer 2015-11-28 2016-03-23 Baranovskiy, A.G.,Babayeva, N.D.,Zhang, Y.,Gu, J.,Suwa, Y.,Pavlov, Y.I.,Tahirov, T.H. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome. J.Biol.Chem. 2016 291 10006 10020 5F4P 26985324 HIV-1 gp120 complex with BNM-III-170 2015-12-03 2016-03-30 Melillo, B.,Liang, S.,Park, J.,Schon, A.,Courter, J.R.,LaLonde, J.M.,Wendler, D.J.,Princiotto, A.M.,Seaman, M.S.,Freire, E.,Sodroski, J.,Madani, N.,Hendrickson, W.A.,Smith, A.B. Small-Molecule CD4-Mimics: Structure-Based Optimization of HIV-1 Entry Inhibition. Acs Med.Chem.Lett. 2016 7 330 334 5IBK 26976582 Skp1-F-box in complex with a ubiquitin variant 2016-02-22 2016-03-30 Gorelik, M.,Orlicky, S.,Sartori, M.A.,Tang, X.,Marcon, E.,Kurinov, I.,Greenblatt, J.F.,Tyers, M.,Moffat, J.,Sicheri, F.,Sidhu, S.S. Inhibition of SCF ubiquitin ligases by engineered ubiquitin variants that target the Cul1 binding site on the Skp1-F-box interface. Proc.Natl.Acad.Sci.USA 2016 113 3527 3532 5IPL 27035955 SigmaS-transcription initiation complex with 4-nt nascent RNA 2016-03-09 2016-03-30 Liu, B.,Zuo, Y.,Steitz, T.A. Structures of E. coli sigma S-transcription initiation complexes provide new insights into polymerase mechanism. Proc.Natl.Acad.Sci.USA 2016 113 4051 4056 5H8O 27069117 Crystal structure of an ASC-binding nanobody in complex with the CARD domain of ASC 2015-12-23 2016-04-06 Schmidt, F.I.,Lu, A.,Chen, J.W.,Ruan, J.,Tang, C.,Wu, H.,Ploegh, H.L. A single domain antibody fragment that recognizes the adaptor ASC defines the role of ASC domains in inflammasome assembly. J.Exp.Med. 2016 213 771 790 5HAU 26809677 Crystal structure of antimicrobial peptide Bac7(1-19) bound to the Thermus thermophilus 70S ribosome 2015-12-30 2016-04-06 Gagnon, M.G.,Roy, R.N.,Lomakin, I.B.,Florin, T.,Mankin, A.S.,Steitz, T.A. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition. Nucleic Acids Res. 2016 44 2439 2450 5HCP 26809677 Crystal structure of antimicrobial peptide Metalnikowin bound to the Thermus thermophilus 70S ribosome 2016-01-04 2016-04-06 Gagnon, M.G.,Roy, R.N.,Lomakin, I.B.,Florin, T.,Mankin, A.S.,Steitz, T.A. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition. Nucleic Acids Res. 2016 44 2439 2450 5HCQ 26809677 Crystal structure of antimicrobial peptide Oncocin d15-19 bound to the Thermus thermophilus 70S ribosome 2016-01-04 2016-04-06 Gagnon, M.G.,Roy, R.N.,Lomakin, I.B.,Florin, T.,Mankin, A.S.,Steitz, T.A. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition. Nucleic Acids Res. 2016 44 2439 2450 5HCR 26809677 Crystal structure of antimicrobial peptide Oncocin 10wt bound to the Thermus thermophilus 70S ribosome 2016-01-04 2016-04-06 Gagnon, M.G.,Roy, R.N.,Lomakin, I.B.,Florin, T.,Mankin, A.S.,Steitz, T.A. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition. Nucleic Acids Res. 2016 44 2439 2450 5HD1 26809677 Crystal structure of antimicrobial peptide Pyrrhocoricin bound to the Thermus thermophilus 70S ribosome 2016-01-04 2016-04-06 Gagnon, M.G.,Roy, R.N.,Lomakin, I.B.,Florin, T.,Mankin, A.S.,Steitz, T.A. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition. Nucleic Acids Res. 2016 44 2439 2450 5HPN 26988700 A circularly permuted PduA forming an icosahedral cage 2016-01-20 2016-04-06 Jorda, J.,Leibly, D.J.,Thompson, M.C.,Yeates, T.O. Structure of a novel 13 nm dodecahedral nanocage assembled from a redesigned bacterial microcompartment shell protein. Chem.Commun.(Camb.) 2016 52 5041 5044 5ED1 27065196 Human Adenosine Deaminase Acting on dsRNA (ADAR2) mutant E488Q bound to dsRNA sequence derived from S. cerevisiae BDF2 gene 2015-10-20 2016-04-13 Matthews, M.M.,Thomas, J.M.,Zheng, Y.,Tran, K.,Phelps, K.J.,Scott, A.I.,Havel, J.,Fisher, A.J.,Beal, P.A. Structures of human ADAR2 bound to dsRNA reveal base-flipping mechanism and basis for site selectivity. Nat.Struct.Mol.Biol. 2016 23 426 433 5I4N 27029346 Crystal Structure of the E596A V617F Mutant JAK2 Pseudokinase Domain Bound to Mg-ATP 2016-02-12 2016-04-13 Leroy, E.,Dusa, A.,Colau, D.,Motamedi, A.,Cahu, X.,Mouton, C.,Huang, L.J.,Shiau, A.K.,Constantinescu, S.N. Uncoupling JAK2 V617F activation from cytokine-induced signalling by modulation of JH2 alpha C helix. Biochem.J. 2016 473 1579 1591 5I74 27049939 X-ray structure of the ts3 human serotonin transporter complexed with Br-citalopram at the central site 2016-02-16 2016-04-13 Coleman, J.A.,Green, E.M.,Gouaux, E. X-ray structures and mechanism of the human serotonin transporter. Nature 2016 532 334 339 5ED7 27053559 Crystal Structure of HSV-1 UL21 C-terminal Domain 2015-10-20 2016-04-20 Metrick, C.M.,Heldwein, E.E. Novel Structure and Unexpected RNA-Binding Ability of the C-Terminal Domain of Herpes Simplex Virus 1 Tegument Protein UL21. J.Virol. 2016 90 5759 5769 5HQG 27041596 WD40 domain of Human E3 Ubiquitin Ligase COP1 (RFWD2) 2016-01-21 2016-04-20 Uljon, S.,Xu, X.,Durzynska, I.,Stein, S.,Adelmant, G.,Marto, J.A.,Pear, W.S.,Blacklow, S.C. Structural Basis for Substrate Selectivity of the E3 Ligase COP1. Structure 2016 24 687 696 5IGO 27041596 WD40 domain of Arabidopsis thaliana E3 Ubiquitin Ligase COP1 in complex with peptide from Trib1 2016-02-28 2016-04-20 Uljon, S.,Xu, X.,Durzynska, I.,Stein, S.,Adelmant, G.,Marto, J.A.,Pear, W.S.,Blacklow, S.C. Structural Basis for Substrate Selectivity of the E3 Ligase COP1. Structure 2016 24 687 696 5J4B 27079977 Crystal structure of the Thermus thermophilus 70S ribosome in complex with cisplatin (co-crystallized) and bound to mRNA and A-, P- and E-site tRNAs at 2.6A resolution 2016-03-31 2016-04-27 Melnikov, S.V.,Soll, D.,Steitz, T.A.,Polikanov, Y.S. Insights into RNA binding by the anticancer drug cisplatin from the crystal structure of cisplatin-modified ribosome. Nucleic Acids Res. 2016 44 4978 4987 5J4C 27079977 Crystal structure of the Thermus thermophilus 70S ribosome in complex with cisplatin (soaked) and bound to mRNA and A-, P- and E-site tRNAs at 2.8A resolution 2016-03-31 2016-04-27 Melnikov, S.V.,Soll, D.,Steitz, T.A.,Polikanov, Y.S. Insights into RNA binding by the anticancer drug cisplatin from the crystal structure of cisplatin-modified ribosome. Nucleic Acids Res. 2016 44 4978 4987 4WD5 Crystal structure of EGFR 696-1022 T790M in complex with QL-X138 2014-09-07 2016-05-04 Wu, H.,Hu, C.,Wang, A.,Weisberg, E.E.,Chen, Y.,Yun, C.H.,Wang, W.,Liu, X.,Tian, B.,Wang, J.,Zhao, Z.,Liang, Y.,Li, B.,Wang, L.,Wang, B.,Chen, C.,Buhrlage, S.J.,Fernadners, S.M.,Griffin, J.,Brown, J.R.,Eck, M.J.,Liu, J.,Liu, Q.,Gray, N.S. Crystal structure of EGFR 696-1022 T790M in complex with QL-X138 To Be Published 0 0 0 0 4XXW 29443515 Crystal structure of mouse Cadherin-23 EC1-2 and Protocadherin-15 EC1-2 splice variant 2015-01-31 2016-05-04 Narui, Y.,Sotomayor, M. Tuning Inner-Ear Tip-Link Affinity Through Alternatively Spliced Variants of Protocadherin-15. Biochemistry 2018 57 1702 1710 5DZV 27161523 Protocadherin alpha 7 extracellular cadherin domains 1-5 2015-09-26 2016-05-04 Goodman, K.M.,Rubinstein, R.,Thu, C.A.,Bahna, F.,Mannepalli, S.,Ahlsen, G.,Rittenhouse, C.,Maniatis, T.,Honig, B.,Shapiro, L. Structural Basis of Diverse Homophilic Recognition by Clustered alpha- and beta-Protocadherins. Neuron 2016 90 709 723 5DZX 27161523 Protocadherin beta 6 extracellular cadherin domains 1-4 2015-09-26 2016-05-04 Goodman, K.M.,Rubinstein, R.,Thu, C.A.,Bahna, F.,Mannepalli, S.,Ahlsen, G.,Rittenhouse, C.,Maniatis, T.,Honig, B.,Shapiro, L. Structural Basis of Diverse Homophilic Recognition by Clustered alpha- and beta-Protocadherins. Neuron 2016 90 709 723 5DZY 27161523 Protocadherin beta 8 extracellular cadherin domains 1-4 2015-09-26 2016-05-04 Goodman, K.M.,Rubinstein, R.,Thu, C.A.,Bahna, F.,Mannepalli, S.,Ahlsen, G.,Rittenhouse, C.,Maniatis, T.,Honig, B.,Shapiro, L. Structural Basis of Diverse Homophilic Recognition by Clustered alpha- and beta-Protocadherins. Neuron 2016 90 709 723 5HHJ 27136328 Reverse transcriptase domain of group II intron maturase from Roseburia intestinalis in P21 space group 2016-01-11 2016-05-04 Zhao, C.,Pyle, A.M. Crystal structures of a group II intron maturase reveal a missing link in spliceosome evolution. Nat.Struct.Mol.Biol. 2016 23 558 565 5JDZ 27070241 Crystal structure of Burkholderia glumae ToxA with bound S-adenosylhomocysteine (SAH) 2016-04-17 2016-05-04 Fenwick, M.K.,Philmus, B.,Begley, T.P.,Ealick, S.E. Burkholderia glumae ToxA Is a Dual-Specificity Methyltransferase That Catalyzes the Last Two Steps of Toxoflavin Biosynthesis. Biochemistry 2016 55 2748 2759 5JE1 27070241 Crystal structure of Burkholderia glumae ToxA with bound S-adenosylhomocysteine (SAH) and toxoflavin 2016-04-17 2016-05-04 Fenwick, M.K.,Philmus, B.,Begley, T.P.,Ealick, S.E. Burkholderia glumae ToxA Is a Dual-Specificity Methyltransferase That Catalyzes the Last Two Steps of Toxoflavin Biosynthesis. Biochemistry 2016 55 2748 2759 5JE3 27070241 Crystal structure of Burkholderia glumae ToxA Y7A mutant with bound S-adenosylhomocysteine (SAH) 2016-04-17 2016-05-04 Fenwick, M.K.,Philmus, B.,Begley, T.P.,Ealick, S.E. Burkholderia glumae ToxA Is a Dual-Specificity Methyltransferase That Catalyzes the Last Two Steps of Toxoflavin Biosynthesis. Biochemistry 2016 55 2748 2759 5JE4 27070241 Crystal structure of Burkholderia glumae ToxA Y7A mutant with bound S-adenosylhomocysteine (SAH) 2016-04-17 2016-05-04 Fenwick, M.K.,Philmus, B.,Begley, T.P.,Ealick, S.E. Burkholderia glumae ToxA Is a Dual-Specificity Methyltransferase That Catalyzes the Last Two Steps of Toxoflavin Biosynthesis. Biochemistry 2016 55 2748 2759 5JE2 27070241 Crystal structure of Burkholderia glumae ToxA Y7F mutant with bound S-adenosylhomocysteine (SAH) 2016-04-17 2016-05-11 Fenwick, M.K.,Philmus, B.,Begley, T.P.,Ealick, S.E. Burkholderia glumae ToxA Is a Dual-Specificity Methyltransferase That Catalyzes the Last Two Steps of Toxoflavin Biosynthesis. Biochemistry 2016 55 2748 2759 5EGQ 27145334 Structure of tetrameric rat phenylalanine hydroxylase mutant R270K, residues 25-453 2015-10-27 2016-05-18 Meisburger, S.P.,Taylor, A.B.,Khan, C.A.,Zhang, S.,Fitzpatrick, P.F.,Ando, N. Domain Movements upon Activation of Phenylalanine Hydroxylase Characterized by Crystallography and Chromatography-Coupled Small-Angle X-ray Scattering. J.Am.Chem.Soc. 2016 138 6506 6516 4ZXT 27167001 Complex of ERK2 with catechol 2015-05-20 2016-05-25 Lim do, Y.,Shin, S.H.,Lee, M.H.,Malakhova, M.,Kurinov, I.,Wu, Q.,Xu, J.,Jiang, Y.,Dong, Z.,Liu, K.,Lee, K.Y.,Bae, K.B.,Choi, B.Y.,Deng, Y.,Bode, A.,Dong, Z. A natural small molecule, catechol, induces c-Myc degradation by directly targeting ERK2 in lung cancer. Oncotarget 2016 7 35001 35014 5IMN 27172425 Crystal structure of N299A/S303A Aspergillus terreus aristolochene synthase complexed with (1S,8S,9aR)-1,9a-dimethyl-8-(prop-1-en-2-yl)decahydroquinolizin-5-ium 2016-03-06 2016-05-25 Chen, M.,Chou, W.K.,Al-Lami, N.,Faraldos, J.A.,Allemann, R.K.,Cane, D.E.,Christianson, D.W. Probing the Role of Active Site Water in the Sesquiterpene Cyclization Reaction Catalyzed by Aristolochene Synthase. Biochemistry 2016 55 2864 2874 5J8B 27092003 Crystal structure of Elongation Factor 4 (EF-4/LepA) in complex with GDPCP bound to the Thermus thermophilus 70S ribosome 2016-04-07 2016-05-25 Gagnon, M.G.,Lin, J.,Steitz, T.A. Elongation factor 4 remodels the A-site tRNA on the ribosome. Proc.Natl.Acad.Sci.USA 2016 113 4994 4999 5JJ6 Fic-1 (aa134 - 508) from C. elegans 2016-04-22 2016-06-01 Truttman, M.C.,Cruz, V.E.,Guo, X.,Engert, C.,Schwartz, T.U.,Ploegh, H.L. Fic-1 dimer To be published 0 0 0 0 5JJ7 Fic-1 (aa134 - 508 E274G) from C. elegans 2016-04-22 2016-06-01 Truttman, M.C.,Cruz, V.E.,Guo, X.,Engert, C.,Schwartz, T.U.,Ploegh, H.L. Fic-1 (aa134 - 508 E274G) from C. elegans To be published 0 0 0 0 5EOW 27218267 Crystal Structure of 6-Hydroxynicotinic Acid 3-Monooxygenase from Pseudomonas putida KT2440 2015-11-10 2016-06-08 Hicks, K.A.,Yuen, M.E.,Zhen, W.F.,Gerwig, T.J.,Story, R.W.,Kopp, M.C.,Snider, M.J. Structural and Biochemical Characterization of 6-Hydroxynicotinic Acid 3-Monooxygenase, A Novel Decarboxylative Hydroxylase Involved in Aerobic Nicotinate Degradation. Biochemistry 2016 55 3432 3446 5ERP 27298358 Crystal structure of human Desmocollin-2 ectodomain fragment EC2-5 2015-11-14 2016-06-15 Harrison, O.J.,Brasch, J.,Lasso, G.,Katsamba, P.S.,Ahlsen, G.,Honig, B.,Shapiro, L. Structural basis of adhesive binding by desmocollins and desmogleins. Proc.Natl.Acad.Sci.USA 2016 113 7160 7165 5IWK 27296226 Structure of Transient Receptor Potential (TRP) channel TRPV6 2016-03-22 2016-06-15 Saotome, K.,Singh, A.K.,Yelshanskaya, M.V.,Sobolevsky, A.I. Crystal structure of the epithelial calcium channel TRPV6. Nature 2016 534 506 511 5IWP 27296226 Structure of Transient Receptor Potential (TRP) channel TRPV6 in the presence of calcium 2016-03-22 2016-06-15 Saotome, K.,Singh, A.K.,Yelshanskaya, M.V.,Sobolevsky, A.I. Crystal structure of the epithelial calcium channel TRPV6. Nature 2016 534 506 511 5IWR 27296226 Structure of Transient Receptor Potential (TRP) channel TRPV6 in the presence of barium 2016-03-22 2016-06-15 Saotome, K.,Singh, A.K.,Yelshanskaya, M.V.,Sobolevsky, A.I. Crystal structure of the epithelial calcium channel TRPV6. Nature 2016 534 506 511 5IWT 27296226 Structure of Transient Receptor Potential (TRP) channel TRPV6 in the presence of gadolinium 2016-03-22 2016-06-15 Saotome, K.,Singh, A.K.,Yelshanskaya, M.V.,Sobolevsky, A.I. Crystal structure of the epithelial calcium channel TRPV6. Nature 2016 534 506 511 5CI0 27276098 Ribonucleotide reductase Y122 3,5-F2Y variant 2015-07-10 2016-06-22 Oyala, P.H.,Ravichandran, K.R.,Funk, M.A.,Stucky, P.A.,Stich, T.A.,Drennan, C.L.,Britt, R.D.,Stubbe, J. Biophysical Characterization of Fluorotyrosine Probes Site-Specifically Incorporated into Enzymes: E. coli Ribonucleotide Reductase As an Example. J.Am.Chem.Soc. 2016 138 7951 7964 5CI1 27276098 Ribonucleotide reductase Y122 2,3-F2Y variant 2015-07-10 2016-06-22 Oyala, P.H.,Ravichandran, K.R.,Funk, M.A.,Stucky, P.A.,Stich, T.A.,Drennan, C.L.,Britt, R.D.,Stubbe, J. Biophysical Characterization of Fluorotyrosine Probes Site-Specifically Incorporated into Enzymes: E. coli Ribonucleotide Reductase As an Example. J.Am.Chem.Soc. 2016 138 7951 7964 5CI2 27276098 Ribonucleotide reductase Y122 2,3,6-F3Y variant 2015-07-10 2016-06-22 Oyala, P.H.,Ravichandran, K.R.,Funk, M.A.,Stucky, P.A.,Stich, T.A.,Drennan, C.L.,Britt, R.D.,Stubbe, J. Biophysical Characterization of Fluorotyrosine Probes Site-Specifically Incorporated into Enzymes: E. coli Ribonucleotide Reductase As an Example. J.Am.Chem.Soc. 2016 138 7951 7964 5CI4 27276098 Ribonucleotide reductase beta subunit 2015-07-10 2016-06-22 Oyala, P.H.,Ravichandran, K.R.,Funk, M.A.,Stucky, P.A.,Stich, T.A.,Drennan, C.L.,Britt, R.D.,Stubbe, J. Biophysical Characterization of Fluorotyrosine Probes Site-Specifically Incorporated into Enzymes: E. coli Ribonucleotide Reductase As an Example. J.Am.Chem.Soc. 2016 138 7951 7964 5IRY 27298358 Crystal structure of human Desmocollin-1 ectodomain 2016-03-15 2016-06-22 Harrison, O.J.,Brasch, J.,Lasso, G.,Katsamba, P.S.,Ahlsen, G.,Honig, B.,Shapiro, L. Structural basis of adhesive binding by desmocollins and desmogleins. Proc.Natl.Acad.Sci.USA 2016 113 7160 7165 5J5J 27298358 Crystal structure of a chimera of human Desmocollin-2 EC1 and human Desmoglein-2 EC2-EC5 2016-04-02 2016-06-22 Harrison, O.J.,Brasch, J.,Lasso, G.,Katsamba, P.S.,Ahlsen, G.,Honig, B.,Shapiro, L. Structural basis of adhesive binding by desmocollins and desmogleins. Proc.Natl.Acad.Sci.USA 2016 113 7160 7165 5D6V 27561553 PduJ K25A mutant, from Salmonella enterica serovar Typhimurium LT2, PduJ mutant 2015-08-13 2016-06-29 Chowdhury, C.,Chun, S.,Sawaya, M.R.,Yeates, T.O.,Bobik, T.A. The function of the PduJ microcompartment shell protein is determined by the genomic position of its encoding gene. Mol.Microbiol. 2016 101 770 783 5HFT 27303801 Crystal structure of HpxW 2016-01-07 2016-06-29 Hicks, K.A.,Ealick, S.E. Biochemical and structural characterization of Klebsiella pneumoniae oxamate amidohydrolase in the uric acid degradation pathway. Acta Crystallogr D Struct Biol 2016 72 808 816 5FG0 27385828 Structure of the conserved yeast listerin (Ltn1) N-terminal domain, MONOCLINIC FORM 2015-12-19 2016-07-06 Doamekpor, S.K.,Lee, J.W.,Hepowit, N.L.,Wu, C.,Charenton, C.,Leonard, M.,Bengtson, M.H.,Rajashankar, K.R.,Sachs, M.S.,Lima, C.D.,Joazeiro, C.A. Structure and function of the yeast listerin (Ltn1) conserved N-terminal domain in binding to stalled 60S ribosomal subunits. Proc.Natl.Acad.Sci.USA 2016 113 0 0 5FG1 27385828 Structure of the conserved yeast listerin (Ltn1) selenomethionine-substituted N-terminal domain, TRIGONAL FORM 2015-12-19 2016-07-06 Doamekpor, S.K.,Lee, J.W.,Hepowit, N.L.,Wu, C.,Charenton, C.,Leonard, M.,Bengtson, M.H.,Rajashankar, K.R.,Sachs, M.S.,Lima, C.D.,Joazeiro, C.A. Structure and function of the yeast listerin (Ltn1) conserved N-terminal domain in binding to stalled 60S ribosomal subunits. Proc.Natl.Acad.Sci.USA 2016 113 0 0 5JMV 27302132 Crystal structure of mjKae1-pfuPcc1 complex 2016-04-29 2016-07-06 Wan, L.C.,Pillon, M.C.,Thevakumaran, N.,Sun, Y.,Chakrabartty, A.,Guarne, A.,Kurinov, I.,Durocher, D.,Sicheri, F. Structural and functional characterization of KEOPS dimerization by Pcc1 and its role in t6A biosynthesis. Nucleic Acids Res. 2016 44 6971 6980 4ZF6 27267136 Cytochrome P450 pentamutant from BM3 with bound PEG 2015-04-21 2016-07-13 Geronimo, I.,Denning, C.A.,Rogers, W.E.,Othman, T.,Huxford, T.,Heidary, D.K.,Glazer, E.C.,Payne, C.M. Effect of Mutation and Substrate Binding on the Stability of Cytochrome P450BM3 Variants. Biochemistry 2016 55 3594 3606 4ZF8 27267136 Cytochrome P450 pentamutant from BM3 with bound Metyrapone 2015-04-21 2016-07-13 Geronimo, I.,Denning, C.A.,Rogers, W.E.,Othman, T.,Huxford, T.,Heidary, D.K.,Glazer, E.C.,Payne, C.M. Effect of Mutation and Substrate Binding on the Stability of Cytochrome P450BM3 Variants. Biochemistry 2016 55 3594 3606 4ZFA 27267136 Cytochrome P450 wild type from BM3 with bound PEG 2015-04-21 2016-07-13 Geronimo, I.,Denning, C.A.,Rogers, W.E.,Othman, T.,Huxford, T.,Heidary, D.K.,Glazer, E.C.,Payne, C.M. Effect of Mutation and Substrate Binding on the Stability of Cytochrome P450BM3 Variants. Biochemistry 2016 55 3594 3606 4ZFB 27267136 Cytochrome P450 pentamutant from BM3 bound to Palmitic Acid 2015-04-21 2016-07-13 Geronimo, I.,Denning, C.A.,Rogers, W.E.,Othman, T.,Huxford, T.,Heidary, D.K.,Glazer, E.C.,Payne, C.M. Effect of Mutation and Substrate Binding on the Stability of Cytochrome P450BM3 Variants. Biochemistry 2016 55 3594 3606 5CI3 27276098 Ribonucleotide reductase Y122 2,3,5-F3Y variant 2015-07-10 2016-07-13 Oyala, P.H.,Ravichandran, K.R.,Funk, M.A.,Stucky, P.A.,Stich, T.A.,Drennan, C.L.,Britt, R.D.,Stubbe, J. Biophysical Characterization of Fluorotyrosine Probes Site-Specifically Incorporated into Enzymes: E. coli Ribonucleotide Reductase As an Example. J.Am.Chem.Soc. 2016 138 7951 7964 5K7C 27398999 The native structure of native pistol ribozyme 2016-05-26 2016-07-13 Ren, A.,Vusurovic, N.,Gebetsberger, J.,Gao, P.,Juen, M.,Kreutz, C.,Micura, R.,Patel, D.J. Pistol ribozyme adopts a pseudoknot fold facilitating site-specific in-line cleavage. Nat.Chem.Biol. 2016 12 702 708 5K7D 27398999 The structure of native pistol ribozyme, bound to Iridium 2016-05-26 2016-07-13 Ren, A.,Vusurovic, N.,Gebetsberger, J.,Gao, P.,Juen, M.,Kreutz, C.,Micura, R.,Patel, D.J. Pistol ribozyme adopts a pseudoknot fold facilitating site-specific in-line cleavage. Nat.Chem.Biol. 2016 12 702 708 5K7E 27398999 The structure of pistol ribozyme, soaked with Mn2+ 2016-05-26 2016-07-13 Ren, A.,Vusurovic, N.,Gebetsberger, J.,Gao, P.,Juen, M.,Kreutz, C.,Micura, R.,Patel, D.J. Pistol ribozyme adopts a pseudoknot fold facilitating site-specific in-line cleavage. Nat.Chem.Biol. 2016 12 702 708 5CBF 27678077 Structural and Functional Characterization of a Calcium-activated Cation channel from Tsukamurella Paurometabola 2015-06-30 2016-07-20 Dhakshnamoorthy, B.,Rohaim, A.,Rui, H.,Blachowicz, L.,Roux, B. Structural and functional characterization of a calcium-activated cation channel from Tsukamurella paurometabola. Nat Commun 2016 7 12753 12753 5CBG 27678077 Calcium activated non-selective cation channel 2015-06-30 2016-07-20 Dhakshnamoorthy, B.,Rohaim, A.,Rui, H.,Blachowicz, L.,Roux, B. Structural and functional characterization of a calcium-activated cation channel from Tsukamurella paurometabola. Nat Commun 2016 7 12753 12753 5CBH 27678077 Structural and Functional Characterization of a Calcium-activated Cation channel from Tsukamurella Paurometabola 2015-06-30 2016-07-20 Dhakshnamoorthy, B.,Rohaim, A.,Rui, H.,Blachowicz, L.,Roux, B. Structural and functional characterization of a calcium-activated cation channel from Tsukamurella paurometabola. Nat Commun 2016 7 12753 12753 5HYT 27595425 Structure of human C4b-binidng protein alpha chain CCP domains 1 and 2 in complex with the hypervariable region of group A Streptococcus M22 protein 2016-02-01 2016-07-20 Buffalo, C.Z.,Bahn-Suh, A.J.,Hirakis, S.P.,Biswas, T.,Amaro, R.E.,Nizet, V.,Ghosh, P. Conserved patterns hidden within group A Streptococcus M protein hypervariability recognize human C4b-binding protein. Nat Microbiol 2016 1 16155 16155 5IRS 27396824 crystal structure of the proteasomal Rpn13 PRU-domain 2016-03-14 2016-07-20 Chen, X.,Randles, L.,Shi, K.,Tarasov, S.G.,Aihara, H.,Walters, K.J. Structures of Rpn1 T1:Rad23 and hRpn13:hPLIC2 Reveal Distinct Binding Mechanisms between Substrate Receptors and Shuttle Factors of the Proteasome. Structure 2016 24 1257 1270 5J45 27452459 Crystal structure of Shrub, fly ortholog of SNF7/CHMP4B 2016-03-31 2016-07-20 McMillan, B.J.,Tibbe, C.,Jeon, H.,Drabek, A.A.,Klein, T.,Blacklow, S.C. Electrostatic Interactions between Elongated Monomers Drive Filamentation of Drosophila Shrub, a Metazoan ESCRT-III Protein. Cell Rep 2016 16 1211 1217 5KTB 22813733 Structure of a complex between S. cerevisiae Csm1 and Mam1 2016-07-11 2016-07-20 Corbett, K.D.,Harrison, S.C. Molecular architecture of the yeast monopolin complex. Cell Rep 2012 1 583 589 5CU9 CANDIDA ALBICANS SUPEROXIDE DISMUTASE 5 (SOD5), APO 2015-07-24 2016-07-27 Waninger-Saroni, J.J.,Taylor, A.B.,Hart, P.J.,Galaleldeen, A. CANDIDA ALBICANS SUPEROXIDE DISMUTASE 5 (SOD5), APO To Be Published 0 0 0 0 5DS9 26959646 Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT) 2015-09-17 2016-07-27 Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One 2016 11 0 0 5IM4 27463675 Crystal structure of designed two-component self-assembling icosahedral cage I52-32 2016-03-05 2016-07-27 Bale, J.B.,Gonen, S.,Liu, Y.,Sheffler, W.,Ellis, D.,Thomas, C.,Cascio, D.,Yeates, T.O.,Gonen, T.,King, N.P.,Baker, D. Accurate design of megadalton-scale two-component icosahedral protein complexes. Science 2016 353 389 394 5IM5 27463675 Crystal structure of designed two-component self-assembling icosahedral cage I53-40 2016-03-05 2016-07-27 Bale, J.B.,Gonen, S.,Liu, Y.,Sheffler, W.,Ellis, D.,Thomas, C.,Cascio, D.,Yeates, T.O.,Gonen, T.,King, N.P.,Baker, D. Accurate design of megadalton-scale two-component icosahedral protein complexes. Science 2016 353 389 394 5IM6 27463675 Crystal structure of designed two-component self-assembling icosahedral cage I32-28 2016-03-05 2016-07-27 Bale, J.B.,Gonen, S.,Liu, Y.,Sheffler, W.,Ellis, D.,Thomas, C.,Cascio, D.,Yeates, T.O.,Gonen, T.,King, N.P.,Baker, D. Accurate design of megadalton-scale two-component icosahedral protein complexes. Science 2016 353 389 394 5CYZ 27491543 Structure of S. cerevisiae Hrr25:Mam1 complex, form 1 2015-07-31 2016-08-03 Ye, Q.,Ur, S.N.,Su, T.Y.,Corbett, K.D. Structure of the Saccharomyces cerevisiae Hrr25:Mam1 monopolin subcomplex reveals a novel kinase regulator. Embo J. 2016 35 2139 2151 5K5S 27434672 Crystal structure of the active form of human calcium-sensing receptor extracellular domain 2016-05-23 2016-08-03 Geng, Y.,Mosyak, L.,Kurinov, I.,Zuo, H.,Sturchler, E.,Cheng, T.C.,Subramanyam, P.,Brown, A.P.,Brennan, S.C.,Mun, H.C.,Bush, M.,Chen, Y.,Nguyen, T.X.,Cao, B.,Chang, D.D.,Quick, M.,Conigrave, A.D.,Colecraft, H.M.,McDonald, P.,Fan, Q.R. Structural mechanism of ligand activation in human calcium-sensing receptor. Elife 2016 5 0 0 5K5T 27434672 Crystal structure of the inactive form of human calcium-sensing receptor extracellular domain 2016-05-23 2016-08-03 Geng, Y.,Mosyak, L.,Kurinov, I.,Zuo, H.,Sturchler, E.,Cheng, T.C.,Subramanyam, P.,Brown, A.P.,Brennan, S.C.,Mun, H.C.,Bush, M.,Chen, Y.,Nguyen, T.X.,Cao, B.,Chang, D.D.,Quick, M.,Conigrave, A.D.,Colecraft, H.M.,McDonald, P.,Fan, Q.R. Structural mechanism of ligand activation in human calcium-sensing receptor. Elife 2016 5 0 0 5CY5 31840320 Crystal structure of the T33-51H designed self-assembling protein tetrahedron 2015-07-30 2016-08-10 Cannon, K.A.,Park, R.U.,Boyken, S.E.,Nattermann, U.,Yi, S.,Baker, D.,King, N.P.,Yeates, T.O. Design and structure of two new protein cages illustrate successes and ongoing challenges in protein engineering. Protein Sci. 2020 29 919 929 5EXI 27506792 Crystal structure of M. tuberculosis lipoyl synthase at 2.28 A resolution 2015-11-23 2016-08-10 McLaughlin, M.I.,Lanz, N.D.,Goldman, P.J.,Lee, K.H.,Booker, S.J.,Drennan, C.L. Crystallographic snapshots of sulfur insertion by lipoyl synthase. Proc.Natl.Acad.Sci.USA 2016 113 9446 9450 5EXJ 27506792 Crystal structure of M. tuberculosis lipoyl synthase at 1.64 A resolution 2015-11-23 2016-08-10 McLaughlin, M.I.,Lanz, N.D.,Goldman, P.J.,Lee, K.H.,Booker, S.J.,Drennan, C.L. Crystallographic snapshots of sulfur insertion by lipoyl synthase. Proc.Natl.Acad.Sci.USA 2016 113 9446 9450 5EXK 27506792 Crystal structure of M. tuberculosis lipoyl synthase with 6-thiooctanoyl peptide intermediate 2015-11-23 2016-08-10 McLaughlin, M.I.,Lanz, N.D.,Goldman, P.J.,Lee, K.H.,Booker, S.J.,Drennan, C.L. Crystallographic snapshots of sulfur insertion by lipoyl synthase. Proc.Natl.Acad.Sci.USA 2016 113 9446 9450 5I2C 27487210 Arginine-bound CASTOR1 from Homo sapiens 2016-02-08 2016-08-10 Saxton, R.A.,Chantranupong, L.,Knockenhauer, K.E.,Schwartz, T.U.,Sabatini, D.M. Mechanism of arginine sensing by CASTOR1 upstream of mTORC1. Nature 2016 536 229 233 5K8K 27780190 Structure of the Haemophilus influenzae LpxH-lipid X complex 2016-05-30 2016-08-10 Cho, J.,Lee, C.J.,Zhao, J.,Young, H.E.,Zhou, P. Structure of the essential Haemophilus influenzae UDP-diacylglucosamine pyrophosphohydrolase LpxH in lipid A biosynthesis. Nat Microbiol 2016 1 16154 16154 5KK5 27444870 AsCpf1(E993A)-crRNA-DNA ternary complex 2016-06-21 2016-08-10 Gao, P.,Yang, H.,Rajashankar, K.R.,Huang, Z.,Patel, D.J. Type V CRISPR-Cas Cpf1 endonuclease employs a unique mechanism for crRNA-mediated target DNA recognition. Cell Res. 2016 26 901 913 5CUW Crystal structure of Sortase E1 from Streptomyces coelicolor with tripeptide in the active site 2015-07-25 2016-08-17 Kattke, M.D.,Cascio, D.,Sawaya, M.R.,Elliot, M.A.,Clubb, R.T. Crystal structure of the first class E sortase transpeptidase, SrtE1 from Streptomyces coelicolor To be published 0 0 0 0 5D7F X-ray structure of Ca(2+)-S100B with human RAGE-derived W72 peptide 2015-08-13 2016-08-17 Jensen, J.L.,Colbert, C.L. X-ray structure of Ca(2+)-S100B with human RAGE-derived W72 peptide To Be Published 0 0 0 0 5J1S 27490483 TorsinA-LULL1 complex, H. sapiens, bound to VHH-BS2 2016-03-29 2016-08-17 Demircioglu, F.E.,Sosa, B.A.,Ingram, J.,Ploegh, H.L.,Schwartz, T.U. Structures of TorsinA and its disease-mutant complexed with an activator reveal the molecular basis for primary dystonia. Elife 2016 5 0 0 5J1T 27490483 TorsinAdeltaE-LULL1 complex, H. sapiens, bound to VHH-BS2 2016-03-29 2016-08-17 Demircioglu, F.E.,Sosa, B.A.,Ingram, J.,Ploegh, H.L.,Schwartz, T.U. Structures of TorsinA and its disease-mutant complexed with an activator reveal the molecular basis for primary dystonia. Elife 2016 5 0 0 5L2R 27528683 Crystal structure of fumarate hydratase from Leishmania major 2016-08-02 2016-08-17 Feliciano, P.R.,Drennan, C.L.,Nonato, M.C. Crystal structure of an Fe-S cluster-containing fumarate hydratase enzyme from Leishmania major reveals a unique protein fold. Proc.Natl.Acad.Sci.USA 2016 113 9804 9809 5E7P 26953339 Crystal Structure of MSMEG_0858 (Uniprot A0QQS4), a AAA ATPase. 2015-10-12 2016-08-24 Unciuleac, M.C.,Smith, P.C.,Shuman, S. Crystal Structure and Biochemical Characterization of a Mycobacterium smegmatis AAA-Type Nucleoside Triphosphatase Phosphohydrolase (Msm0858). J.Bacteriol. 2016 198 1521 1533 4ZSN 27378776 70S-wild-type HigB toxin complex bound to a AAA lysine codon 2015-05-13 2016-09-07 Schureck, M.A.,Repack, A.,Miles, S.J.,Marquez, J.,Dunham, C.M. Mechanism of endonuclease cleavage by the HigB toxin. Nucleic Acids Res. 2016 44 7944 7953 5CCA Crystal structure of Mtb toxin 2015-07-01 2016-09-07 Cascio, D.,Arbing, M.,de Serrano, V.,Eisenberg, D.,Miallau, L.,TB Structural Genomics Consortium (TBSGC) Crystal structure of Mtb toxin To Be Published 0 0 0 0 5KDM 27581705 Crystal structure of EBV tegument protein BNRF1 in complex with histone chaperone DAXX and histones H3.3-H4 2016-06-08 2016-09-07 Huang, H.,Deng, Z.,Vladimirova, O.,Wiedmer, A.,Lu, F.,Lieberman, P.M.,Patel, D.J. Structural basis underlying viral hijacking of a histone chaperone complex. Nat Commun 2016 7 12707 12707 5KYN 27551091 Structure of Sec23 and TANGO1 complex 2016-07-21 2016-09-07 Ma, W.,Goldberg, J. TANGO1/cTAGE5 receptor as a polyvalent template for assembly of large COPII coats. Proc.Natl.Acad.Sci.USA 2016 113 10061 10066 5KYW 27551091 crystal structure of Sec23 and TANGO1 peptide3 complex 2016-07-22 2016-09-07 Ma, W.,Goldberg, J. TANGO1/cTAGE5 receptor as a polyvalent template for assembly of large COPII coats. Proc.Natl.Acad.Sci.USA 2016 113 10061 10066 5KYX 27551091 crystal structure of Sec23 and TANGO1 peptide1 complex 2016-07-22 2016-09-07 Ma, W.,Goldberg, J. TANGO1/cTAGE5 receptor as a polyvalent template for assembly of large COPII coats. Proc.Natl.Acad.Sci.USA 2016 113 10061 10066 5KYY 27551091 Crystal structure of Sec23 and TANGO1 peptide4 complex 2016-07-22 2016-09-07 Ma, W.,Goldberg, J. TANGO1/cTAGE5 receptor as a polyvalent template for assembly of large COPII coats. Proc.Natl.Acad.Sci.USA 2016 113 10061 10066 5KQR 27633330 Structure of NS5 methyltransferase from Zika virus bound to S-adenosylmethionine 2016-07-06 2016-09-14 Coloma, J.,Jain, R.,Rajashankar, K.R.,Garcia-Sastre, A.,Aggarwal, A.K. Structures of NS5 Methyltransferase from Zika Virus. Cell Rep 2016 16 3097 3102 5KYU 27551091 crystal structure of Sec23 and TANGO1 peptide2 complex 2016-07-22 2016-09-14 Ma, W.,Goldberg, J. TANGO1/cTAGE5 receptor as a polyvalent template for assembly of large COPII coats. Proc.Natl.Acad.Sci.USA 2016 113 10061 10066 4XHZ 27857071 Crystal Structure of Human Protocadherin-15 EC8-10 2015-01-06 2016-09-21 Araya-Secchi, R.,Neel, B.L.,Sotomayor, M. An elastic element in the protocadherin-15 tip link of the inner ear. Nat Commun 2016 7 13458 13458 5E08 27593161 Specific Recognition of a Single-stranded RNA Sequence by an Engineered Synthetic Antibody Fragment 2015-09-28 2016-09-21 Shao, Y.,Huang, H.,Qin, D.,Li, N.S.,Koide, A.,Staley, J.P.,Koide, S.,Kossiakoff, A.A.,Piccirilli, J.A. Specific Recognition of a Single-Stranded RNA Sequence by a Synthetic Antibody Fragment. J.Mol.Biol. 2016 428 4100 4114 5D08 27638883 Crystal structure of selenomethionine-labeled epoxyqueuosine reductase 2015-08-02 2016-09-28 Dowling, D.P.,Miles, Z.D.,Kohrer, C.,Maiocco, S.J.,Elliott, S.J.,Bandarian, V.,Drennan, C.L. Molecular basis of cobalamin-dependent RNA modification. Nucleic Acids Res. 2016 44 9965 9976 5D0A 27638883 Crystal structure of epoxyqueuosine reductase with cleaved RNA stem loop 2015-08-03 2016-09-28 Dowling, D.P.,Miles, Z.D.,Kohrer, C.,Maiocco, S.J.,Elliott, S.J.,Bandarian, V.,Drennan, C.L. Molecular basis of cobalamin-dependent RNA modification. Nucleic Acids Res. 2016 44 9965 9976 5D4N 27464895 Structure of CPII bound to ADP, AMP and acetate, from Thiomonas intermedia K12 2015-08-08 2016-09-28 Wheatley, N.M.,Eden, K.D.,Ngo, J.,Rosinski, J.S.,Sawaya, M.R.,Cascio, D.,Collazo, M.,Hoveida, H.,Hubbell, W.L.,Yeates, T.O. A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol. 2016 428 4013 4030 5D4P 27464895 Structure of CPII bound to ADP and bicarbonate, from Thiomonas intermedia K12 2015-08-08 2016-09-28 Wheatley, N.M.,Eden, K.D.,Ngo, J.,Rosinski, J.S.,Sawaya, M.R.,Cascio, D.,Collazo, M.,Hoveida, H.,Hubbell, W.L.,Yeates, T.O. A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein. J.Mol.Biol. 2016 428 4013 4030 5FAU 27642068 wild-type choline TMA lyase in complex with choline 2015-12-12 2016-09-28 Bodea, S.,Funk, M.A.,Balskus, E.P.,Drennan, C.L. Molecular Basis of C-N Bond Cleavage by the Glycyl Radical Enzyme Choline Trimethylamine-Lyase. Cell Chem Biol 2016 23 1206 1216 5FAV 27642068 E491Q mutant of choline TMA-lyase 2015-12-12 2016-09-28 Bodea, S.,Funk, M.A.,Balskus, E.P.,Drennan, C.L. Molecular Basis of C-N Bond Cleavage by the Glycyl Radical Enzyme Choline Trimethylamine-Lyase. Cell Chem Biol 2016 23 1206 1216 5FAW 27642068 T502A mutant of choline TMA-lyase 2015-12-12 2016-09-28 Bodea, S.,Funk, M.A.,Balskus, E.P.,Drennan, C.L. Molecular Basis of C-N Bond Cleavage by the Glycyl Radical Enzyme Choline Trimethylamine-Lyase. Cell Chem Biol 2016 23 1206 1216 5FAY 27642068 Y208F mutant of choline TMA-lyase 2015-12-12 2016-09-28 Bodea, S.,Funk, M.A.,Balskus, E.P.,Drennan, C.L. Molecular Basis of C-N Bond Cleavage by the Glycyl Radical Enzyme Choline Trimethylamine-Lyase. Cell Chem Biol 2016 23 1206 1216 5IUS 27618663 Crystal structure of human PD-L1 in complex with high affinity PD-1 mutant 2016-03-18 2016-09-28 Pascolutti, R.,Sun, X.,Kao, J.,Maute, R.L.,Ring, A.M.,Bowman, G.R.,Kruse, A.C. Structure and Dynamics of PD-L1 and an Ultra-High-Affinity PD-1 Receptor Mutant. Structure 2016 24 1719 1728 5K6Y 27644106 Sidekick-2 immunoglobulin domains 1-4, crystal form 2 2016-05-25 2016-09-28 Goodman, K.M.,Yamagata, M.,Jin, X.,Mannepalli, S.,Katsamba, P.S.,Ahlsen, G.,Sergeeva, A.P.,Honig, B.,Sanes, J.R.,Shapiro, L. Molecular basis of sidekick-mediated cell-cell adhesion and specificity. Elife 2016 5 0 0 5KDP 27642068 E491A mutant of choline TMA-lyase 2016-06-08 2016-09-28 Bodea, S.,Funk, M.A.,Balskus, E.P.,Drennan, C.L. Molecular Basis of C-N Bond Cleavage by the Glycyl Radical Enzyme Choline Trimethylamine-Lyase. Cell Chem Biol 2016 23 1206 1216 5KXI 27698419 X-ray structure of the human Alpha4Beta2 nicotinic receptor 2016-07-20 2016-09-28 Morales-Perez, C.L.,Noviello, C.M.,Hibbs, R.E. X-ray structure of the human alpha 4 beta 2 nicotinic receptor. Nature 2016 538 411 415 5SVM 27626375 Crystal structure of the ATP-gated human P2X3 ion channel bound to agonist 2-methylthio-ATP in the desensitized state 2016-08-06 2016-09-28 Mansoor, S.E.,Lu, W.,Oosterheert, W.,Shekhar, M.,Tajkhorshid, E.,Gouaux, E. X-ray structures define human P2X3 receptor gating cycle and antagonist action. Nature 2016 538 66 71 5SVP 27626375 Anomalous sulfur signal reveals the position of agonist 2-methylthio-ATP bound to the ATP-gated human P2X3 ion channel in the desensitized state 2016-08-07 2016-09-28 Mansoor, S.E.,Lu, W.,Oosterheert, W.,Shekhar, M.,Tajkhorshid, E.,Gouaux, E. X-ray structures define human P2X3 receptor gating cycle and antagonist action. Nature 2016 538 66 71 5SVT 27626375 Anomalous Cs+ signal reveals the site of Na+ ion entry to the channel pore of the human P2X3 ion channel through the extracellular fenestrations 2016-08-07 2016-09-28 Mansoor, S.E.,Lu, W.,Oosterheert, W.,Shekhar, M.,Tajkhorshid, E.,Gouaux, E. X-ray structures define human P2X3 receptor gating cycle and antagonist action. Nature 2016 538 66 71 5T8Y 27638883 Structure of epoxyqueuosine reductase from Bacillus subtilis with the Asp134 catalytic loop swung out of the active site. 2016-09-08 2016-09-28 Dowling, D.P.,Miles, Z.D.,Kohrer, C.,Maiocco, S.J.,Elliott, S.J.,Bandarian, V.,Drennan, C.L. Molecular basis of cobalamin-dependent RNA modification. Nucleic Acids Res. 2016 44 9965 9976 5KTJ 28096403 Crystal structure of Pistol, a class of self-cleaving ribozyme 2016-07-11 2016-10-05 Nguyen, L.A.,Wang, J.,Steitz, T.A. Crystal structure of Pistol, a class of self-cleaving ribozyme. Proc. Natl. Acad. Sci. U.S.A. 2017 114 1021 1026 5SVL 27626375 Crystal structure of the ATP-gated human P2X3 ion channel in the ATP-bound, closed (desensitized) state 2016-08-06 2016-10-05 Mansoor, S.E.,Lu, W.,Oosterheert, W.,Shekhar, M.,Tajkhorshid, E.,Gouaux, E. X-ray structures define human P2X3 receptor gating cycle and antagonist action. Nature 2016 538 66 71 5SVQ 27626375 Crystal structure of the ATP-gated human P2X3 ion channel bound to competitive antagonist TNP-ATP 2016-08-07 2016-10-05 Mansoor, S.E.,Lu, W.,Oosterheert, W.,Shekhar, M.,Tajkhorshid, E.,Gouaux, E. X-ray structures define human P2X3 receptor gating cycle and antagonist action. Nature 2016 538 66 71 5T0K 27648579 Structure of G9a SET-domain with H3K9M mutant peptide and SAM 2016-08-16 2016-10-05 Shan, C.M.,Wang, J.,Xu, K.,Chen, H.,Yue, J.X.,Andrews, S.,Moresco, J.J.,Yates, J.R.,Nagy, P.L.,Tong, L.,Jia, S. A histone H3K9M mutation traps histone methyltransferase Clr4 to prevent heterochromatin spreading. Elife 2016 5 0 0 5T0M 27648579 A histone H3K9M mutation traps histone methyltransferase Clr4 to prevent heterochromatin spreading 2016-08-16 2016-10-05 Shan, C.M.,Wang, J.,Xu, K.,Chen, H.,Yue, J.X.,Andrews, S.,Moresco, J.J.,Yates, J.R.,Nagy, P.L.,Tong, L.,Jia, S. A histone H3K9M mutation traps histone methyltransferase Clr4 to prevent heterochromatin spreading. Elife 2016 5 0 0 5T0N 27649739 Pseudo-apo structure of Sestrin2 at 3.0 angstrom resolution 2016-08-16 2016-10-05 Saxton, R.A.,Knockenhauer, K.E.,Schwartz, T.U.,Sabatini, D.M. The apo-structure of the leucine sensor Sestrin2 is still elusive. Sci.Signal. 2016 9 0 0 5CZP 27681416 70S termination complex containing E. coli RF2 2015-07-31 2016-10-12 Pierson, W.E.,Hoffer, E.D.,Keedy, H.E.,Simms, C.L.,Dunham, C.M.,Zaher, H.S. Uniformity of Peptide Release Is Maintained by Methylation of Release Factors. Cell Rep 2016 17 11 18 5DFE 27681416 70S termination complex containing E. coli RF2 2015-08-26 2016-10-12 Pierson, W.E.,Hoffer, E.D.,Keedy, H.E.,Simms, C.L.,Dunham, C.M.,Zaher, H.S. Uniformity of Peptide Release Is Maintained by Methylation of Release Factors. Cell Rep 2016 17 11 18 5J30 27681416 Thermus thermophilus 70S termination complex containing E. coli RF1 2016-03-30 2016-10-12 Pierson, W.E.,Hoffer, E.D.,Keedy, H.E.,Simms, C.L.,Dunham, C.M.,Zaher, H.S. Uniformity of Peptide Release Is Maintained by Methylation of Release Factors. Cell Rep 2016 17 11 18 5J3C 27681416 Thermus thermophilus 70S termination complex containing E. coli RF1 2016-03-30 2016-10-12 Pierson, W.E.,Hoffer, E.D.,Keedy, H.E.,Simms, C.L.,Dunham, C.M.,Zaher, H.S. Uniformity of Peptide Release Is Maintained by Methylation of Release Factors. Cell Rep 2016 17 11 18 5KJ8 27731796 Structure of the Ca2+-bound synaptotagmin-1 SNARE complex (long unit cell form) - from synchrotron diffraction 2016-06-17 2016-10-19 Lyubimov, A.Y.,Uervirojnangkoorn, M.,Zeldin, O.B.,Zhou, Q.,Zhao, M.,Brewster, A.S.,Michels-Clark, T.,Holton, J.M.,Sauter, N.K.,Weis, W.I.,Brunger, A.T. Advances in X-ray free electron laser (XFEL) diffraction data processing applied to the crystal structure of the synaptotagmin-1 / SNARE complex. Elife 2016 5 0 0 5L1B 27618672 AMPA subtype ionotropic glutamate receptor GluA2 in Apo state 2016-07-28 2016-10-19 Yelshanskaya, M.V.,Singh, A.K.,Sampson, J.M.,Narangoda, C.,Kurnikova, M.,Sobolevsky, A.I. Structural Bases of Noncompetitive Inhibition of AMPA-Subtype Ionotropic Glutamate Receptors by Antiepileptic Drugs. Neuron 2016 91 1305 1315 5L1E 27618672 AMPA subtype ionotropic glutamate receptor GluA2 in complex with noncompetitive inhibitor CP465022 2016-07-29 2016-10-19 Yelshanskaya, M.V.,Singh, A.K.,Sampson, J.M.,Narangoda, C.,Kurnikova, M.,Sobolevsky, A.I. Structural Bases of Noncompetitive Inhibition of AMPA-Subtype Ionotropic Glutamate Receptors by Antiepileptic Drugs. Neuron 2016 91 1305 1315 5L1F 27618672 AMPA subtype ionotropic glutamate receptor GluA2 in complex with noncompetitive inhibitor Perampanel 2016-07-29 2016-10-19 Yelshanskaya, M.V.,Singh, A.K.,Sampson, J.M.,Narangoda, C.,Kurnikova, M.,Sobolevsky, A.I. Structural Bases of Noncompetitive Inhibition of AMPA-Subtype Ionotropic Glutamate Receptors by Antiepileptic Drugs. Neuron 2016 91 1305 1315 5L1G 27618672 AMPA subtype ionotropic glutamate receptor GluA2 in complex with GYKI-Br 2016-07-29 2016-10-19 Yelshanskaya, M.V.,Singh, A.K.,Sampson, J.M.,Narangoda, C.,Kurnikova, M.,Sobolevsky, A.I. Structural Bases of Noncompetitive Inhibition of AMPA-Subtype Ionotropic Glutamate Receptors by Antiepileptic Drugs. Neuron 2016 91 1305 1315 5L1H 27618672 AMPA subtype ionotropic glutamate receptor GluA2 in complex with noncompetitive inhibitor GYKI53655 2016-07-29 2016-10-19 Yelshanskaya, M.V.,Singh, A.K.,Sampson, J.M.,Narangoda, C.,Kurnikova, M.,Sobolevsky, A.I. Structural Bases of Noncompetitive Inhibition of AMPA-Subtype Ionotropic Glutamate Receptors by Antiepileptic Drugs. Neuron 2016 91 1305 1315 5SZO 27782885 Protocadherin Gamma B7 extracellular cadherin domains 1-4 P41212 crystal form 2016-08-14 2016-10-19 Goodman, K.M.,Rubinstein, R.,Thu, C.A.,Mannepalli, S.,Bahna, F.,Ahlsen, G.,Rittenhouse, C.,Maniatis, T.,Honig, B.,Shapiro, L. gamma-Protocadherin structural diversity and functional implications. Elife 2016 5 0 0 5SZP 27782885 Protocadherin Gamma B7 extracellular cadherin domains 1-4 P21 crystal form 2016-08-14 2016-10-19 Goodman, K.M.,Rubinstein, R.,Thu, C.A.,Mannepalli, S.,Bahna, F.,Ahlsen, G.,Rittenhouse, C.,Maniatis, T.,Honig, B.,Shapiro, L. gamma-Protocadherin structural diversity and functional implications. Elife 2016 5 0 0 5SZR 27782885 Protocadherin Gamma B2 extracellular cadherin domains 3-6 2016-08-14 2016-10-19 Goodman, K.M.,Rubinstein, R.,Thu, C.A.,Mannepalli, S.,Bahna, F.,Ahlsen, G.,Rittenhouse, C.,Maniatis, T.,Honig, B.,Shapiro, L. gamma-Protocadherin structural diversity and functional implications. Elife 2016 5 0 0 5FCW 27374062 HDAC8 Complexed with a Hydroxamic Acid 2015-12-15 2016-10-26 Tabackman, A.A.,Frankson, R.,Marsan, E.S.,Perry, K.,Cole, K.E. Structure of 'linkerless' hydroxamic acid inhibitor-HDAC8 complex confirms the formation of an isoform-specific subpocket. J.Struct.Biol. 2016 195 373 378 5T6O 27742839 Structure of the catalytic domain of the class I polyhydroxybutyrate synthase from Cupriavidus necator 2016-09-01 2016-10-26 Wittenborn, E.C.,Jost, M.,Wei, Y.,Stubbe, J.,Drennan, C.L. Structure of the Catalytic Domain of the Class I Polyhydroxybutyrate Synthase from Cupriavidus necator. J.Biol.Chem. 2016 291 25264 25277 5CO1 27787195 Crystal Structure of Zebrafish Protocadherin-19 EC3-4 2015-07-19 2016-11-02 Cooper, S.R.,Jontes, J.D.,Sotomayor, M. Structural determinants of adhesion by Protocadherin-19 and implications for its role in epilepsy. Elife 2016 5 0 0 5CYX Crystal Structure of Mouse Protocadherin-24 EC1-3 2015-07-31 2016-11-02 Johnson, Z.R.,Sotomayor, M. Crystal Structure of Mouse Protocadherin-24 EC1-3 To Be Published 0 0 0 0 5CZR Crystal Structure of Human Protocadherin-24 EC1-2 2015-08-01 2016-11-02 Johnson, Z.R.,Sotomayor, M. Crystal Structure of Human Protocadherin-24 EC1-2 To Be Published 0 0 0 0 5K36 27818140 Structure of an eleven component nuclear RNA exosome complex bound to RNA 2016-05-19 2016-11-02 Zinder, J.C.,Wasmuth, E.V.,Lima, C.D. Nuclear RNA Exosome at 3.1 angstrom Reveals Substrate Specificities, RNA Paths, and Allosteric Inhibition of Rrp44/Dis3. Mol.Cell 2016 64 734 745 5SYT 27774687 Crystal Structure of ZMPSTE24 2016-08-11 2016-11-02 Clark, K.M.,Jenkins, J.L.,Fedoriw, N.,Dumont, M.E. Human CaaX protease ZMPSTE24 expressed in yeast: Structure and inhibition by HIV protease inhibitors. Protein Sci. 2017 26 242 257 5SZQ 27782885 Protocadherin Gamma A4 extracellular cadherin domains 3-6 2016-08-14 2016-11-02 Goodman, K.M.,Rubinstein, R.,Thu, C.A.,Mannepalli, S.,Bahna, F.,Ahlsen, G.,Rittenhouse, C.,Maniatis, T.,Honig, B.,Shapiro, L. gamma-Protocadherin structural diversity and functional implications. Elife 2016 5 0 0 5TAR 27791178 Crystal structure of farnesylated and methylated kras4b in complex with PDE-delta (crystal form II - with ordered hypervariable region) 2016-09-10 2016-11-02 Dharmaiah, S.,Bindu, L.,Tran, T.H.,Gillette, W.K.,Frank, P.H.,Ghirlando, R.,Nissley, D.V.,Esposito, D.,McCormick, F.,Stephen, A.G.,Simanshu, D.K. Structural basis of recognition of farnesylated and methylated KRAS4b by PDE delta. Proc.Natl.Acad.Sci.USA 2016 113 0 0 5L0Q 27503072 Crystal structure of the complex between ADAM10 D+C domain and a conformation specific mAb 8C7. 2016-07-28 2016-11-09 Atapattu, L.,Saha, N.,Chheang, C.,Eissman, M.F.,Xu, K.,Vail, M.E.,Hii, L.,Llerena, C.,Liu, Z.,Horvay, K.,Abud, H.E.,Kusebauch, U.,Moritz, R.L.,Ding, B.S.,Cao, Z.,Rafii, S.,Ernst, M.,Scott, A.M.,Nikolov, D.B.,Lackmann, M.,Janes, P.W. An activated form of ADAM10 is tumor selective and regulates cancer stem-like cells and tumor growth. J.Exp.Med. 2016 213 1741 1757 5T51 27881300 Structure of the MIND Complex Shows a Regulatory Focus of Yeast Kinetochore Assembly 2016-08-30 2016-11-09 Dimitrova, Y.N.,Jenni, S.,Valverde, R.,Khin, Y.,Harrison, S.C. Structure of the MIND Complex Defines a Regulatory Focus for Yeast Kinetochore Assembly. Cell 2016 167 1014 0 5T58 27881300 Structure of the MIND Complex Shows a Regulatory Focus of Yeast Kinetochore Assembly 2016-08-30 2016-11-09 Dimitrova, Y.N.,Jenni, S.,Valverde, R.,Khin, Y.,Harrison, S.C. Structure of the MIND Complex Defines a Regulatory Focus for Yeast Kinetochore Assembly. Cell 2016 167 1014 0 5T59 27881300 Structure of the MIND Complex Shows a Regulatory Focus of Yeast Kinetochore Assembly 2016-08-30 2016-11-09 Dimitrova, Y.N.,Jenni, S.,Valverde, R.,Khin, Y.,Harrison, S.C. Structure of the MIND Complex Defines a Regulatory Focus for Yeast Kinetochore Assembly. Cell 2016 167 1014 0 5T6J 27881300 Structure of the MIND Complex Shows a Regulatory Focus of Yeast Kinetochore Assembly 2016-09-01 2016-11-09 Dimitrova, Y.N.,Jenni, S.,Valverde, R.,Khin, Y.,Harrison, S.C. Structure of the MIND Complex Defines a Regulatory Focus for Yeast Kinetochore Assembly. Cell 2016 167 1014 0 5TD8 27851957 Crystal structure of an Extended Dwarf Ndc80 Complex 2016-09-17 2016-11-16 Valverde, R.,Ingram, J.,Harrison, S.C. Conserved Tetramer Junction in the Kinetochore Ndc80 Complex. Cell Rep 2016 17 1915 1922 5TK7 27849620 Structure of the HD-domain phosphohydrolase OxsA with Oxetanocin-A triphosphate bound 2016-10-06 2016-11-16 Bridwell-Rabb, J.,Kang, G.,Zhong, A.,Liu, H.W.,Drennan, C.L. An HD domain phosphohydrolase active site tailored for oxetanocin-A biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 2016 113 13750 13755 5TK8 27849620 Structure of the HD-domain phosphohydrolase OxsA with Oxetanocin-A monophosphate bound 2016-10-06 2016-11-16 Bridwell-Rabb, J.,Kang, G.,Zhong, A.,Liu, H.W.,Drennan, C.L. An HD domain phosphohydrolase active site tailored for oxetanocin-A biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 2016 113 13750 13755 5TK9 27849620 Structure of the HD-domain phosphohydrolase OxsA with Oxetanocin-A bound 2016-10-06 2016-11-16 Bridwell-Rabb, J.,Kang, G.,Zhong, A.,Liu, H.W.,Drennan, C.L. An HD domain phosphohydrolase active site tailored for oxetanocin-A biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 2016 113 13750 13755 5KTE 27839948 Crystal structure of Deinococcus radiodurans MntH, an Nramp-family transition metal transporter 2016-07-11 2016-11-23 Bozzi, A.T.,Bane, L.B.,Weihofen, W.A.,Singharoy, A.,Guillen, E.R.,Ploegh, H.L.,Schulten, K.,Gaudet, R. Crystal Structure and Conformational Change Mechanism of a Bacterial Nramp-Family Divalent Metal Transporter. Structure 2016 24 2102 2114 5KTE 27839948 Crystal structure of Deinococcus radiodurans MntH, an Nramp-family transition metal transporter 2016-07-11 2016-11-23 Bozzi, A.T.,Bane, L.B.,Weihofen, W.A.,Singharoy, A.,Guillen, E.R.,Ploegh, H.L.,Schulten, K.,Gaudet, R. Crystal Structure and Conformational Change Mechanism of a Bacterial Nramp-Family Divalent Metal Transporter. Structure 2016 24 2102 2114 5L2X 27819052 Crystal structure of human PrimPol ternary complex 2016-08-02 2016-11-23 Rechkoblit, O.,Gupta, Y.K.,Malik, R.,Rajashankar, K.R.,Johnson, R.E.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structure and mechanism of human PrimPol, a DNA polymerase with primase activity. Sci Adv 2016 2 0 0 5TCS 27851957 Crystal structure of a Dwarf Ndc80 Tetramer 2016-09-15 2016-11-23 Valverde, R.,Ingram, J.,Harrison, S.C. Conserved Tetramer Junction in the Kinetochore Ndc80 Complex. Cell Rep 2016 17 1915 1922 5TK6 27849620 Structure of the HD-domain phosphohydrolase OxsA with Oxetanocin-A diphosphate bound 2016-10-06 2016-11-23 Bridwell-Rabb, J.,Kang, G.,Zhong, A.,Liu, H.W.,Drennan, C.L. An HD domain phosphohydrolase active site tailored for oxetanocin-A biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 2016 113 13750 13755 5IWD 28183184 HCMV DNA polymerase subunit UL44 complex with a small molecule 2016-03-22 2016-11-30 Chen, H.,Coseno, M.,Ficarro, S.B.,Mansueto, M.S.,Komazin-Meredith, G.,Boissel, S.,Filman, D.J.,Marto, J.A.,Hogle, J.M.,Coen, D.M. A Small Covalent Allosteric Inhibitor of Human Cytomegalovirus DNA Polymerase Subunit Interactions. ACS Infect Dis 2017 3 112 118 5IXA 28183184 HCMV DNA polymerase processivity subunit UL44 at neutral pH and low salt 2016-03-23 2016-11-30 Chen, H.,Coseno, M.,Ficarro, S.B.,Mansueto, M.S.,Komazin-Meredith, G.,Boissel, S.,Filman, D.J.,Marto, J.A.,Hogle, J.M.,Coen, D.M. A Small Covalent Allosteric Inhibitor of Human Cytomegalovirus DNA Polymerase Subunit Interactions. ACS Infect Dis 2017 3 112 118 5J56 27903650 RTA-V1C7 2016-04-01 2016-12-07 Rudolph, M.J.,Vance, D.J.,Cassidy, M.S.,Rong, Y.,Mantis, N.J. Structural Analysis of Single Domain Antibodies Bound to a Second Neutralizing Hot Spot on Ricin Toxin's Enzymatic Subunit. J. Biol. Chem. 2017 292 872 883 5K73 as-isolated Dbr1 with Fe(II) and Zn(II) 2016-05-25 2016-12-07 Clark, N.E.,Katolik, A.,Roberts, K.,Taylor, A.B.,Holloway, S.P.,Schuermann, J.P.,Montemayor, E.J.,Stevens, S.W.,Fitzpatrick, P.F.,Damha, M.J.,Hart, P.J. The RNA lariat debranching enzyme Dbr1: metal dependence and branched RNA co-crystal structures Proc.Natl.Acad.Sci.USA 2016 0 0 0 5K77 27930312 Dbr1 in complex with 7-mer branched RNA 2016-05-25 2016-12-07 Clark, N.E.,Katolik, A.,Roberts, K.M.,Taylor, A.B.,Holloway, S.P.,Schuermann, J.P.,Montemayor, E.J.,Stevens, S.W.,Fitzpatrick, P.F.,Damha, M.J.,Hart, P.J. Metal dependence and branched RNA cocrystal structures of the RNA lariat debranching enzyme Dbr1. Proc. Natl. Acad. Sci. U.S.A. 2016 113 14727 14732 5K78 Dbr1 in complex with 16-mer branched RNA 2016-05-25 2016-12-07 Clark, N.E.,Katolik, A.,Roberts, K.,Taylor, A.B.,Holloway, S.P.,Schuermann, J.P.,Montemayor, E.J.,Stevens, S.W.,Fitzpatrick, P.F.,Damha, M.J.,Hart, P.J. The RNA lariat debranching enzyme Dbr1: metal dependence and branched RNA co-crystal structures Proc.Natl.Acad.Sci.USA 2016 0 0 0 5JY6 27875551 Structures of Streptococcus agalactiae GBS GAPDH in different enzymatic states 2016-05-13 2016-12-21 Schormann, N.,Ayres, C.A.,Fry, A.,Green, T.J.,Banerjee, S.,Ulett, G.C.,Chattopadhyay, D. Crystal Structures of Group B Streptococcus Glyceraldehyde-3-Phosphate Dehydrogenase: Apo-Form, Binary and Ternary Complexes. PLoS ONE 2016 11 0 0 5JYE 27875551 Structures of Streptococcus agalactiae GBS GAPDH in different enzymatic states 2016-05-13 2016-12-21 Schormann, N.,Ayres, C.A.,Fry, A.,Green, T.J.,Banerjee, S.,Ulett, G.C.,Chattopadhyay, D. Crystal Structures of Group B Streptococcus Glyceraldehyde-3-Phosphate Dehydrogenase: Apo-Form, Binary and Ternary Complexes. PLoS ONE 2016 11 0 0 5JYF 27875551 Structures of Streptococcus agalactiae GBS GAPDH in different enzymatic states 2016-05-13 2016-12-21 Schormann, N.,Ayres, C.A.,Fry, A.,Green, T.J.,Banerjee, S.,Ulett, G.C.,Chattopadhyay, D. Crystal Structures of Group B Streptococcus Glyceraldehyde-3-Phosphate Dehydrogenase: Apo-Form, Binary and Ternary Complexes. PLoS ONE 2016 11 0 0 5TJW 27965447 Influenza A virus Nucleoprotein in Complex with Inhibitory Nanobody 2016-10-05 2016-12-21 Hanke, L.,Knockenhauer, K.E.,Brewer, R.C.,van Diest, E.,Schmidt, F.I.,Schwartz, T.U.,Ploegh, H.L. The Antiviral Mechanism of an Influenza A Virus Nucleoprotein-Specific Single-Domain Antibody Fragment. MBio 2016 7 0 0 5TU8 27872164 Crystal structure of Staphylococcus epidermidis Aap G58-spacer-G513* (variant G5-spacer-variant G5) 2016-11-05 2016-12-21 Shelton, C.L.,Conrady, D.G.,Herr, A.B. Functional consequences of B-repeat sequence variation in the staphylococcal biofilm protein Aap: deciphering the assembly code. Biochem. J. 2017 474 427 443 5SWW 27991903 Crystal Structure of Human APOBEC3A complexed with ssDNA 2016-08-09 2016-12-28 Shi, K.,Carpenter, M.A.,Banerjee, S.,Shaban, N.M.,Kurahashi, K.,Salamango, D.J.,McCann, J.L.,Starrett, G.J.,Duffy, J.V.,Demir, O.,Amaro, R.E.,Harki, D.A.,Harris, R.S.,Aihara, H. Structural basis for targeted DNA cytosine deamination and mutagenesis by APOBEC3A and APOBEC3B. Nat. Struct. Mol. Biol. 2017 24 131 139 5T77 28024149 Crystal structure of the MOP flippase MurJ 2016-09-02 2016-12-28 Kuk, A.C.,Mashalidis, E.H.,Lee, S.Y. Crystal structure of the MOP flippase MurJ in an inward-facing conformation. Nat. Struct. Mol. Biol. 2017 24 171 176 5TD5 27991903 Crystal Structure of Human APOBEC3B variant complexed with ssDNA 2016-09-16 2016-12-28 Shi, K.,Carpenter, M.A.,Banerjee, S.,Shaban, N.M.,Kurahashi, K.,Salamango, D.J.,McCann, J.L.,Starrett, G.J.,Duffy, J.V.,Demir, O.,Amaro, R.E.,Harki, D.A.,Harris, R.S.,Aihara, H. Structural basis for targeted DNA cytosine deamination and mutagenesis by APOBEC3A and APOBEC3B. Nat. Struct. Mol. Biol. 2017 24 131 139 5HAN Structure function studies of R. palustris RubisCO (S59F mutant; CABP-bound) 2015-12-30 2017-01-04 Arbing, M.A.,Satagopan, S.,Varaljay, V.A.,Leong, J.G.,Tabita, F.R. Structure function studies of R. palustris RubisCO To Be Published 0 0 0 0 5HAO Structure function studies of R. palustris RubisCO (M331A mutant; CABP-bound) 2015-12-30 2017-01-04 Arbing, M.A.,Satagopan, S.,Varaljay, V.A.,Shin, A.,Tabita, F.R. Structure function studies of R. palustris RubisCO. To Be Published 0 0 0 0 5HAT Structure function studies of R. palustris RubisCO (S59F/M331A mutant; CABP-bound) 2015-12-30 2017-01-04 Arbing, M.A.,Satagopan, S.,Varaljay, V.A.,Leong, J.G.,Tabita, F.R. Structure function studies of R. palustris RubisCO. To Be Published 0 0 0 0 5HBD Filamentous Assembly of Green Fluorescent Protein Supported by a C-terminal fusion of 18-residues, viewed in space group C2 2015-12-31 2017-01-04 Sawaya, M.R.,Hochschild, A.,Heller, D.M.,McPartland, L.,Eisenberg, D.S. Green Fluorescent Protein Fusion that Self Assembles as Polar Filaments to be published 0 0 0 0 5U1L 27935479 Crystal structure of the ATP-gated P2X7 ion channel in the closed, apo state 2016-11-28 2017-01-04 Karasawa, A.,Kawate, T. Structural basis for subtype-specific inhibition of the P2X7 receptor. Elife 2016 5 0 0 5U2H 27935479 Crystal structure of the ATP-gated P2X7 ion channel bound to ATP and allosteric antagonist A804598 2016-11-30 2017-01-04 Karasawa, A.,Kawate, T. Structural basis for subtype-specific inhibition of the P2X7 receptor. Elife 2016 5 0 0 5HGE Filamentous Assembly of Green Fluorescent Protein Supported by a C-terminal fusion of 18-residues, viewed in space group P212121 2016-01-08 2017-01-11 Sawaya, M.R.,Hochschild, A.,Heller, D.M.,McPartland, L.,Eisenberg, D.S. Green Fluorescent Protein Fusion that Self Assembles as Polar Filaments to be published 0 0 0 0 5TF6 28045380 Structure and conformational plasticity of the U6 small nuclear ribonucleoprotein core 2016-09-24 2017-01-11 Montemayor, E.J.,Didychuk, A.L.,Liao, H.,Hu, P.,Brow, D.A.,Butcher, S.E. Structure and conformational plasticity of the U6 small nuclear ribonucleoprotein core. Acta Crystallogr D Struct Biol 2017 73 1 8 5UBF 28031373 Crystal structure of the RctB domains 2-3, RctB-155-483 2016-12-20 2017-01-11 Orlova, N.,Gerding, M.,Ivashkiv, O.,Olinares, P.D.B.,Chait, B.T.,Waldor, M.K.,Jeruzalmi, D. The replication initiator of the cholera pathogen's second chromosome shows structural similarity to plasmid initiators. Nucleic Acids Res. 2017 45 3724 3737 5UDP 27905149 High resolution x-ray crystal structure of synthetic insulin lispro 2016-12-28 2017-01-11 Dhayalan, B.,Mandal, K.,Rege, N.,Weiss, M.A.,Eitel, S.H.,Meier, T.,Schoenleber, R.O.,Kent, S.B. Scope and Limitations of Fmoc Chemistry SPPS-Based Approaches to the Total Synthesis of Insulin Lispro via Ester Insulin. Chemistry 2017 23 1709 1716 5HJX Structure function studies of R. palustris RubisCO (A47V mutant; CABP-bound) 2016-01-13 2017-01-18 Arbing, M.A.,Satagopan, S.,Varaljay, V.A.,Shin, A.,Tabita, F.R. Structure function studies of R. palustris RubisCO. To Be Published 0 0 0 0 5HJY Structure function studies of R. palustris RubisCO (I165T mutant; CABP-bound) 2016-01-13 2017-01-18 Arbing, M.A.,Satagopan, S.,Varaljay, V.A.,Shin, A.,Tabita, F.R. Structure function studies of R. palustris RubisCO. To Be Published 0 0 0 0 5HK4 Structure function studies of R. palustris RubisCO (A47V-M331A mutant) 2016-01-13 2017-01-18 Arbing, M.A.,Satagopan, S.,Varaljay, V.A.,Tabita, F.R. Structure function studies of R. palustris RubisCO. To Be Published 0 0 0 0 5SUP 28059701 Crystal structure of the Sub2-Yra1 complex in association with RNA 2016-08-03 2017-01-18 Ren, Y.,Schmiege, P.,Blobel, G. Structural and biochemical analyses of the DEAD-box ATPase Sub2 in association with THO or Yra1. Elife 2017 6 0 0 5SUQ 28059701 Crystal structure of the THO-Sub2 complex 2016-08-03 2017-01-18 Ren, Y.,Schmiege, P.,Blobel, G. Structural and biochemical analyses of the DEAD-box ATPase Sub2 in association with THO or Yra1. Elife 2017 6 0 0 5HQL Structure function studies of R. palustris RubisCO (A47V-M331A mutant; CABP-bound; no expression tag) 2016-01-21 2017-01-25 Arbing, M.A.,Shin, A.,Cascio, D.,Satagopan, S.,Varaljay, V.A.,Tabita, F.R. Structure function studies of R. palustris RubisCO To Be Published 0 0 0 0 5HQM Structure function studies of R. palustris RubisCO (R. palustris/R. rubrum chimera) 2016-01-21 2017-01-25 Arbing, M.A.,Satagopan, S.,Varaljay, V.A.,Tabita, F.R. Structure function studies of R. palustris RubisCO. To Be Published 0 0 0 0 5I5A 28194851 quasi racemic structure of allo-Ile7-ShK and D-ShK 2016-02-14 2017-01-25 Dang, B.,Shen, R.,Kubota, T.,Mandal, K.,Bezanilla, F.,Roux, B.,Kent, S.B. Inversion of the Side-Chain Stereochemistry of Indvidual Thr or Ile Residues in a Protein Molecule: Impact on the Folding, Stability, and Structure of the ShK Toxin. Angew. Chem. Int. Ed. Engl. 2017 56 3324 3328 5I5B 28194851 quasi racemic structure of allo-Thr13-ShK and D-ShK 2016-02-15 2017-01-25 Dang, B.,Shen, R.,Kubota, T.,Mandal, K.,Bezanilla, F.,Roux, B.,Kent, S.B. Inversion of the Side-Chain Stereochemistry of Indvidual Thr or Ile Residues in a Protein Molecule: Impact on the Folding, Stability, and Structure of the ShK Toxin. Angew. Chem. Int. Ed. Engl. 2017 56 3324 3328 5I5C 28194851 X-ray crystal structure of allo-Thr31-ShK 2016-02-15 2017-01-25 Dang, B.,Shen, R.,Kubota, T.,Mandal, K.,Bezanilla, F.,Roux, B.,Kent, S.B. Inversion of the Side-Chain Stereochemistry of Indvidual Thr or Ile Residues in a Protein Molecule: Impact on the Folding, Stability, and Structure of the ShK Toxin. Angew. Chem. Int. Ed. Engl. 2017 56 3324 3328 5JRW Crystal structure of Thermotoga maritima mutant D89R/D253R 2016-05-06 2017-01-25 Kowatz, T.,Maguire, M. Crystal structure of Thermotoga maritima mutant D89R/D253R To Be Published 0 0 0 0 5U30 27984729 Crystal structure of AacC2c1-sgRNA-extended target DNA ternary complex 2016-12-01 2017-01-25 Yang, H.,Gao, P.,Rajashankar, K.R.,Patel, D.J. PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease. Cell 2016 167 1814 0 5U33 27984729 Crystal structure of AacC2c1-sgRNA-extended non-target DNA ternary complex 2016-12-01 2017-01-25 Yang, H.,Gao, P.,Rajashankar, K.R.,Patel, D.J. PAM-Dependent Target DNA Recognition and Cleavage by C2c1 CRISPR-Cas Endonuclease. Cell 2016 167 1814 0 5HW9 Filamentous Assembly of Green Fluorescent Protein Supported by a C-terminal fusion of 18-residues, viewed in space group P21 2016-01-29 2017-02-01 Sawaya, M.R.,Hochschild, A.,Heller, D.M.,McPartland, L.,Eisenberg, D.S. Green Fluorescent Protein Fusion that Self Assembles as Polar Filaments to be published 0 0 0 0 5L2Q 28089446 Serine/threonine-protein kinase 40 (STK40) kinase homology domain 2016-08-02 2017-02-01 Durzynska, I.,Xu, X.,Adelmant, G.,Ficarro, S.B.,Marto, J.A.,Sliz, P.,Uljon, S.,Blacklow, S.C. STK40 Is a Pseudokinase that Binds the E3 Ubiquitin Ligase COP1. Structure 2017 25 287 294 5U3G 28096518 Structure of the Dickeya dadantii ykkC riboswitch bound to guanidinium 2016-12-02 2017-02-01 Battaglia, R.A.,Price, I.R.,Ke, A. Structural basis for guanidine sensing by the ykkC family of riboswitches. RNA 2017 23 578 585 5TTJ 27933790 Crystal Structure of Nicotine Oxidoreductase from Pseudomonas putida 2016-11-03 2017-02-08 Tararina, M.A.,Janda, K.D.,Allen, K.N. Structural Analysis Provides Mechanistic Insight into Nicotine Oxidoreductase from Pseudomonas putida. Biochemistry 2016 55 6595 6598 5U1T 28146474 Crystal structure of the Saccharomyces cerevisiae separase-securin complex at 2.6 angstrom resolution 2016-11-29 2017-02-08 Luo, S.,Tong, L. Molecular mechanism for the regulation of yeast separase by securin. Nature 2017 542 255 259 5UJ0 Structure of T4Pnkp 3' phosphatase covalently bound to BeF3 2017-01-16 2017-02-08 Shuman, S.,Chatterjee, D. Truncated T4Pnk covalently bound to BeF3 To Be Published 0 0 0 0 5T4M 28238533 Crystal Structure of Human Protocadherin-15 EC3-5 2016-08-29 2017-02-22 Powers, R.E.,Gaudet, R.,Sotomayor, M. A Partial Calcium-Free Linker Confers Flexibility to Inner-Ear Protocadherin-15. Structure 2017 25 482 495 5TUY 28135087 Structure of human G9a SET-domain (EHMT2) in complex with inhibitor MS0124 2016-11-07 2017-02-22 Xiong, Y.,Li, F.,Babault, N.,Dong, A.,Zeng, H.,Wu, H.,Chen, X.,Arrowsmith, C.H.,Brown, P.J.,Liu, J.,Vedadi, M.,Jin, J. Discovery of Potent and Selective Inhibitors for G9a-Like Protein (GLP) Lysine Methyltransferase. J. Med. Chem. 2017 60 1876 1891 5TUZ 28135087 Structure of human GLP SET-domain (EHMT1) in complex with inhibitor MS0124 2016-11-07 2017-02-22 Xiong, Y.,Li, F.,Babault, N.,Dong, A.,Zeng, H.,Wu, H.,Chen, X.,Arrowsmith, C.H.,Brown, P.J.,Liu, J.,Vedadi, M.,Jin, J. Discovery of Potent and Selective Inhibitors for G9a-Like Protein (GLP) Lysine Methyltransferase. J. Med. Chem. 2017 60 1876 1891 5UI5 28223493 Crystal structure of Aquifex aeolicus sigmaN bound to promoter DNA 2017-01-12 2017-02-22 Campbell, E.A.,Kamath, S.,Rajashankar, K.R.,Wu, M.,Darst, S.A. Crystal structure of Aquifex aeolicus sigma (N) bound to promoter DNA and the structure of sigma (N)-holoenzyme. Proc. Natl. Acad. Sci. U.S.A. 2017 114 0 0 5I55 28232575 Crystal Structure of the Virulent PSM-alpha3 Peptide Forming a Cross-alpha amyloid-like Fibril 2016-02-14 2017-03-01 Tayeb-Fligelman, E.,Tabachnikov, O.,Moshe, A.,Goldshmidt-Tran, O.,Sawaya, M.R.,Coquelle, N.,Colletier, J.P.,Landau, M. The cytotoxic Staphylococcus aureus PSM alpha 3 reveals a cross-alpha amyloid-like fibril. Science 2017 355 831 833 5TX2 28228478 Miniature TGF-beta2 3-mutant monomer 2016-11-15 2017-03-01 Kim, S.K.,Barron, L.,Hinck, C.S.,Petrunak, E.M.,Cano, K.E.,Thangirala, A.,Iskra, B.,Brothers, M.,Vonberg, M.,Leal, B.,Richter, B.,Kodali, R.,Taylor, A.B.,Du, S.,Barnes, C.O.,Sulea, T.,Calero, G.,Hart, P.J.,Hart, M.J.,Demeler, B.,Hinck, A.P. An engineered transforming growth factor beta (TGF-beta ) monomer that functions as a dominant negative to block TGF-beta signaling. J. Biol. Chem. 2017 292 7173 7188 5DJ7 S. erythraea trypsin acyl-enzyme 2015-09-01 2017-03-08 Blankenship, E.,Lodowski, D.T. High resolution structures of S. erythraeus trypsin throughout the catalytic cycle To be Published 0 0 0 0 5DK1 S. erythraea trypsin mixed catalytic intermediate 2015-09-02 2017-03-08 Blankenship, E.,Lodowski, D.T. High resolution structures of S. erythraeus trypsin throughout the catalytic cycle To be Published 0 0 0 0 5DKM S. erythraea trypsin Michaelis-Menten complex 2015-09-03 2017-03-08 Blankenship, E.,Lodowski, D.T. High resolution structures of S. erythraeus trypsin throughout the catalytic cycle To be Published 0 0 0 0 5TT5 28223499 Escherichia coli LigA (K115M) in complex with NAD+ 2016-11-01 2017-03-08 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Two-metal versus one-metal mechanisms of lysine adenylylation by ATP-dependent and NAD(+)-dependent polynucleotide ligases. Proc. Natl. Acad. Sci. U.S.A. 2017 114 2592 2597 5UIX 28235027 Crystal Structure of the DH576 CD4bs Fab (unliganded) from the RV305 HIV Vaccine Trial 2017-01-15 2017-03-08 Easterhoff, D.,Moody, M.A.,Fera, D.,Cheng, H.,Ackerman, M.,Wiehe, K.,Saunders, K.O.,Pollara, J.,Vandergrift, N.,Parks, R.,Kim, J.,Michael, N.L.,O'Connell, R.J.,Excler, J.L.,Robb, M.L.,Vasan, S.,Rerks-Ngarm, S.,Kaewkungwal, J.,Pitisuttithum, P.,Nitayaphan, S.,Sinangil, F.,Tartaglia, J.,Phogat, S.,Kepler, T.B.,Alam, S.M.,Liao, H.X.,Ferrari, G.,Seaman, M.S.,Montefiori, D.C.,Tomaras, G.D.,Harrison, S.C.,Haynes, B.F. Boosting of HIV envelope CD4 binding site antibodies with long variable heavy third complementarity determining region in the randomized double blind RV305 HIV-1 vaccine trial. PLoS Pathog. 2017 13 0 0 5J0Z 28262093 Crystal structure of GLIC in complex with DHA 2016-03-28 2017-03-15 Basak, S.,Schmandt, N.,Gicheru, Y.,Chakrapani, S. Crystal structure and dynamics of a lipid-induced potential desensitized-state of a pentameric ligand-gated channel. Elife 2017 6 0 0 5TE3 28289214 Crystal structure of Bos taurus opsin at 2.7 Angstrom 2016-09-20 2017-03-15 Gulati, S.,Jastrzebska, B.,Banerjee, S.,Placeres, A.L.,Miszta, P.,Gao, S.,Gunderson, K.,Tochtrop, G.P.,Filipek, S.,Katayama, K.,Kiser, P.D.,Mogi, M.,Stewart, P.L.,Palczewski, K. Photocyclic behavior of rhodopsin induced by an atypical isomerization mechanism. Proc. Natl. Acad. Sci. U.S.A. 2017 114 0 0 5TE5 28289214 Crystal structure of Bos taurus opsin regenerated with 6-carbon ring retinal chromophore 2016-09-20 2017-03-15 Gulati, S.,Jastrzebska, B.,Banerjee, S.,Placeres, A.L.,Miszta, P.,Gao, S.,Gunderson, K.,Tochtrop, G.P.,Filipek, S.,Katayama, K.,Kiser, P.D.,Mogi, M.,Stewart, P.L.,Palczewski, K. Photocyclic behavior of rhodopsin induced by an atypical isomerization mechanism. Proc. Natl. Acad. Sci. U.S.A. 2017 114 0 0 5TPP 28298420 Crystal Structure of DH270.5 (unliganded) from the DH270 Broadly Neutralizing N332-glycan Dependent Lineage 2016-10-20 2017-03-15 Bonsignori, M.,Kreider, E.F.,Fera, D.,Meyerhoff, R.R.,Bradley, T.,Wiehe, K.,Alam, S.M.,Aussedat, B.,Walkowicz, W.E.,Hwang, K.K.,Saunders, K.O.,Zhang, R.,Gladden, M.A.,Monroe, A.,Kumar, A.,Xia, S.M.,Cooper, M.,Louder, M.K.,McKee, K.,Bailer, R.T.,Pier, B.W.,Jette, C.A.,Kelsoe, G.,Williams, W.B.,Morris, L.,Kappes, J.,Wagh, K.,Kamanga, G.,Cohen, M.S.,Hraber, P.T.,Montefiori, D.C.,Trama, A.,Liao, H.X.,Kepler, T.B.,Moody, M.A.,Gao, F.,Danishefsky, S.J.,Mascola, J.R.,Shaw, G.M.,Hahn, B.H.,Harrison, S.C.,Korber, B.T.,Haynes, B.F. Staged induction of HIV-1 glycan-dependent broadly neutralizing antibodies. Sci Transl Med 2017 9 0 0 5U0R 28298420 Crystal Structure of DH270.UCA1 (unliganded) from the DH270 Broadly Neutralizing N332-glycan Dependent Lineage 2016-11-26 2017-03-15 Bonsignori, M.,Kreider, E.F.,Fera, D.,Meyerhoff, R.R.,Bradley, T.,Wiehe, K.,Alam, S.M.,Aussedat, B.,Walkowicz, W.E.,Hwang, K.K.,Saunders, K.O.,Zhang, R.,Gladden, M.A.,Monroe, A.,Kumar, A.,Xia, S.M.,Cooper, M.,Louder, M.K.,McKee, K.,Bailer, R.T.,Pier, B.W.,Jette, C.A.,Kelsoe, G.,Williams, W.B.,Morris, L.,Kappes, J.,Wagh, K.,Kamanga, G.,Cohen, M.S.,Hraber, P.T.,Montefiori, D.C.,Trama, A.,Liao, H.X.,Kepler, T.B.,Moody, M.A.,Gao, F.,Danishefsky, S.J.,Mascola, J.R.,Shaw, G.M.,Hahn, B.H.,Harrison, S.C.,Korber, B.T.,Haynes, B.F. Staged induction of HIV-1 glycan-dependent broadly neutralizing antibodies. Sci Transl Med 2017 9 0 0 5L0Y 28286332 Crystal Structure of a Sec72-ssa1 c-terminal peptide fusion protein 2016-07-28 2017-03-22 Tripathi, A.,Mandon, E.C.,Gilmore, R.,Rapoport, T.A. Two alternative binding mechanisms connect the protein translocation Sec71-Sec72 complex with heat shock proteins. J. Biol. Chem. 2017 292 8007 8018 5UCT 28298445 Mycobacterium tuberculosis toxin MazF-mt6 2016-12-22 2017-03-22 Hoffer, E.D.,Miles, S.J.,Dunham, C.M. The structure and function of Mycobacterium tuberculosis MazF-mt6 toxin provide insights into conserved features of MazF endonucleases. J. Biol. Chem. 2017 292 7718 7726 5UDZ 28297670 Human LIN28A in complex with let-7f-1 microRNA pre-element 2016-12-29 2017-03-22 Wang, L.,Nam, Y.,Lee, A.K.,Yu, C.,Roth, K.,Chen, C.,Ransey, E.M.,Sliz, P. LIN28 Zinc Knuckle Domain Is Required and Sufficient to Induce let-7 Oligouridylation. Cell Rep 2017 18 2664 2675 5LOI 28314775 Crystal structure of Myceliophthora thermophila Rad26 (residues 373-841) 2016-08-09 2017-03-29 Andersen, K.R. Insights into Rad3 kinase recruitment from the crystal structure of the DNA damage checkpoint protein Rad26. J. Biol. Chem. 2017 292 8149 8157 5UY6 Crystal Structure of the Human CAMKK2B 2017-02-23 2017-03-29 Counago, R.M.,Dewry, D.,Bountra, C.,Arruda, P.,Edwards, A.M.,Gileadi, O.,Structural Genomics Consortium (SGC) Crystal Structure of the Human CAMKK2B To Be Published 0 0 0 0 5UXH 28334865 Structure of Human POFUT1 in complex with GDP-fucose 2017-02-22 2017-04-05 McMillan, B.J.,Zimmerman, B.,Egan, E.D.,Lofgren, M.,Xu, X.,Hesser, A.,Blacklow, S.C. Structure of human POFUT1, its requirement in ligand-independent oncogenic Notch signaling, and functional effects of Dowling-Degos mutations. Glycobiology 2017 27 777 786 5HGJ 29440721 Structure of integrin alpha1beta1 and alpha2beta1 I-domains explain differential calcium-mediated ligand recognition 2016-01-08 2017-04-12 Brown, K.L.,Banerjee, S.,Feigley, A.,Abe, H.,Blackwell, T.S.,Pozzi, A.,Hudson, B.G.,Zent, R. Salt-bridge modulates differential calcium-mediated ligand binding to integrin alpha 1- and alpha 2-I domains. Sci Rep 2018 8 2916 2916 5HJ2 29440721 Integrin alpha2beta1 I-domain 2016-01-12 2017-04-12 Brown, K.L.,Banerjee, S.,Feigley, A.,Abe, H.,Blackwell, T.S.,Pozzi, A.,Hudson, B.G.,Zent, R. Salt-bridge modulates differential calcium-mediated ligand binding to integrin alpha 1- and alpha 2-I domains. Sci Rep 2018 8 2916 2916 5HRY 28338692 Computationally Designed Cyclic Dimer ank3C2_1 2016-01-24 2017-04-12 Fallas, J.A.,Ueda, G.,Sheffler, W.,Nguyen, V.,McNamara, D.E.,Sankaran, B.,Pereira, J.H.,Parmeggiani, F.,Brunette, T.J.,Cascio, D.,Yeates, T.R.,Zwart, P.,Baker, D. Computational design of self-assembling cyclic protein homo-oligomers. Nat Chem 2017 9 353 360 5HRZ 28338692 Computationally Designed Trimer 1na0C3_3 2016-01-24 2017-04-12 Fallas, J.A.,Ueda, G.,Sheffler, W.,Nguyen, V.,McNamara, D.E.,Sankaran, B.,Pereira, J.H.,Parmeggiani, F.,Brunette, T.J.,Cascio, D.,Yeates, T.R.,Zwart, P.,Baker, D. Computational design of self-assembling cyclic protein homo-oligomers. Nat Chem 2017 9 353 360 5HS0 28338692 Computationally Designed Cyclic Tetramer ank1C4_7 2016-01-24 2017-04-12 Fallas, J.A.,Ueda, G.,Sheffler, W.,Nguyen, V.,McNamara, D.E.,Sankaran, B.,Pereira, J.H.,Parmeggiani, F.,Brunette, T.J.,Cascio, D.,Yeates, T.R.,Zwart, P.,Baker, D. Computational design of self-assembling cyclic protein homo-oligomers. Nat Chem 2017 9 353 360 5L26 28424521 Structure of CNTnw in an inward-facing substrate-bound state 2016-07-31 2017-04-12 Hirschi, M.,Johnson, Z.L.,Lee, S.Y. Visualizing multistep elevator-like transitions of a nucleoside transporter. Nature 2017 545 66 70 5L2A 28424521 Structure of CNTnw N149S,F366A in an outward-facing state 2016-07-31 2017-04-12 Hirschi, M.,Johnson, Z.L.,Lee, S.Y. Visualizing multistep elevator-like transitions of a nucleoside transporter. Nature 2017 545 66 70 5L2B 28424521 Structure of CNTnw N149S, E332A in an outward-facing state 2016-07-31 2017-04-12 Hirschi, M.,Johnson, Z.L.,Lee, S.Y. Visualizing multistep elevator-like transitions of a nucleoside transporter. Nature 2017 545 66 70 5SZE 28375142 Crystal structure of Aquifex aeolicus Hfq-RNA complex at 1.5A 2016-08-13 2017-04-12 Stanek, K.A.,Patterson-West, J.,Randolph, P.S.,Mura, C. Crystal structure and RNA-binding properties of an Hfq homolog from the deep-branching Aquificae: conservation of the lateral RNA-binding mode. Acta Crystallogr D Struct Biol 2017 73 294 315 5TWF 28373297 Regulation of protein interactions by MOB1 phosphorylation 2016-11-13 2017-04-12 Xiong, S.,Couzens, A.L.,Kean, M.J.,Mao, D.Y.,Guettler, S.,Kurinov, I.,Gingras, A.C.,Sicheri, F. Regulation of Protein Interactions by Mps One Binder (MOB1) Phosphorylation. Mol. Cell Proteomics 2017 16 1111 1125 5TWG 28373298 human MOB1A bound to human MST1 phosphorylated T353 peptide 2016-11-13 2017-04-12 Couzens, A.L.,Xiong, S.,Knight, J.D.R.,Mao, D.Y.,Guettler, S.,Picaud, S.,Kurinov, I.,Filippakopoulos, P.,Sicheri, F.,Gingras, A.C. MOB1 Mediated Phospho-recognition in the Core Mammalian Hippo Pathway. Mol. Cell Proteomics 2017 16 1098 1110 5TWH 28373298 human MOB1A bound to MST1 phosphorylated T367 peptide 2016-11-13 2017-04-12 Couzens, A.L.,Xiong, S.,Knight, J.D.R.,Mao, D.Y.,Guettler, S.,Picaud, S.,Kurinov, I.,Filippakopoulos, P.,Sicheri, F.,Gingras, A.C. MOB1 Mediated Phospho-recognition in the Core Mammalian Hippo Pathway. Mol. Cell Proteomics 2017 16 1098 1110 5UK4 28396572 VESICULAR STOMATITS VIRUS N PROTEIN IN COMPLEX WITH INHIBITORY NANOBODY 1307 2017-01-19 2017-04-19 Hanke, L.,Schmidt, F.I.,Knockenhauer, K.E.,Morin, B.,Whelan, S.P.,Schwartz, T.U.,Ploegh, H.L. Vesicular stomatitis virus N protein-specific single-domain antibody fragments inhibit replication. EMBO Rep. 2017 18 1027 1037 5UKB 28396572 VSV N PROTEIN IN COMPLEX WITH INHIBITORY NANOBODY 1004 2017-01-20 2017-04-19 Hanke, L.,Schmidt, F.I.,Knockenhauer, K.E.,Morin, B.,Whelan, S.P.,Schwartz, T.U.,Ploegh, H.L. Vesicular stomatitis virus N protein-specific single-domain antibody fragments inhibit replication. EMBO Rep. 2017 18 1027 1037 5UL2 28346939 Structure of Apo, SeMet-labeled Cobalamin-dependent S-adenosylmethionine radical enzyme OxsB 2017-01-24 2017-04-19 Bridwell-Rabb, J.,Zhong, A.,Sun, H.G.,Drennan, C.L.,Liu, H.W. A B12-dependent radical SAM enzyme involved in oxetanocin A biosynthesis. Nature 2017 544 322 326 5UL3 28346939 Structure of Cobalamin-dependent S-adenosylmethionine radical enzyme OxsB with aqua-cobalamin bound 2017-01-24 2017-04-19 Bridwell-Rabb, J.,Zhong, A.,Sun, H.G.,Drennan, C.L.,Liu, H.W. A B12-dependent radical SAM enzyme involved in oxetanocin A biosynthesis. Nature 2017 544 322 326 5UL4 28346939 Structure of Cobalamin-dependent S-adenosylmethionine radical enzyme OxsB with aqua-cobalamin and S-adenosylmethionine bound 2017-01-24 2017-04-19 Bridwell-Rabb, J.,Zhong, A.,Sun, H.G.,Drennan, C.L.,Liu, H.W. A B12-dependent radical SAM enzyme involved in oxetanocin A biosynthesis. Nature 2017 544 322 326 5V8S Flavo di-iron protein H90D mutant from Thermotoga maritima 2017-03-22 2017-04-19 Kurtz Jr., D.M. Flavo Di-iron protein H90D Mutant from Thermotoga Maritima To Be Published 0 0 0 0 5U0L 28389542 X-ray crystal structure of fatty aldehyde dehydrogenase enzymes from Marinobacter aquaeolei VT8 complexed with a substrate 2016-11-24 2017-04-26 Bertram, J.H.,Mulliner, K.M.,Shi, K.,Plunkett, M.H.,Nixon, P.,Serratore, N.A.,Douglas, C.J.,Aihara, H.,Barney, B.M. Five Fatty Aldehyde Dehydrogenase Enzymes from Marinobacter and Acinetobacter spp. and Structural Insights into the Aldehyde Binding Pocket. Appl. Environ. Microbiol. 2017 83 0 0 5U0M 28389542 Fatty aldehyde dehydrogenase from Marinobacter aquaeolei VT8 and cofactor complex 2016-11-24 2017-04-26 Bertram, J.H.,Mulliner, K.M.,Shi, K.,Plunkett, M.H.,Nixon, P.,Serratore, N.A.,Douglas, C.J.,Aihara, H.,Barney, B.M. Five Fatty Aldehyde Dehydrogenase Enzymes from Marinobacter and Acinetobacter spp. and Structural Insights into the Aldehyde Binding Pocket. Appl. Environ. Microbiol. 2017 83 0 0 5UV4 Crystal Structure of Maize SIRK1 (sucrose-induced receptor kinase 1) kinase domain bound to AMP-PNP 2017-02-17 2017-04-26 Aquino, B.,Counago, R.M.,Massirer, K.B.,Gileadi, O.,Arruda, P.,Structural Genomics Consortium (SGC) Crystal Structure of Maize SIRK1 (sucrose-induced receptor kinase 1) kinase domain bound to AMP-PNP To Be Published 0 0 0 0 5TWJ 28428565 Crystal Structure of RlmH in Complex with S-Adenosylmethionine 2016-11-14 2017-05-03 Koh, C.S.,Madireddy, R.,Beane, T.J.,Zamore, P.D.,Korostelev, A.A. Small methyltransferase RlmH assembles a composite active site to methylate a ribosomal pseudouridine. Sci Rep 2017 7 969 969 5TWK 28428565 Crystal Structure of RlmH in Complex with Sinefungin 2016-11-14 2017-05-03 Koh, C.S.,Madireddy, R.,Beane, T.J.,Zamore, P.D.,Korostelev, A.A. Small methyltransferase RlmH assembles a composite active site to methylate a ribosomal pseudouridine. Sci Rep 2017 7 969 969 5UNI 28648609 Critical role of water molecules for proton translocation of the membrane-bound transhydrogenase 2017-01-30 2017-05-10 Padayatti, P.S.,Leung, J.H.,Mahinthichaichan, P.,Tajkhorshid, E.,Ishchenko, A.,Cherezov, V.,Soltis, S.M.,Jackson, J.B.,Stout, C.D.,Gennis, R.B.,Zhang, Q. Critical Role of Water Molecules in Proton Translocation by the Membrane-Bound Transhydrogenase. Structure 2017 25 1111 0 5ULI 28283058 Crystal Structure of mouse DXO in complex with (3'-NADP)+ and calcium ion 2017-01-24 2017-05-17 Jiao, X.,Doamekpor, S.K.,Bird, J.G.,Nickels, B.E.,Tong, L.,Hart, R.P.,Kiledjian, M. 5' End Nicotinamide Adenine Dinucleotide Cap in Human Cells Promotes RNA Decay through DXO-Mediated deNADding. Cell 2017 168 1015 0 5V3N 28487408 Structure of S. cerevisiae Ulp2-Tof2-Csm1 complex 2017-03-07 2017-05-17 Liang, J.,Singh, N.,Carlson, C.R.,Albuquerque, C.P.,Corbett, K.D.,Zhou, H. Recruitment of a SUMO isopeptidase to rDNA stabilizes silencing complexes by opposing SUMO targeted ubiquitin ligase activity. Genes Dev. 2017 31 802 815 5V3F 28553947 Co-crystal structure of the fluorogenic RNA Mango 2017-03-07 2017-05-24 Trachman, R.J.,Demeshkina, N.A.,Lau, M.W.L.,Panchapakesan, S.S.S.,Jeng, S.C.Y.,Unrau, P.J.,Ferre-D'Amare, A.R. Structural basis for high-affinity fluorophore binding and activation by RNA Mango. Nat. Chem. Biol. 2017 13 807 813 5TIW 28536265 Schistosoma haematobium (Blood Fluke) Sulfotransferase/Racemic Oxamniquine Complex 2016-10-03 2017-05-31 Taylor, A.B.,Roberts, K.M.,Cao, X.,Clark, N.E.,Holloway, S.P.,Donati, E.,Polcaro, C.M.,Pica-Mattoccia, L.,Tarpley, R.S.,McHardy, S.F.,Cioli, D.,LoVerde, P.T.,Fitzpatrick, P.F.,Hart, P.J. Structural and enzymatic insights into species-specific resistance to schistosome parasite drug therapy. J. Biol. Chem. 2017 292 11154 11164 5U8X 28493664 Crystal structure of Fe-CAO1 2016-12-15 2017-05-31 Sui, X.,Weitz, A.C.,Farquhar, E.R.,Badiee, M.,Banerjee, S.,von Lintig, J.,Tochtrop, G.P.,Palczewski, K.,Hendrich, M.P.,Kiser, P.D. Structure and Spectroscopy of Alkene-Cleaving Dioxygenases Containing an Atypically Coordinated Non-Heme Iron Center. Biochemistry 2017 56 2836 2852 5U8Y 28493664 Crystal structure of Co-CAO1 2016-12-15 2017-05-31 Sui, X.,Weitz, A.C.,Farquhar, E.R.,Badiee, M.,Banerjee, S.,von Lintig, J.,Tochtrop, G.P.,Palczewski, K.,Hendrich, M.P.,Kiser, P.D. Structure and Spectroscopy of Alkene-Cleaving Dioxygenases Containing an Atypically Coordinated Non-Heme Iron Center. Biochemistry 2017 56 2836 2852 5U90 28493664 Crystal structure of Co-CAO1 in complex with resveratrol 2016-12-15 2017-05-31 Sui, X.,Weitz, A.C.,Farquhar, E.R.,Badiee, M.,Banerjee, S.,von Lintig, J.,Tochtrop, G.P.,Palczewski, K.,Hendrich, M.P.,Kiser, P.D. Structure and Spectroscopy of Alkene-Cleaving Dioxygenases Containing an Atypically Coordinated Non-Heme Iron Center. Biochemistry 2017 56 2836 2852 5U97 28493664 Crystal structure of Co-CAO1 in complex with piceatannol 2016-12-15 2017-05-31 Sui, X.,Weitz, A.C.,Farquhar, E.R.,Badiee, M.,Banerjee, S.,von Lintig, J.,Tochtrop, G.P.,Palczewski, K.,Hendrich, M.P.,Kiser, P.D. Structure and Spectroscopy of Alkene-Cleaving Dioxygenases Containing an Atypically Coordinated Non-Heme Iron Center. Biochemistry 2017 56 2836 2852 5UCG 28527238 Structure of the PP2C Phosphatase Domain and a Fragment of the Regulatory Domain of the Cell Fate Determinant SpoIIE from Bacillus Subtilis 2016-12-22 2017-05-31 Bradshaw, N.,Levdikov, V.M.,Zimanyi, C.M.,Gaudet, R.,Wilkinson, A.J.,Losick, R. A widespread family of serine/threonine protein phosphatases shares a common regulatory switch with proteasomal proteases. Elife 2017 6 0 0 5T7D 29180815 Crystal structure of Streptomyces hygroscopicus bialaphos resistance (BAR) protein in complex with acetyl coenzyme A 2016-09-04 2017-06-07 Christ, B.,Hochstrasser, R.,Guyer, L.,Francisco, R.,Aubry, S.,Hortensteiner, S.,Weng, J.K. Non-specific activities of the major herbicide-resistance gene BAR. Nat Plants 2017 3 937 945 5T7E 29180815 Crystal structure of Streptomyces hygroscopicus Bialaphos Resistance (BAR) protein in complex with Coenzyme A and L-phosphinothricin 2016-09-04 2017-06-07 Christ, B.,Hochstrasser, R.,Guyer, L.,Francisco, R.,Aubry, S.,Hortensteiner, S.,Weng, J.K. Non-specific activities of the major herbicide-resistance gene BAR. Nat Plants 2017 3 937 945 5UOX 28337323 Structure-Based Design of ASK1 Inhibitors as Potential First-in-Class Agents for Heart Failure 2017-02-01 2017-06-07 Lanier, M.,Pickens, J.,Bigi, S.V.,Bradshaw-Pierce, E.L.,Chambers, A.,Cheruvallath, Z.S.,Cole, D.,Dougan, D.R.,Ermolieff, J.,Gibson, T.,Halkowycz, P.,Hirokawa, A.,Ivetac, A.,Miura, J.,Nunez, E.,Sabat, M.,Tyhonas, J.,Wang, H.,Wang, X.,Swann, S. Structure-Based Design of ASK1 Inhibitors as Potential Agents for Heart Failure. ACS Med Chem Lett 2017 8 316 320 5KHN 28584102 Crystal structures of the Burkholderia multivorans hopanoid transporter HpnN 2016-06-15 2017-06-14 Kumar, N.,Su, C.C.,Chou, T.H.,Radhakrishnan, A.,Delmar, J.A.,Rajashankar, K.R.,Yu, E.W. Crystal structures of the Burkholderia multivorans hopanoid transporter HpnN. Proc. Natl. Acad. Sci. U.S.A. 2017 114 6557 6562 5KHS 28584102 Crystal structures of the Burkholderia multivorans hopanoid transporter HpnN 2016-06-15 2017-06-14 Kumar, N.,Su, C.C.,Chou, T.H.,Radhakrishnan, A.,Delmar, J.A.,Rajashankar, K.R.,Yu, E.W. Crystal structures of the Burkholderia multivorans hopanoid transporter HpnN. Proc. Natl. Acad. Sci. U.S.A. 2017 114 6557 6562 5UDH 28552575 HHARI/ARIH1-UBCH7~Ubiquitin 2016-12-27 2017-06-14 Dove, K.K.,Olszewski, J.L.,Martino, L.,Duda, D.M.,Wu, X.S.,Miller, D.J.,Reiter, K.H.,Rittinger, K.,Schulman, B.A.,Klevit, R.E. Structural Studies of HHARI/UbcH7Ub Reveal Unique E2Ub Conformational Restriction by RBR RING1. Structure 2017 25 890 0 5VNY 28564595 Crystal structure of DM14-3 domain of Lgd 2017-05-01 2017-06-14 McMillan, B.J.,Tibbe, C.,Drabek, A.A.,Seegar, T.C.M.,Blacklow, S.C.,Klein, T. Structural Basis for Regulation of ESCRT-III Complexes by Lgd. Cell Rep 2017 19 1750 1757 5VO5 28564595 Crystal structure of Lgd-Shrub complex, single chain fusion 2017-05-02 2017-06-14 McMillan, B.J.,Tibbe, C.,Drabek, A.A.,Seegar, T.C.M.,Blacklow, S.C.,Klein, T. Structural Basis for Regulation of ESCRT-III Complexes by Lgd. Cell Rep 2017 19 1750 1757 5VSL 28607080 Crystal structure of viperin with bound [4Fe-4S] cluster and S-adenosylhomocysteine (SAH) 2017-05-11 2017-06-14 Fenwick, M.K.,Li, Y.,Cresswell, P.,Modis, Y.,Ealick, S.E. Structural studies of viperin, an antiviral radical SAM enzyme. Proc. Natl. Acad. Sci. U.S.A. 2017 114 6806 6811 5VSL 28607080 Crystal structure of viperin with bound [4Fe-4S] cluster and S-adenosylhomocysteine (SAH) 2017-05-11 2017-06-14 Fenwick, M.K.,Li, Y.,Cresswell, P.,Modis, Y.,Ealick, S.E. Structural studies of viperin, an antiviral radical SAM enzyme. Proc. Natl. Acad. Sci. U.S.A. 2017 114 6806 6811 5VSM 28607080 Crystal structure of viperin with bound [4Fe-4S] cluster, 5'-deoxyadenosine, and L-methionine 2017-05-11 2017-06-14 Fenwick, M.K.,Li, Y.,Cresswell, P.,Modis, Y.,Ealick, S.E. Structural studies of viperin, an antiviral radical SAM enzyme. Proc. Natl. Acad. Sci. U.S.A. 2017 114 6806 6811 5VSM 28607080 Crystal structure of viperin with bound [4Fe-4S] cluster, 5'-deoxyadenosine, and L-methionine 2017-05-11 2017-06-14 Fenwick, M.K.,Li, Y.,Cresswell, P.,Modis, Y.,Ealick, S.E. Structural studies of viperin, an antiviral radical SAM enzyme. Proc. Natl. Acad. Sci. U.S.A. 2017 114 6806 6811 5W1F 28573847 Crystal structure of Ni(II)- and Ca(II)-bound human calprotectin 2017-06-03 2017-06-14 Nakashige, T.G.,Zygiel, E.M.,Drennan, C.L.,Nolan, E.M. Nickel Sequestration by the Host-Defense Protein Human Calprotectin. J. Am. Chem. Soc. 2017 139 8828 8836 5UUK 28594323 Human Bfl-1 in complex with a Bfl-1-specific selected peptide 2017-02-17 2017-06-21 Jenson, J.M.,Ryan, J.A.,Grant, R.A.,Letai, A.,Keating, A.E. Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1. Elife 2017 6 0 0 5UUL 28594323 Human Bfl-1 in complex with PUMA BH3 2017-02-17 2017-06-21 Jenson, J.M.,Ryan, J.A.,Grant, R.A.,Letai, A.,Keating, A.E. Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1. Elife 2017 6 0 0 5UUP 28594323 Human Bfl-1 covalently cross-linked to an electrophilic variant of a Bfl-1-specific selected peptide 2017-02-17 2017-06-21 Jenson, J.M.,Ryan, J.A.,Grant, R.A.,Letai, A.,Keating, A.E. Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1. Elife 2017 6 0 0 5I52 30151973 Crystal structure of TEM1 beta-lactamase mutant I263N 2016-02-13 2017-06-28 Roose, B.W.,Zemerov, S.D.,Wang, Y.,Kasimova, M.A.,Carnevale, V.,Dmochowski, I.J. A Structural Basis for129Xe Hyper-CEST Signal in TEM-1 beta-Lactamase. Chemphyschem 2018 0 0 0 5VJ9 28600356 Guanidine-II riboswitch P2 hairpin dimer from Pseudomonas aeruginosa 2017-04-19 2017-06-28 Reiss, C.W.,Strobel, S.A. Structural basis for ligand binding to the guanidine-II riboswitch. RNA 2017 23 1338 1343 5VJB 28600356 Guanidine-II riboswitch P2 hairpin dimer with 5-bromoU substitution from Pseudomonas aeruginosa 2017-04-19 2017-06-28 Reiss, C.W.,Strobel, S.A. Structural basis for ligand binding to the guanidine-II riboswitch. RNA 2017 23 1338 1343 5VP2 28505372 Crystal structure of the Thermus thermophilus 70S ribosome in complex with madumycin II and bound to mRNA and A-, P- and E-site tRNAs at 2.8A resolution 2017-05-04 2017-06-28 Osterman, I.A.,Khabibullina, N.F.,Komarova, E.S.,Kasatsky, P.,Kartsev, V.G.,Bogdanov, A.A.,Dontsova, O.A.,Konevega, A.L.,Sergiev, P.V.,Polikanov, Y.S. Madumycin II inhibits peptide bond formation by forcing the peptidyl transferase center into an inactive state. Nucleic Acids Res. 2017 45 7507 7514 5VP2 28505372 Crystal structure of the Thermus thermophilus 70S ribosome in complex with madumycin II and bound to mRNA and A-, P- and E-site tRNAs at 2.8A resolution 2017-05-04 2017-06-28 Osterman, I.A.,Khabibullina, N.F.,Komarova, E.S.,Kasatsky, P.,Kartsev, V.G.,Bogdanov, A.A.,Dontsova, O.A.,Konevega, A.L.,Sergiev, P.V.,Polikanov, Y.S. Madumycin II inhibits peptide bond formation by forcing the peptidyl transferase center into an inactive state. Nucleic Acids Res. 2017 45 7507 7514 5KOZ Structure function studies of R. palustris RubisCO (K192C mutant; CABP-bound) 2016-07-01 2017-07-05 Arbing, M.A.,North, J.A.,Satagopan, S.,Varaljay, V.A.,Shin, A.,Tabita, F.R. Structure function studies of R. palustris RubisCO. To Be Published 0 0 0 0 5V3I 28625058 Crystal structure of the VS ribozyme - wild-type C634 2017-03-07 2017-07-05 DasGupta, S.,Suslov, N.B.,Piccirilli, J.A. Structural Basis for Substrate Helix Remodeling and Cleavage Loop Activation in the Varkud Satellite Ribozyme. J. Am. Chem. Soc. 2017 139 9591 9597 5VKZ 28479252 Crystal structure of Mdm12 and combinatorial reconstitution of Mdm12/Mmm1 ERMES complexes for structural studies 2017-04-24 2017-07-05 AhYoung, A.P.,Lu, B.,Cascio, D.,Egea, P.F. Crystal structure of Mdm12 and combinatorial reconstitution of Mdm12/Mmm1 ERMES complexes for structural studies. Biochem. Biophys. Res. Commun. 2017 488 129 135 5VNE 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with Emp24 sorting motif 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNF 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with a C-terminal VV sorting motif 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNG 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with a C-terminal II sorting motif 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNH 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with a C-terminal SV sorting motif 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNI 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with a C-terminal FA sorting motif 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNJ 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with a C-terminal FF sorting motif (ERGIC-53) 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNL 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with 4-phenylbutyric acid (1mM soaking) 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNM 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with 4-phenylbutyric acid (15mM soaking) 2017-04-30 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNN 28594326 Crystal structure of Sec23a/Sec24a/Sec22 complexed with 4-phenylbutyric acid (50mM soaking) 2017-05-01 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VNO 28594326 Crystal structure of Sec23a/Sec24a/Sec22 2017-05-01 2017-07-05 Ma, W.,Goldberg, E.,Goldberg, J. ER retention is imposed by COPII protein sorting and attenuated by 4-phenylbutyrate. Elife 2017 6 0 0 5VYC 28723557 Crystal structure of the human 40S ribosomal subunit in complex with DENR-MCT-1. 2017-05-24 2017-07-19 Lomakin, I.B.,Stolboushkina, E.A.,Vaidya, A.T.,Zhao, C.,Garber, M.B.,Dmitriev, S.E.,Steitz, T.A. Crystal Structure of the Human Ribosome in Complex with DENR-MCT-1. Cell Rep 2017 20 521 528 5KWN The WD domain ofArabidopsis thaliana E3 Ubiquitin Ligase COP1 in complex with peptide from HY5 2016-07-18 2017-07-26 Uljon, S.,Blacklow, S. The COP1 WD domain in complex with HY5 peptide To Be Published 0 0 0 0 5VGL 28708375 Crystal structure of lachrymatory factor synthase from Allium cepa 2017-04-11 2017-07-26 Silvaroli, J.A.,Pleshinger, M.J.,Banerjee, S.,Kiser, P.D.,Golczak, M. Enzyme That Makes You Cry-Crystal Structure of Lachrymatory Factor Synthase from Allium cepa. ACS Chem. Biol. 2017 12 2296 2304 5J21 28894100 Structure of Bacillus NanoRNase A (WT) 2016-03-29 2017-08-02 Schmier, B.J.,Nelersa, C.M.,Malhotra, A. Structural Basis for the Bidirectional Activity of Bacillus nanoRNase NrnA. Sci Rep 2017 7 11085 11085 5VBN 28747437 Crystal Structure of human DNA polymerase epsilon B-subunit in complex with C-terminal domain of catalytic subunit 2017-03-29 2017-08-02 Baranovskiy, A.G.,Gu, J.,Babayeva, N.D.,Kurinov, I.,Pavlov, Y.I.,Tahirov, T.H. Crystal structure of the human Pol B-subunit in complex with the C-terminal domain of the catalytic subunit. J. Biol. Chem. 2017 292 15717 15730 5W0T 28712723 Crystal structure of monomeric Msp1 from S. cerevisiae 2017-05-31 2017-08-02 Wohlever, M.L.,Mateja, A.,McGilvray, P.T.,Day, K.J.,Keenan, R.J. Msp1 Is a Membrane Protein Dislocase for Tail-Anchored Proteins. Mol. Cell 2017 67 194 0 5W2F 28736176 Crystal Structure of the C-terminal Domain of Human eIF2D at 1.4 A resolution 2017-06-06 2017-08-02 Vaidya, A.T.,Lomakin, I.B.,Joseph, N.N.,Dmitriev, S.E.,Steitz, T.A. Crystal Structure of the C-terminal Domain of Human eIF2D and Its Implications on Eukaryotic Translation Initiation. J. Mol. Biol. 2017 429 2765 2771 5L21 28785006 Crystal structure of BoNT/A receptor binding domain in complex with VHH C2 2016-07-29 2017-08-09 Yao, G.,Lam, K.H.,Weisemann, J.,Peng, L.,Krez, N.,Perry, K.,Shoemaker, C.B.,Dong, M.,Rummel, A.,Jin, R. A camelid single-domain antibody neutralizes botulinum neurotoxin A by blocking host receptor binding. Sci Rep 2017 7 7438 7438 5LQ3 28761097 Structures and transport dynamics of the Campylobacter jejuni multidrug efflux pump CmeB 2016-08-15 2017-08-09 Su, C.C.,Yin, L.,Kumar, N.,Dai, L.,Radhakrishnan, A.,Bolla, J.R.,Lei, H.T.,Chou, T.H.,Delmar, J.A.,Rajashankar, K.R.,Zhang, Q.,Shin, Y.K.,Yu, E.W. Structures and transport dynamics of a Campylobacter jejuni multidrug efflux pump. Nat Commun 2017 8 171 171 5XZB 28963528 Mouse cGAS bound to the inhibitor RU365 2017-07-12 2017-08-09 Vincent, J.,Adura, C.,Gao, P.,Luz, A.,Lama, L.,Asano, Y.,Okamoto, R.,Imaeda, T.,Aida, J.,Rothamel, K.,Gogakos, T.,Steinberg, J.,Reasoner, S.,Aso, K.,Tuschl, T.,Patel, D.J.,Glickman, J.F.,Ascano, M. Small molecule inhibition of cGAS reduces interferon expression in primary macrophages from autoimmune mice. Nat Commun 2017 8 750 750 5V1M 28887445 Structure of human Usb1 with uridine 5'-monophosphate 2017-03-02 2017-08-16 Didychuk, A.L.,Montemayor, E.J.,Carrocci, T.J.,DeLaitsch, A.T.,Lucarelli, S.E.,Westler, W.M.,Brow, D.A.,Hoskins, A.A.,Butcher, S.E. Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities. Nat Commun 2017 8 497 497 5VIT 28757619 Crystal structure of a Pseudomonas malonate decarboxylase hetero-tetramer in complex with malonate 2017-04-17 2017-08-16 Maderbocus, R.,Fields, B.L.,Hamilton, K.,Luo, S.,Tran, T.H.,Dietrich, L.E.P.,Tong, L. Crystal structure of a Pseudomonas malonate decarboxylase holoenzyme hetero-tetramer. Nat Commun 2017 8 160 160 5VJ1 28757619 Crystal structure of a Pseudomonas malonate decarboxylase hetero-tetramer in complex with coenzyme A 2017-04-18 2017-08-16 Maderbocus, R.,Fields, B.L.,Hamilton, K.,Luo, S.,Tran, T.H.,Dietrich, L.E.P.,Tong, L. Crystal structure of a Pseudomonas malonate decarboxylase holoenzyme hetero-tetramer. Nat Commun 2017 8 160 160 5VR6 28759203 Structure of Human Sts-1 histidine phosphatase domain with sulfate bound 2017-05-10 2017-08-16 Zhou, W.,Yin, Y.,Weinheimer, A.S.,Kaur, N.,Carpino, N.,French, J.B. Structural and Functional Characterization of the Histidine Phosphatase Domains of Human Sts-1 and Sts-2. Biochemistry 2017 56 4637 4645 5VYW 28808024 Crystal structure of Lactococcus lactis pyruvate carboxylase 2017-05-26 2017-08-16 Choi, P.H.,Vu, T.M.N.,Pham, H.T.,Woodward, J.J.,Turner, M.S.,Tong, L. Structural and functional studies of pyruvate carboxylase regulation by cyclic di-AMP in lactic acid bacteria. Proc. Natl. Acad. Sci. U.S.A. 2017 114 0 0 5VYZ 28808024 Crystal structure of Lactococcus lactis pyruvate carboxylase in complex with cyclic-di-AMP 2017-05-26 2017-08-16 Choi, P.H.,Vu, T.M.N.,Pham, H.T.,Woodward, J.J.,Turner, M.S.,Tong, L. Structural and functional studies of pyruvate carboxylase regulation by cyclic di-AMP in lactic acid bacteria. Proc. Natl. Acad. Sci. U.S.A. 2017 114 0 0 5VZ0 28808024 Crystal structure of Lactococcus lactis pyruvate carboxylase G746A mutant in complex with cyclic-di-AMP 2017-05-26 2017-08-16 Choi, P.H.,Vu, T.M.N.,Pham, H.T.,Woodward, J.J.,Turner, M.S.,Tong, L. Structural and functional studies of pyruvate carboxylase regulation by cyclic di-AMP in lactic acid bacteria. Proc. Natl. Acad. Sci. U.S.A. 2017 114 0 0 5W0R 28757211 Crystal structure of MBP fused activation-induced cytidine deaminase (AID) in complex with cacodylic acid 2017-05-31 2017-08-16 Qiao, Q.,Wang, L.,Meng, F.L.,Hwang, J.K.,Alt, F.W.,Wu, H. AID Recognizes Structured DNA for Class Switch Recombination. Mol. Cell 2017 67 361 0 5W0U 28757211 Crystal structure of MBP fused activation-induced cytidine deaminase (AID) in complex with dCMP 2017-05-31 2017-08-16 Qiao, Q.,Wang, L.,Meng, F.L.,Hwang, J.K.,Alt, F.W.,Wu, H. AID Recognizes Structured DNA for Class Switch Recombination. Mol. Cell 2017 67 361 0 5W1C 28757211 Crystal structure of MBP fused activation-induced cytidine deaminase (AID) in complex with cytidine 2017-06-02 2017-08-16 Qiao, Q.,Wang, L.,Meng, F.L.,Hwang, J.K.,Alt, F.W.,Wu, H. AID Recognizes Structured DNA for Class Switch Recombination. Mol. Cell 2017 67 361 0 5W5G 28759203 Structure of Human Sts-1 histidine phosphatase domain 2017-06-15 2017-08-16 Zhou, W.,Yin, Y.,Weinheimer, A.S.,Kaur, N.,Carpino, N.,French, J.B. Structural and Functional Characterization of the Histidine Phosphatase Domains of Human Sts-1 and Sts-2. Biochemistry 2017 56 4637 4645 5KVY 33253191 CRYSTAL STRUCTURE OF THE TWO TANDEM RRM DOMAINS OF PUF60 BOUND TO A PORTION OF AN ADML PRE-MRNA 3' SPLICE SITE ANALOG 2016-07-15 2017-08-23 Hsiao, H.T.,Crichlow, G.V.,Murphy, J.W.,Folta-Stogniew, E.J.,Lolis, E.J.,Braddock, D.T. Unraveling the mechanism of recognition of the 3' splice site of the adenovirus major late promoter intron by the alternative splicing factor PUF60. Plos One 2020 15 0 0 5TTE 28790309 Crystal Structure of an RBR E3 ubiquitin ligase in complex with an E2-Ub thioester intermediate mimic 2016-11-03 2017-08-23 Yuan, L.,Lv, Z.,Atkison, J.H.,Olsen, S.K. Structural insights into the mechanism and E2 specificity of the RBR E3 ubiquitin ligase HHARI. Nat Commun 2017 8 211 211 5W5C 28813412 Crystal structure of the primed SNARE-Complexin-Synaptotagmin-1 C2AB complex 2017-06-14 2017-08-23 Zhou, Q.,Zhou, P.,Wang, A.L.,Wu, D.,Zhao, M.,Sudhof, T.C.,Brunger, A.T. The primed SNARE-complexin-synaptotagmin complex for neuronal exocytosis. Nature 2017 548 420 425 5W5D 28813412 Crystal structure of the primed SNARE-Complexin-Synaptotagmin-1 C2B complex 2017-06-14 2017-08-23 Zhou, Q.,Zhou, P.,Wang, A.L.,Wu, D.,Zhao, M.,Sudhof, T.C.,Brunger, A.T. The primed SNARE-complexin-synaptotagmin complex for neuronal exocytosis. Nature 2017 548 420 425 5W4K 28846667 Crystal structure of the Thermus thermophilus 70S ribosome in complex with Klebsazolicin and bound to mRNA and A-, P- and E-site tRNAs at 2.7A resolution 2017-06-12 2017-08-30 Metelev, M.,Osterman, I.A.,Ghilarov, D.,Khabibullina, N.F.,Yakimov, A.,Shabalin, K.,Utkina, I.,Travin, D.Y.,Komarova, E.S.,Serebryakova, M.,Artamonova, T.,Khodorkovskii, M.,Konevega, A.L.,Sergiev, P.V.,Severinov, K.,Polikanov, Y.S. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel. Nat. Chem. Biol. 2017 13 1129 1136 5WO6 28878326 Crystal Structure of Transient Receptor Potential (TRP) channel TRPV6cryst 2017-08-01 2017-09-13 Singh, A.K.,Saotome, K.,Sobolevsky, A.I. Swapping of transmembrane domains in the epithelial calcium channel TRPV6. Sci Rep 2017 7 10669 10669 5WO7 28878326 Crystal Structure of Transient Receptor Potential (TRP) channel TRPV6* 2017-08-01 2017-09-13 Singh, A.K.,Saotome, K.,Sobolevsky, A.I. Swapping of transmembrane domains in the epithelial calcium channel TRPV6. Sci Rep 2017 7 10669 10669 5WO8 28878326 Crystal Structure of Transient Receptor Potential (TRP) channel TRPV6*-Del1 2017-08-01 2017-09-13 Singh, A.K.,Saotome, K.,Sobolevsky, A.I. Swapping of transmembrane domains in the epithelial calcium channel TRPV6. Sci Rep 2017 7 10669 10669 5WO9 28878326 Crystal Structure of Transient Receptor Potential (TRP) channel TRPV6* in the presence of Calcium 2017-08-01 2017-09-13 Singh, A.K.,Saotome, K.,Sobolevsky, A.I. Swapping of transmembrane domains in the epithelial calcium channel TRPV6. Sci Rep 2017 7 10669 10669 5VHG 28876241 Crystal structure of pentad mutant GAPR-1 2017-04-13 2017-09-20 Li, Y.,Zhao, Y.,Su, M.,Glover, K.,Chakravarthy, S.,Colbert, C.L.,Levine, B.,Sinha, S.C. Structural insights into the interaction of the conserved mammalian proteins GAPR-1 and Beclin 1, a key autophagy protein. Acta Crystallogr D Struct Biol 2017 73 775 792 5VMR 28953867 Receptor binding domain of BoNT/B in complex with mini-protein binder Bot.2110.4 2017-04-28 2017-09-20 Chevalier, A.,Silva, D.A.,Rocklin, G.J.,Hicks, D.R.,Vergara, R.,Murapa, P.,Bernard, S.M.,Zhang, L.,Lam, K.H.,Yao, G.,Bahl, C.D.,Miyashita, S.I.,Goreshnik, I.,Fuller, J.T.,Koday, M.T.,Jenkins, C.M.,Colvin, T.,Carter, L.,Bohn, A.,Bryan, C.M.,Fernandez-Velasco, D.A.,Stewart, L.,Dong, M.,Huang, X.,Jin, R.,Wilson, I.A.,Fuller, D.H.,Baker, D. Massively parallel de novo protein design for targeted therapeutics. Nature 2017 550 74 79 5J2Z 29216315 PRV UL37 N-terminal half (R2 mutant) 2016-03-30 2017-10-04 Richards, A.L.,Sollars, P.J.,Pitts, J.D.,Stults, A.M.,Heldwein, E.E.,Pickard, G.E.,Smith, G.A. The pUL37 tegument protein guides alpha-herpesvirus retrograde axonal transport to promote neuroinvasion. PLoS Pathog. 2017 13 0 0 5WOA 28878326 Crystal Structure of Transient Receptor Potential (TRP) channel TRPV6* in the presence of Gadolinium 2017-08-01 2017-10-04 Singh, A.K.,Saotome, K.,Sobolevsky, A.I. Swapping of transmembrane domains in the epithelial calcium channel TRPV6. Sci Rep 2017 7 10669 10669 5XVN 28869593 E. far Cas1-Cas2/prespacer binary complex 2017-06-28 2017-10-04 Xiao, Y.,Ng, S.,Hyun Nam, K.,Ke, A. How type II CRISPR-Cas establish immunity through Cas1-Cas2-mediated spacer integration. Nature 2017 550 137 141 5XVO 28869593 E. fae Cas1-Cas2/prespacer/target ternary complex revealing DNA sampling and half-integration states 2017-06-28 2017-10-04 Xiao, Y.,Ng, S.,Hyun Nam, K.,Ke, A. How type II CRISPR-Cas establish immunity through Cas1-Cas2-mediated spacer integration. Nature 2017 550 137 141 5XVP 28869593 E. fae Cas1-Cas2/prespacer/target ternary complex revealing the fully integrated states 2017-06-28 2017-10-04 Xiao, Y.,Ng, S.,Hyun Nam, K.,Ke, A. How type II CRISPR-Cas establish immunity through Cas1-Cas2-mediated spacer integration. Nature 2017 550 137 141 4W2P 29038656 Anti-Marburgvirus Nucleoprotein Single Domain Antibody C 2017-08-17 2017-10-11 Garza, J.A.,Taylor, A.B.,Sherwood, L.J.,Hart, P.J.,Hayhurst, A. Unveiling a Drift Resistant Cryptotope withinMarburgvirusNucleoprotein Recognized by Llama Single-Domain Antibodies. Front Immunol 2017 8 1234 1234 5UC6 28993621 Structural insights into IL-1 alpha recognition by a naphthyl-modified aptamer that mimics IL-1RI Domain III 2016-12-21 2017-10-11 Ren, X.,Gelinas, A.D.,von Carlowitz, I.,Janjic, N.,Pyle, A.M. Structural basis for IL-1 alpha recognition by a modified DNA aptamer that specifically inhibits IL-1 alpha signaling. Nat Commun 2017 8 810 810 5UD5 29035363 Crystal structure of the tRNA binding domain of Pyrrolysyl-tRNA synthetase bound to tRNA(Pyl) 2016-12-23 2017-10-11 Suzuki, T.,Miller, C.,Guo, L.T.,Ho, J.M.L.,Bryson, D.I.,Wang, Y.S.,Liu, D.R.,Soll, D. Crystal structures reveal an elusive functional domain of pyrrolysyl-tRNA synthetase. Nat. Chem. Biol. 2017 13 1261 1266 5V6X 29035363 Crystal structure of the tRNA binding domain of Pyrrolysyl-tRNA synthetase mutant (32A NTD) bound to tRNA(Pyl) 2017-03-17 2017-10-11 Suzuki, T.,Miller, C.,Guo, L.T.,Ho, J.M.L.,Bryson, D.I.,Wang, Y.S.,Liu, D.R.,Soll, D. Crystal structures reveal an elusive functional domain of pyrrolysyl-tRNA synthetase. Nat. Chem. Biol. 2017 13 1261 1266 5XZG 28963528 Mouse cGAS bound to the inhibitor RU521 2017-07-12 2017-10-11 Vincent, J.,Adura, C.,Gao, P.,Luz, A.,Lama, L.,Asano, Y.,Okamoto, R.,Imaeda, T.,Aida, J.,Rothamel, K.,Gogakos, T.,Steinberg, J.,Reasoner, S.,Aso, K.,Tuschl, T.,Patel, D.J.,Glickman, J.F.,Ascano, M. Small molecule inhibition of cGAS reduces interferon expression in primary macrophages from autoimmune mice. Nat Commun 2017 8 750 750 5KWM S. erythraea trypsin long construct apoenzyme 2016-07-18 2017-10-18 Blankenship, E.,Lodowski, D.T. S. erythraea trypsin long construct To be Published 0 0 0 0 6AXM 28967743 F95Y Epi-isozizaene synthase 2017-09-07 2017-10-18 Blank, P.N.,Barrow, G.H.,Chou, W.K.W.,Duan, L.,Cane, D.E.,Christianson, D.W. Substitution of Aromatic Residues with Polar Residues in the Active Site Pocket of epi-Isozizaene Synthase Leads to the Generation of New Cyclic Sesquiterpenes. Biochemistry 2017 56 5798 5811 6AXO 28967743 F96S Epi-isozizaene synthase 2017-09-07 2017-10-18 Blank, P.N.,Barrow, G.H.,Chou, W.K.W.,Duan, L.,Cane, D.E.,Christianson, D.W. Substitution of Aromatic Residues with Polar Residues in the Active Site Pocket of epi-Isozizaene Synthase Leads to the Generation of New Cyclic Sesquiterpenes. Biochemistry 2017 56 5798 5811 5TPK 32963095 Crystal Structure of Mouse Protocadherin-15 EC7-8 V875A 2016-10-20 2017-10-25 Choudhary, D.,Narui, Y.,Neel, B.L.,Wimalasena, L.N.,Klanseck, C.F.,De-la-Torre, P.,Chen, C.,Araya-Secchi, R.,Tamilselvan, E.,Sotomayor, M. Structural determinants of protocadherin-15 mechanics and function in hearing and balance perception. Proc.Natl.Acad.Sci.USA 2020 0 0 0 5Y6O Crystal structure of DAXX N-terminal four-helix bundle domain (4HB) in complex with ATRX 2017-08-13 2017-10-25 Huang, H.,Patel, D.J. Crystal structure of DAXX N-terminal four-helix bundle domain (4HB) in complex with ATRX Nat Commun 2017 0 0 0 6ANV 28985564 Crystal structure of anti-CRISPR protein AcrF1 2017-08-14 2017-10-25 Guo, T.W.,Bartesaghi, A.,Yang, H.,Falconieri, V.,Rao, P.,Merk, A.,Eng, E.T.,Raczkowski, A.M.,Fox, T.,Earl, L.A.,Patel, D.J.,Subramaniam, S. Cryo-EM Structures Reveal Mechanism and Inhibition of DNA Targeting by a CRISPR-Cas Surveillance Complex. Cell 2017 171 414 0 6ANW 28985564 Crystal structure of anti-CRISPR protein AcrF10 2017-08-14 2017-10-25 Guo, T.W.,Bartesaghi, A.,Yang, H.,Falconieri, V.,Rao, P.,Merk, A.,Eng, E.T.,Raczkowski, A.M.,Fox, T.,Earl, L.A.,Patel, D.J.,Subramaniam, S. Cryo-EM Structures Reveal Mechanism and Inhibition of DNA Targeting by a CRISPR-Cas Surveillance Complex. Cell 2017 171 414 0 6B0B 29290613 Crystal structure of human APOBEC3H 2017-09-14 2017-10-25 Shaban, N.M.,Shi, K.,Lauer, K.V.,Carpenter, M.A.,Richards, C.M.,Salamango, D.,Wang, J.,Lopresti, M.W.,Banerjee, S.,Levin-Klein, R.,Brown, W.L.,Aihara, H.,Harris, R.S. The Antiviral and Cancer Genomic DNA Deaminase APOBEC3H Is Regulated by an RNA-Mediated Dimerization Mechanism. Mol. Cell 2018 69 75 0 5V5X 29087338 Protocadherin gammaB7 EC3-6 cis-dimer structure 2017-03-15 2017-11-01 Goodman, K.M.,Rubinstein, R.,Dan, H.,Bahna, F.,Mannepalli, S.,Ahlsen, G.,Aye Thu, C.,Sampogna, R.V.,Maniatis, T.,Honig, B.,Shapiro, L. Protocadherin cis-dimer architecture and recognition unit diversity. Proc. Natl. Acad. Sci. U.S.A. 2017 114 0 0 5TVT Structure of Maternal Embryonic Leucine Zipper Kinase 2016-11-10 2017-11-15 Seo, H.-Y.,Dhe-Paganon, S. Structure of Maternal Embryonic Leucine Zipper Kinase To Be Published 0 0 0 0 5TWY 28926338 Structure of Maternal Embryonic Leucine Zipper Kinase 2016-11-15 2017-11-22 Huang, H.T.,Seo, H.S.,Zhang, T.,Wang, Y.,Jiang, B.,Li, Q.,Buckley, D.L.,Nabet, B.,Roberts, J.M.,Paulk, J.,Dastjerdi, S.,Winter, G.E.,McLauchlan, H.,Moran, J.,Bradner, J.E.,Eck, M.J.,Dhe-Paganon, S.,Zhao, J.J.,Gray, N.S. MELK is not necessary for the proliferation of basal-like breast cancer cells. Elife 2017 6 0 0 5TWZ 28926338 Structure of Maternal Embryonic Leucine Zipper Kinase 2016-11-15 2017-11-22 Huang, H.T.,Seo, H.S.,Zhang, T.,Wang, Y.,Jiang, B.,Li, Q.,Buckley, D.L.,Nabet, B.,Roberts, J.M.,Paulk, J.,Dastjerdi, S.,Winter, G.E.,McLauchlan, H.,Moran, J.,Bradner, J.E.,Eck, M.J.,Dhe-Paganon, S.,Zhao, J.J.,Gray, N.S. MELK is not necessary for the proliferation of basal-like breast cancer cells. Elife 2017 6 0 0 5W1J 28463568 Echinococcus granulosus thioredoxin glutathione reductas (egTGR) 2017-06-03 2017-11-22 Salinas, G.,Gao, W.,Wang, Y.,Bonilla, M.,Yu, L.,Novikov, A.,Virginio, V.G.,Ferreira, H.B.,Vieites, M.,Gladyshev, V.N.,Gambino, D.,Dai, S. The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I). Antioxid. Redox Signal. 2017 27 1491 1504 5W1L 28463568 Echinococcus granulosus thioredoxin glutathione reductas (egTGR) with Gold 2017-06-03 2017-11-22 Salinas, G.,Gao, W.,Wang, Y.,Bonilla, M.,Yu, L.,Novikov, A.,Virginio, V.G.,Ferreira, H.B.,Vieites, M.,Gladyshev, V.N.,Gambino, D.,Dai, S. The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I). Antioxid. Redox Signal. 2017 27 1491 1504 5H7R 29496391 Structural basis of the flanking zinc-finger motifs crucial for the E3 ligase activity of the LNX1 RING domain 2016-11-21 2017-11-29 Nayak, D.,Sivaraman, J. Structure of LNX1:Ubc13~Ubiquitin Complex Reveals the Role of Additional Motifs for the E3 Ligase Activity of LNX1. J. Mol. Biol. 2018 430 1173 1188 5H7S 29496391 Structural basis of the flanking zinc-finger motifs crucial for the E3 ligase activity of the LNX1 RING domain 2016-11-21 2017-11-29 Nayak, D.,Sivaraman, J. Structure of LNX1:Ubc13~Ubiquitin Complex Reveals the Role of Additional Motifs for the E3 Ligase Activity of LNX1. J. Mol. Biol. 2018 430 1173 1188 5V9X 29165676 Structure of Mycobacterium smegmatis helicase Lhr bound to ssDNA and AMP-PNP 2017-03-23 2017-12-06 Ejaz, A.,Ordonez, H.,Jacewicz, A.,Ferrao, R.,Shuman, S. Structure of mycobacterial 3'-to-5' RNA:DNA helicase Lhr bound to a ssDNA tracking strand highlights distinctive features of a novel family of bacterial helicases. Nucleic Acids Res. 2018 46 442 455 5WGI 29203661 Ultrahigh resolution crystal structure of Danio rerio histone deacetylase 6 catalytic domain 2 in complex with TSA 2017-07-14 2017-12-06 Porter, N.J.,Mahendran, A.,Breslow, R.,Christianson, D.W. Unusual zinc-binding mode of HDAC6-selective hydroxamate inhibitors. Proc. Natl. Acad. Sci. U.S.A. 2017 114 13459 13464 5UFN 28665591 Crystal structure of Burkholderia thailandensis 1,6-didemethyltoxoflavin-N1-methyltransferase with bound S-adenosylhomocysteine 2017-01-05 2017-12-13 Fenwick, M.K.,Almabruk, K.H.,Ealick, S.E.,Begley, T.P.,Philmus, B. Biochemical Characterization and Structural Basis of Reactivity and Regioselectivity Differences between Burkholderia thailandensis and Burkholderia glumae 1,6-Didesmethyltoxoflavin N-Methyltransferase. Biochemistry 2017 56 3934 3944 6BQL Crystal Structure of the Human CAMKK2B in complex with TAE-226 2017-11-28 2017-12-13 Counago, R.M.,de Souza, G.P.,dos Reis, C.V.,Drewry, D.,Massirer, K.B.,Arruda, P.,Edwards, A.M.,Elkins, J.M.,Structural Genomics Consortium (SGC) Crystal Structure of the Human CAMKK2B in complex with TAE-226 To Be Published 0 0 0 0 6BQP Crystal Structure of the Human CAMKK2B in complex with Crenolanib 2017-11-28 2017-12-13 Counago, R.M.,de Souza, G.P.,dos Reis, C.V.,Drewry, D.,Massirer, K.B.,Arruda, P.,Edwards, A.M.,Elkins, J.M.,Structural Genomics Consortium (SGC) Crystal Structure of the Human CAMKK2B in complex with Crenolanib To Be Published 0 0 0 0 6BQQ Crystal Structure of the Human CAMKK2B in complex with BI2526 2017-11-28 2017-12-13 Counago, R.M.,de Souza, G.P.,dos Reis, C.V.,Drewry, D.,Massirer, K.B.,Arruda, P.,Edwards, A.M.,Elkins, J.M.,Structural Genomics Consortium (SGC) Crystal Structure of the Human CAMKK2B in complex with BI2526 To Be Published 0 0 0 0 5U9L Crystal structure of the intermembrane space region of the plastid division protein PARC6 2016-12-16 2017-12-20 Delmar, J.A.,Yu, E.W.,Osteryoung, K.W. Cocrystal structure of the intermembrane space region of the plastid division proteins PARC6 and PDV1 To Be Published 0 0 0 0 5U9O Cocrystal structure of the intermembrane space region of the plastid division proteins PARC6 and PDV1 2016-12-16 2017-12-20 Delmar, J.A.,Yu, E.W.,Osteryoung, K.W. Cocrystal structure of the intermembrane space region of the plastid division proteins PARC6 and PDV1 To Be Published 0 0 0 0 5UBO 29259197 Mical-oxidized Actin complex with Gelsolin Segment 1 2016-12-21 2017-12-20 Grintsevich, E.E.,Ge, P.,Sawaya, M.R.,Yesilyurt, H.G.,Terman, J.R.,Zhou, Z.H.,Reisler, E. Catastrophic disassembly of actin filaments via Mical-mediated oxidation. Nat Commun 2017 8 2183 2183 5VS6 29056421 Structure of DUB complex 2017-05-11 2017-12-20 Lamberto, I.,Liu, X.,Seo, H.S.,Schauer, N.J.,Iacob, R.E.,Hu, W.,Das, D.,Mikhailova, T.,Weisberg, E.L.,Engen, J.R.,Anderson, K.C.,Chauhan, D.,Dhe-Paganon, S.,Buhrlage, S.J. Structure-Guided Development of a Potent and Selective Non-covalent Active-Site Inhibitor of USP7. Cell Chem Biol 2017 24 1490 0 5VSB 29056421 Structure of DUB complex 2017-05-11 2017-12-20 Lamberto, I.,Liu, X.,Seo, H.S.,Schauer, N.J.,Iacob, R.E.,Hu, W.,Das, D.,Mikhailova, T.,Weisberg, E.L.,Engen, J.R.,Anderson, K.C.,Chauhan, D.,Dhe-Paganon, S.,Buhrlage, S.J. Structure-Guided Development of a Potent and Selective Non-covalent Active-Site Inhibitor of USP7. Cell Chem Biol 2017 24 1490 0 5VSK 29056421 Structure of DUB complex 2017-05-11 2017-12-20 Lamberto, I.,Liu, X.,Seo, H.S.,Schauer, N.J.,Iacob, R.E.,Hu, W.,Das, D.,Mikhailova, T.,Weisberg, E.L.,Engen, J.R.,Anderson, K.C.,Chauhan, D.,Dhe-Paganon, S.,Buhrlage, S.J. Structure-Guided Development of a Potent and Selective Non-covalent Active-Site Inhibitor of USP7. Cell Chem Biol 2017 24 1490 0 5WBH 29236692 Structure of the FRB domain of mTOR bound to a substrate recruitment peptide of S6K1 2017-06-29 2017-12-20 Yang, H.,Jiang, X.,Li, B.,Yang, H.J.,Miller, M.,Yang, A.,Dhar, A.,Pavletich, N.P. Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017 552 368 373 5WBI 29236692 Crystal structure of the Arabidopsis thaliana Raptor 2017-06-29 2017-12-20 Yang, H.,Jiang, X.,Li, B.,Yang, H.J.,Miller, M.,Yang, A.,Dhar, A.,Pavletich, N.P. Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017 552 368 373 5WBJ 29236692 Crystal structure of the arabidopsis thaliana Raptor in complex with the TOS peptide of human 4EBP1 2017-06-29 2017-12-20 Yang, H.,Jiang, X.,Li, B.,Yang, H.J.,Miller, M.,Yang, A.,Dhar, A.,Pavletich, N.P. Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017 552 368 373 5WBK 29236692 Crystal structure of the arabidopsis thaliana Raptor in complex with the TOS peptide of human S6K1 2017-06-29 2017-12-20 Yang, H.,Jiang, X.,Li, B.,Yang, H.J.,Miller, M.,Yang, A.,Dhar, A.,Pavletich, N.P. Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017 552 368 373 5WBL 29236692 Crystal structure of the Arabidopsis thaliana Raptor in complex with the TOS peptide of human PRAS40 2017-06-29 2017-12-20 Yang, H.,Jiang, X.,Li, B.,Yang, H.J.,Miller, M.,Yang, A.,Dhar, A.,Pavletich, N.P. Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017 552 368 373 5WBU 29236692 Crystal structure of mTOR(deltaN)-mLST8-PRAS40(alpha-helix & beta-strand) complex 2017-06-29 2017-12-20 Yang, H.,Jiang, X.,Li, B.,Yang, H.J.,Miller, M.,Yang, A.,Dhar, A.,Pavletich, N.P. Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017 552 368 373 5WBY 29236692 Crystal structure of mTOR(deltaN)-mLST8-PRAS40(beta-strand) complex 2017-06-29 2017-12-20 Yang, H.,Jiang, X.,Li, B.,Yang, H.J.,Miller, M.,Yang, A.,Dhar, A.,Pavletich, N.P. Mechanisms of mTORC1 activation by RHEB and inhibition by PRAS40. Nature 2017 552 368 373 6AMG 29211462 cyt P460 of Nitrosomonas sp. AL212 2017-08-09 2017-12-20 Smith, M.A.,Lancaster, K.M. The Eponymous Cofactors in Cytochrome P460s from Ammonia-Oxidizing Bacteria Are Iron Porphyrinoids Whose Macrocycles Are Dibasic. Biochemistry 2018 57 334 343 6B9R 29217579 Streptomyces albus HEPD with substrate 2-hydroxyethylphosphonate (2-HEP) and Fe(II) bound 2017-10-11 2017-12-20 Born, D.A.,Ulrich, E.C.,Ju, K.S.,Peck, S.C.,van der Donk, W.A.,Drennan, C.L. Structural basis for methylphosphonate biosynthesis. Science 2017 358 1336 1339 6B9S 29217579 MPnS crystallized in the absence of substrate 2017-10-11 2017-12-20 Born, D.A.,Ulrich, E.C.,Ju, K.S.,Peck, S.C.,van der Donk, W.A.,Drennan, C.L. Structural basis for methylphosphonate biosynthesis. Science 2017 358 1336 1339 6BLQ 29255035 Crystal Structure of IAg7 in complex with insulin mimotope p8E9E 2017-11-11 2017-12-20 Wang, Y.,Sosinowski, T.,Novikov, A.,Crawford, F.,Neau, D.B.,Yang, J.,Kwok, W.W.,Marrack, P.,Kappler, J.W.,Dai, S. C-terminal modification of the insulin B:11-23 peptide creates superagonists in mouse and human type 1 diabetes. Proc. Natl. Acad. Sci. U.S.A. 2018 115 162 167 6BLR 29255035 Crystal Structure of IAg7 in complex with insulin mimotope p8E9E6SS 2017-11-11 2017-12-20 Wang, Y.,Sosinowski, T.,Novikov, A.,Crawford, F.,Neau, D.B.,Yang, J.,Kwok, W.W.,Marrack, P.,Kappler, J.W.,Dai, S. C-terminal modification of the insulin B:11-23 peptide creates superagonists in mouse and human type 1 diabetes. Proc. Natl. Acad. Sci. U.S.A. 2018 115 162 167 5SXH 29234087 Crystal Structure of the Cancer Genomic DNA Mutator APOBEC3B 2016-08-09 2017-12-27 Shi, K.,Demir, O.,Carpenter, M.A.,Wagner, J.,Kurahashi, K.,Harris, R.S.,Amaro, R.E.,Aihara, H. Conformational Switch Regulates the DNA Cytosine Deaminase Activity of Human APOBEC3B. Sci Rep 2017 7 17415 17415 5TFL 30033219 Crystal Structure of Mouse Cadherin-23 EC7+8 2016-09-25 2017-12-27 Jaiganesh, A.,De-la-Torre, P.,Patel, A.A.,Termine, D.J.,Velez-Cortes, F.,Chen, C.,Sotomayor, M. Zooming in on Cadherin-23: Structural Diversity and Potential Mechanisms of Inherited Deafness. Structure 2018 26 1210 0 6B14 29309709 Crystal structure of Spinach RNA aptamer in complex with Fab BL3-6S97N 2017-09-16 2017-12-27 Koirala, D.,Shelke, S.A.,Dupont, M.,Ruiz, S.,DasGupta, S.,Bailey, L.J.,Benner, S.A.,Piccirilli, J.A. Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography. Nucleic Acids Res. 2018 46 2624 2635 6B3K 29309709 Crystal structure of mutant Spinach RNA aptamer in complex with Fab BL3-6 2017-09-22 2017-12-27 Koirala, D.,Shelke, S.A.,Dupont, M.,Ruiz, S.,DasGupta, S.,Bailey, L.J.,Benner, S.A.,Piccirilli, J.A. Affinity maturation of a portable Fab-RNA module for chaperone-assisted RNA crystallography. Nucleic Acids Res. 2018 46 2624 2635 6BDZ 29224781 ADAM10 Extracellular Domain Bound by the 11G2 Fab 2017-10-24 2017-12-27 Seegar, T.C.M.,Killingsworth, L.B.,Saha, N.,Meyer, P.A.,Patra, D.,Zimmerman, B.,Janes, P.W.,Rubinstein, E.,Nikolov, D.B.,Skiniotis, G.,Kruse, A.C.,Blacklow, S.C. Structural Basis for Regulated Proteolysis by the alpha-Secretase ADAM10. Cell 2017 171 1638 0 6BE6 29224781 ADAM10 Extracellular Domain 2017-10-24 2017-12-27 Seegar, T.C.M.,Killingsworth, L.B.,Saha, N.,Meyer, P.A.,Patra, D.,Zimmerman, B.,Janes, P.W.,Rubinstein, E.,Nikolov, D.B.,Skiniotis, G.,Kruse, A.C.,Blacklow, S.C. Structural Basis for Regulated Proteolysis by the alpha-Secretase ADAM10. Cell 2017 171 1638 0 5WPL 29282294 KRas G12V, bound to GppNHp and miniprotein 225-11 2017-08-05 2018-01-03 McGee, J.H.,Shim, S.Y.,Lee, S.J.,Swanson, P.K.,Jiang, S.Y.,Durney, M.A.,Verdine, G.L. Exceptionally high-affinity Ras binders that remodel its effector domain. J. Biol. Chem. 2018 293 3265 3280 5WPM 29282294 KRas G12V, bound to GppNHp and miniprotein 225-11(A30R) 2017-08-05 2018-01-03 McGee, J.H.,Shim, S.Y.,Lee, S.J.,Swanson, P.K.,Jiang, S.Y.,Durney, M.A.,Verdine, G.L. Exceptionally high-affinity Ras binders that remodel its effector domain. J. Biol. Chem. 2018 293 3265 3280 6B2C 29259749 Macrophage Migration Inhibitory Factor in Complex with a Naphthyridinone Inhibitor (4b) 2017-09-19 2018-01-03 Dawson, T.K.,Dziedzic, P.,Robertson, M.J.,Cisneros, J.A.,Krimmer, S.G.,Newton, A.S.,Tirado-Rives, J.,Jorgensen, W.L. Adding a Hydrogen Bond May Not Help: Naphthyridinone vs Quinoline Inhibitors of Macrophage Migration Inhibitory Factor. ACS Med Chem Lett 2017 8 1287 1291 6ARX 29276037 Crystal structure of an insecticide-resistant acetylcholinesterase mutant from the malaria vector Anopheles gambiae in the ligand-free state 2017-08-23 2018-01-10 Cheung, J.,Mahmood, A.,Kalathur, R.,Liu, L.,Carlier, P.R. Structure of the G119S Mutant Acetylcholinesterase of the Malaria Vector Anopheles gambiae Reveals Basis of Insecticide Resistance. Structure 2018 26 130 0 6ARY 29276037 Crystal structure of an insecticide-resistant acetylcholinesterase mutant from the malaria vector Anopheles gambiae in complex with a difluoromethyl ketone inhibitor 2017-08-23 2018-01-10 Cheung, J.,Mahmood, A.,Kalathur, R.,Liu, L.,Carlier, P.R. Structure of the G119S Mutant Acetylcholinesterase of the Malaria Vector Anopheles gambiae Reveals Basis of Insecticide Resistance. Structure 2018 26 130 0 6BBO 29290613 Crystal structure of human APOBEC3H/RNA complex 2017-10-19 2018-01-10 Shaban, N.M.,Shi, K.,Lauer, K.V.,Carpenter, M.A.,Richards, C.M.,Salamango, D.,Wang, J.,Lopresti, M.W.,Banerjee, S.,Levin-Klein, R.,Brown, W.L.,Aihara, H.,Harris, R.S. The Antiviral and Cancer Genomic DNA Deaminase APOBEC3H Is Regulated by an RNA-Mediated Dimerization Mechanism. Mol. Cell 2018 69 75 0 5BJZ 29321208 Crystal structure of maltose binding protein in complex with an allosteric synthetic antibody 2017-09-12 2018-01-17 Mukherjee, S.,Griffin, D.H.,Horn, J.R.,Rizk, S.S.,Nocula-Lugowska, M.,Malmqvist, M.,Kim, S.S.,Kossiakoff, A.A. Engineered synthetic antibodies as probes to quantify the energetic contributions of ligand binding to conformational changes in proteins. J. Biol. Chem. 2018 293 2815 2828 5BK2 29321208 Crystal structure of maltose binding protein in complex with a peristeric synthetic antibody 2017-09-12 2018-01-17 Mukherjee, S.,Griffin, D.H.,Horn, J.R.,Rizk, S.S.,Nocula-Lugowska, M.,Malmqvist, M.,Kim, S.S.,Kossiakoff, A.A. Engineered synthetic antibodies as probes to quantify the energetic contributions of ligand binding to conformational changes in proteins. J. Biol. Chem. 2018 293 2815 2828 5V7P 29342140 Atomic structure of the eukaryotic intramembrane Ras methyltransferase ICMT (isoprenylcysteine carboxyl methyltransferase), in complex with a monobody 2017-03-20 2018-01-17 Diver, M.M.,Pedi, L.,Koide, A.,Koide, S.,Long, S.B. Atomic structure of the eukaryotic intramembrane RAS methyltransferase ICMT. Nature 2018 553 526 529 6BMN 29326245 Structure of human DHHC20 palmitoyltransferase, space group P63 2017-11-15 2018-01-24 Rana, M.S.,Kumar, P.,Lee, C.J.,Verardi, R.,Rajashankar, K.R.,Banerjee, A. Fatty acyl recognition and transfer by an integral membraneS-acyltransferase. Science 2018 359 0 0 5ULU 30033219 Crystal Structure of Mouse Cadherin-23 EC19-21 (S2087P) with non-syndromic deafness (DFNB12) associated mutation D2148N 2017-01-25 2018-01-31 Jaiganesh, A.,De-la-Torre, P.,Patel, A.A.,Termine, D.J.,Velez-Cortes, F.,Chen, C.,Sotomayor, M. Zooming in on Cadherin-23: Structural Diversity and Potential Mechanisms of Inherited Deafness. Structure 2018 26 1210 0 5W8X 29371662 Lipid A Disaccharide Synthase (LpxB)-7 solubilizing mutations-Bound to UDP 2017-06-22 2018-01-31 Bohl, T.E.,Shi, K.,Lee, J.K.,Aihara, H. Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli. Nat Commun 2018 9 377 377 5VR3 29433126 Crystal structure of the BRS domain of BRAF 2017-05-10 2018-02-14 Lavoie, H.,Sahmi, M.,Maisonneuve, P.,Marullo, S.A.,Thevakumaran, N.,Jin, T.,Kurinov, I.,Sicheri, F.,Therrien, M. MEK drives BRAF activation through allosteric control of KSR proteins. Nature 2018 554 549 553 5VYK 29433126 Crystal structure of the BRS domain of BRAF in complex with the CC-SAM domain of KSR1 2017-05-25 2018-02-14 Lavoie, H.,Sahmi, M.,Maisonneuve, P.,Marullo, S.A.,Thevakumaran, N.,Jin, T.,Kurinov, I.,Sicheri, F.,Therrien, M. MEK drives BRAF activation through allosteric control of KSR proteins. Nature 2018 554 549 553 5W0D 29343437 Inferred precursor (UCA) of the human antibody lineage K03.12 in complex with influenza hemagglutinin H1 Solomon Islands/03/2006 2017-05-30 2018-02-14 McCarthy, K.R.,Watanabe, A.,Kuraoka, M.,Do, K.T.,McGee, C.E.,Sempowski, G.D.,Kepler, T.B.,Schmidt, A.G.,Kelsoe, G.,Harrison, S.C. Memory B Cells that Cross-React with Group 1 and Group 2 Influenza A Viruses Are Abundant in Adult Human Repertoires. Immunity 2018 48 174 0 5WIS 28934499 Crystal structure of the Thermus thermophilus 70S ribosome in complex with methymycin and bound to mRNA and A-, P- and E-site tRNAs at 2.7A resolution 2017-07-20 2018-02-14 Almutairi, M.M.,Svetlov, M.S.,Hansen, D.A.,Khabibullina, N.F.,Klepacki, D.,Kang, H.Y.,Sherman, D.H.,Vazquez-Laslop, N.,Polikanov, Y.S.,Mankin, A.S. Co-produced natural ketolides methymycin and pikromycin inhibit bacterial growth by preventing synthesis of a limited number of proteins. Nucleic Acids Res. 2017 45 9573 9582 5WIT 28934499 Crystal structure of the Thermus thermophilus 70S ribosome in complex with pikromycin and bound to mRNA and A-, P- and E-site tRNAs at 2.6A resolution 2017-07-20 2018-02-14 Almutairi, M.M.,Svetlov, M.S.,Hansen, D.A.,Khabibullina, N.F.,Klepacki, D.,Kang, H.Y.,Sherman, D.H.,Vazquez-Laslop, N.,Polikanov, Y.S.,Mankin, A.S. Co-produced natural ketolides methymycin and pikromycin inhibit bacterial growth by preventing synthesis of a limited number of proteins. Nucleic Acids Res. 2017 45 9573 9582 6BRK 29379009 The SAM domain of mouse SAMHD1 is critical for its activation and regulation 2017-11-30 2018-02-14 Buzovetsky, O.,Tang, C.,Knecht, K.M.,Antonucci, J.M.,Wu, L.,Ji, X.,Xiong, Y. The SAM domain of mouse SAMHD1 is critical for its activation and regulation. Nat Commun 2018 9 411 411 6BZG 30566683 Structure of S. cerevisiae Zip2:Spo16 complex, P212121 form 2017-12-23 2018-02-14 Arora, K.,Corbett, K.D. The conserved XPF:ERCC1-like Zip2:Spo16 complex controls meiotic crossover formation through structure-specific DNA binding. Nucleic Acids Res. 2019 47 2365 2376 5VAE 29462788 Crystal structure of accessory secretion protein 1 and 3 2017-03-25 2018-02-21 Chen, Y.,Bensing, B.A.,Seepersaud, R.,Mi, W.,Liao, M.,Jeffrey, P.D.,Shajahan, A.,Sonon, R.N.,Azadi, P.,Sullam, P.M.,Rapoport, T.A. Unraveling the sequence of cytosolic reactions in the export of GspB adhesin fromStreptococcus gordonii. J. Biol. Chem. 2018 293 5360 5373 5VAF 29462788 Crystal structure of accessory secretion protein 1 2017-03-25 2018-02-21 Chen, Y.,Bensing, B.A.,Seepersaud, R.,Mi, W.,Liao, M.,Jeffrey, P.D.,Shajahan, A.,Sonon, R.N.,Azadi, P.,Sullam, P.M.,Rapoport, T.A. Unraveling the sequence of cytosolic reactions in the export of GspB adhesin fromStreptococcus gordonii. J. Biol. Chem. 2018 293 5360 5373 6BW6 29459785 Human GPT (DPAGT1) H129 variant in complex with tunicamycin 2017-12-14 2018-02-21 Yoo, J.,Mashalidis, E.H.,Kuk, A.C.Y.,Yamamoto, K.,Kaeser, B.,Ichikawa, S.,Lee, S.Y. GlcNAc-1-P-transferase-tunicamycin complex structure reveals basis for inhibition of N-glycosylation. Nat. Struct. Mol. Biol. 2018 25 217 224 6C5L 29403017 Conformation of methylated GGQ in the Peptidyl Transferase Center during translation termination (T. thermophilus) 2018-01-16 2018-02-21 Zeng, F.,Jin, H. Conformation of methylated GGQ in the Peptidyl Transferase Center during Translation Termination. Sci Rep 2018 8 2349 2349 6CAD 29407977 Crystal structure of RAF kinase domain bound to the inhibitor 2a 2018-01-30 2018-02-21 Assadieskandar, A.,Yu, C.,Maisonneuve, P.,Liu, X.,Chen, Y.C.,Prakash, G.K.S.,Kurinov, I.,Sicheri, F.,Zhang, C. Effects of rigidity on the selectivity of protein kinase inhibitors. Eur J Med Chem 2018 146 519 528 5V8X Mutant Structures of Streptococcus Agalactiae GBS Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) 2017-03-22 2018-02-28 Schormann, N.,Ulett, G.C.,Chattopadhyay, D. Mutant Structures of Streptococcus Agalactiae GBS Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) To Be Published 0 0 0 0 6C8F 29483651 Crystal structure of Transient Receptor Potential (TRP) channel TRPV4 in the presence of cesium 2018-01-24 2018-02-28 Deng, Z.,Paknejad, N.,Maksaev, G.,Sala-Rabanal, M.,Nichols, C.G.,Hite, R.K.,Yuan, P. Cryo-EM and X-ray structures of TRPV4 reveal insight into ion permeation and gating mechanisms. Nat. Struct. Mol. Biol. 2018 25 252 260 6C8G 29483651 Crystal structure of Transient Receptor Potential (TRP) channel TRPV4 in the presence of barium 2018-01-24 2018-02-28 Deng, Z.,Paknejad, N.,Maksaev, G.,Sala-Rabanal, M.,Nichols, C.G.,Hite, R.K.,Yuan, P. Cryo-EM and X-ray structures of TRPV4 reveal insight into ion permeation and gating mechanisms. Nat. Struct. Mol. Biol. 2018 25 252 260 6C8H 29483651 Crystal structure of Transient Receptor Potential (TRP) channel TRPV4 in the presence of gadolinium 2018-01-24 2018-02-28 Deng, Z.,Paknejad, N.,Maksaev, G.,Sala-Rabanal, M.,Nichols, C.G.,Hite, R.K.,Yuan, P. Cryo-EM and X-ray structures of TRPV4 reveal insight into ion permeation and gating mechanisms. Nat. Struct. Mol. Biol. 2018 25 252 260 5UTL Mutant Structures of Streptococcus Agalactiae GBS Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) 2017-02-15 2018-03-07 Schormann, N.,Ulett, G.C.,Chattopadhyay, D. Mutant Structures of Streptococcus agalactiae GAPDH To Be Published 0 0 0 0 6CFJ 29410130 Crystal structure of the Thermus thermophilus 70S ribosome in complex with histidyl-CAM and bound to mRNA and A-, P-, and E-site tRNAs at 2.8A resolution 2018-02-15 2018-03-07 Tereshchenkov, A.G.,Dobosz-Bartoszek, M.,Osterman, I.A.,Marks, J.,Sergeeva, V.A.,Kasatsky, P.,Komarova, E.S.,Stavrianidi, A.N.,Rodin, I.A.,Konevega, A.L.,Sergiev, P.V.,Sumbatyan, N.V.,Mankin, A.S.,Bogdanov, A.A.,Polikanov, Y.S. Binding and Action of Amino Acid Analogs of Chloramphenicol upon the Bacterial Ribosome. J. Mol. Biol. 2018 430 842 852 6CFJ 29410130 Crystal structure of the Thermus thermophilus 70S ribosome in complex with histidyl-CAM and bound to mRNA and A-, P-, and E-site tRNAs at 2.8A resolution 2018-02-15 2018-03-07 Tereshchenkov, A.G.,Dobosz-Bartoszek, M.,Osterman, I.A.,Marks, J.,Sergeeva, V.A.,Kasatsky, P.,Komarova, E.S.,Stavrianidi, A.N.,Rodin, I.A.,Konevega, A.L.,Sergiev, P.V.,Sumbatyan, N.V.,Mankin, A.S.,Bogdanov, A.A.,Polikanov, Y.S. Binding and Action of Amino Acid Analogs of Chloramphenicol upon the Bacterial Ribosome. J. Mol. Biol. 2018 430 842 852 6CFK 29410130 Crystal structure of the Thermus thermophilus 70S ribosome in complex with D-histidyl-CAM and bound to protein Y (YfiA) at 2.7A resolution 2018-02-15 2018-03-07 Tereshchenkov, A.G.,Dobosz-Bartoszek, M.,Osterman, I.A.,Marks, J.,Sergeeva, V.A.,Kasatsky, P.,Komarova, E.S.,Stavrianidi, A.N.,Rodin, I.A.,Konevega, A.L.,Sergiev, P.V.,Sumbatyan, N.V.,Mankin, A.S.,Bogdanov, A.A.,Polikanov, Y.S. Binding and Action of Amino Acid Analogs of Chloramphenicol upon the Bacterial Ribosome. J. Mol. Biol. 2018 430 842 852 6CFK 29410130 Crystal structure of the Thermus thermophilus 70S ribosome in complex with D-histidyl-CAM and bound to protein Y (YfiA) at 2.7A resolution 2018-02-15 2018-03-07 Tereshchenkov, A.G.,Dobosz-Bartoszek, M.,Osterman, I.A.,Marks, J.,Sergeeva, V.A.,Kasatsky, P.,Komarova, E.S.,Stavrianidi, A.N.,Rodin, I.A.,Konevega, A.L.,Sergiev, P.V.,Sumbatyan, N.V.,Mankin, A.S.,Bogdanov, A.A.,Polikanov, Y.S. Binding and Action of Amino Acid Analogs of Chloramphenicol upon the Bacterial Ribosome. J. Mol. Biol. 2018 430 842 852 6CFL 29410130 Crystal structure of the Thermus thermophilus 70S ribosome in complex with lysyl-CAM and bound to protein Y (YfiA) at 2.6A resolution 2018-02-15 2018-03-07 Tereshchenkov, A.G.,Dobosz-Bartoszek, M.,Osterman, I.A.,Marks, J.,Sergeeva, V.A.,Kasatsky, P.,Komarova, E.S.,Stavrianidi, A.N.,Rodin, I.A.,Konevega, A.L.,Sergiev, P.V.,Sumbatyan, N.V.,Mankin, A.S.,Bogdanov, A.A.,Polikanov, Y.S. Binding and Action of Amino Acid Analogs of Chloramphenicol upon the Bacterial Ribosome. J. Mol. Biol. 2018 430 842 852 6CFL 29410130 Crystal structure of the Thermus thermophilus 70S ribosome in complex with lysyl-CAM and bound to protein Y (YfiA) at 2.6A resolution 2018-02-15 2018-03-07 Tereshchenkov, A.G.,Dobosz-Bartoszek, M.,Osterman, I.A.,Marks, J.,Sergeeva, V.A.,Kasatsky, P.,Komarova, E.S.,Stavrianidi, A.N.,Rodin, I.A.,Konevega, A.L.,Sergiev, P.V.,Sumbatyan, N.V.,Mankin, A.S.,Bogdanov, A.A.,Polikanov, Y.S. Binding and Action of Amino Acid Analogs of Chloramphenicol upon the Bacterial Ribosome. J. Mol. Biol. 2018 430 842 852 6CFM Crystal Structure of the Human vaccinia-related kinase bound to a propynyl-pteridinone inhibitor 2018-02-15 2018-03-07 Counago, R.M.,dos Reis, C.V.,de Souza, G.P.,Azevedo, H.,Guimaraes, C.,Mascarello, A.,Gama, F.,Ferreira, M.,Massirer, K.B.,Arruda, P.,Edwards, A.M.,Elkins, J.M.,Structural Genomics Consortium (SGC) Crystal Structure of the Human vaccinia-related kinase bound to a propynyl-pteridinone inhibitor To Be Published 0 0 0 0 5NCV Crystal Structure of Cytochrome c in complex with p-Methylphosphonatocalix[4]arene 2017-03-06 2018-03-14 Alex, J.M.,Rennie, M.L.,Volpi, S.,Sansone, F.,Casnati, A.,Crowley, P.B. Phosphonated Calixarene as a """"Molecular Glue"""" for Protein Crystallization Cryst.Growth Des. 2018 18 2467 2473 5WKV 29513651 Structure of an acid sensing ion channel in a resting state with calcium 2017-07-25 2018-03-14 Yoder, N.,Yoshioka, C.,Gouaux, E. Gating mechanisms of acid-sensing ion channels. Nature 2018 555 397 401 6C33 29635474 Mycobacterium smegmatis DNA flap endonuclease 2018-01-09 2018-03-28 Uson, M.L.,Carl, A.,Goldgur, Y.,Shuman, S. Crystal structure and mutational analysis of Mycobacterium smegmatis FenA highlight active site amino acids and three metal ions essential for flap endonuclease and 5' exonuclease activities. Nucleic Acids Res. 2018 46 4164 4175 6C36 29635474 Mycobacterium smegmatis flap endonuclease mutant D208N 2018-01-09 2018-03-28 Uson, M.L.,Carl, A.,Goldgur, Y.,Shuman, S. Crystal structure and mutational analysis of Mycobacterium smegmatis FenA highlight active site amino acids and three metal ions essential for flap endonuclease and 5' exonuclease activities. Nucleic Acids Res. 2018 46 4164 4175 6CIN 29581263 Crystal structure of pyruvate:ferredoxin oxidoreductase from Moorella thermoacetica 2018-02-24 2018-03-28 Chen, P.Y.,Aman, H.,Can, M.,Ragsdale, S.W.,Drennan, C.L. Binding site for coenzyme A revealed in the structure of pyruvate:ferredoxin oxidoreductase fromMoorella thermoacetica. Proc. Natl. Acad. Sci. U.S.A. 2018 115 3846 3851 6CIO 29581263 Pyruvate:ferredoxin oxidoreductase from Moorella thermoacetica with lactyl-TPP bound 2018-02-24 2018-03-28 Chen, P.Y.,Aman, H.,Can, M.,Ragsdale, S.W.,Drennan, C.L. Binding site for coenzyme A revealed in the structure of pyruvate:ferredoxin oxidoreductase fromMoorella thermoacetica. Proc. Natl. Acad. Sci. U.S.A. 2018 115 3846 3851 6CIP 29581263 Pyruvate:ferredoxin oxidoreductase from Moorella thermoacetica with acetyl-TPP bound 2018-02-24 2018-03-28 Chen, P.Y.,Aman, H.,Can, M.,Ragsdale, S.W.,Drennan, C.L. Binding site for coenzyme A revealed in the structure of pyruvate:ferredoxin oxidoreductase fromMoorella thermoacetica. Proc. Natl. Acad. Sci. U.S.A. 2018 115 3846 3851 6CIQ 29581263 Pyruvate:ferredoxin oxidoreductase from Moorella thermoacetica with coenzyme A bound 2018-02-24 2018-03-28 Chen, P.Y.,Aman, H.,Can, M.,Ragsdale, S.W.,Drennan, C.L. Binding site for coenzyme A revealed in the structure of pyruvate:ferredoxin oxidoreductase fromMoorella thermoacetica. Proc. Natl. Acad. Sci. U.S.A. 2018 115 3846 3851 6CQH Crystal Structure of the Human vaccinia-related kinase bound to a N-propynyl-N-ethyl-dihydropteridine inhibitor 2018-03-15 2018-03-28 dos Reis, C.V.,de Souza, G.P.,Counago, R.M.,Azevedo, H.,Guimaraes, C.,Mascarello, A.,Gama, F.,Ferreira, M.,Massirer, K.B.,Arruda, P.,Edwards, A.M.,Elkins, J.M.,Structural Genomics Consortium (SGC) Crystal Structure of the Human vaccinia-related kinase bound to a N-propynyl-N-ethyl-dihydropteridine inhibitor To Be Published 0 0 0 0 5V8C 30782654 LytR-Csp2A-Psr enzyme from Actinomyces oris 2017-03-21 2018-04-11 Siegel, S.D.,Amer, B.R.,Wu, C.,Sawaya, M.R.,Gosschalk, J.E.,Clubb, R.T.,Ton-That, H. Structure and Mechanism of LcpA, a Phosphotransferase That Mediates Glycosylation of a Gram-Positive Bacterial Cell Wall-Anchored Protein. MBio 2019 10 0 0 6BXK 29590073 Crystal structure of Pyrococcus horikoshii Dph2 with 4Fe-4S cluster and MTA 2017-12-18 2018-04-11 Dong, M.,Kathiresan, V.,Fenwick, M.K.,Torelli, A.T.,Zhang, Y.,Caranto, J.D.,Dzikovski, B.,Sharma, A.,Lancaster, K.M.,Freed, J.H.,Ealick, S.E.,Hoffman, B.M.,Lin, H. Organometallic and radical intermediates reveal mechanism of diphthamide biosynthesis. Science 2018 359 1247 1250 6BXL 29590073 Crystal structure of Pyrococcus horikoshii Dph2 with 4Fe-4S cluster and SAM 2017-12-18 2018-04-11 Dong, M.,Kathiresan, V.,Fenwick, M.K.,Torelli, A.T.,Zhang, Y.,Caranto, J.D.,Dzikovski, B.,Sharma, A.,Lancaster, K.M.,Freed, J.H.,Ealick, S.E.,Hoffman, B.M.,Lin, H. Organometallic and radical intermediates reveal mechanism of diphthamide biosynthesis. Science 2018 359 1247 1250 6BXM 29590073 Crystal structure of Candidatus Methanoperedens nitroreducens Dph2 with 4Fe-4S cluster and SAM/cleaved SAM 2017-12-18 2018-04-11 Dong, M.,Kathiresan, V.,Fenwick, M.K.,Torelli, A.T.,Zhang, Y.,Caranto, J.D.,Dzikovski, B.,Sharma, A.,Lancaster, K.M.,Freed, J.H.,Ealick, S.E.,Hoffman, B.M.,Lin, H. Organometallic and radical intermediates reveal mechanism of diphthamide biosynthesis. Science 2018 359 1247 1250 6BXN 29590073 Crystal structure of Candidatus Methanoperedens nitroreducens Dph2 with 4Fe-4S cluster and SAM 2017-12-18 2018-04-11 Dong, M.,Kathiresan, V.,Fenwick, M.K.,Torelli, A.T.,Zhang, Y.,Caranto, J.D.,Dzikovski, B.,Sharma, A.,Lancaster, K.M.,Freed, J.H.,Ealick, S.E.,Hoffman, B.M.,Lin, H. Organometallic and radical intermediates reveal mechanism of diphthamide biosynthesis. Science 2018 359 1247 1250 6BXO 29590073 Crystal structure of Candidatus Methanoperedens nitroreducens Dph2 with 4Fe-4S cluster and SAH 2017-12-18 2018-04-11 Dong, M.,Kathiresan, V.,Fenwick, M.K.,Torelli, A.T.,Zhang, Y.,Caranto, J.D.,Dzikovski, B.,Sharma, A.,Lancaster, K.M.,Freed, J.H.,Ealick, S.E.,Hoffman, B.M.,Lin, H. Organometallic and radical intermediates reveal mechanism of diphthamide biosynthesis. Science 2018 359 1247 1250 6CTH Crystal Structure of Pathogenesis-related Protein 1G (PR-1G) Kinase Domain from Cacao 2018-03-23 2018-04-11 Tosarini, T.R.,Profeta, G.S.,dos Reis, C.V.,Counago, R.M.,Massirer, K.B.,Mondego, J.M.C.,Edwards, A.M.,Elkins, J.M. Crystal Structure of Pathogenesis-related Protein 1G (PR-1G) Kinase Domain from Cacao To Be Published 0 0 0 0 5XPG 28911094 Crystal structure of T. thermophilus Argonaute protein complexed with a bulge 6'U7' on the target strand 2017-06-02 2018-04-18 Sheng, G.,Gogakos, T.,Wang, J.,Zhao, H.,Serganov, A.,Juranek, S.,Tuschl, T.,Patel, D.J.,Wang, Y. Structure/cleavage-based insights into helical perturbations at bulge sites within T. thermophilus Argonaute silencing complexes. Nucleic Acids Res. 2017 45 9149 9163 6CAE 29625040 Crystal structure of the Thermus thermophilus 70S ribosome in complex with NOSO-95179 antibiotic and bound to mRNA and A-, P- and E-site tRNAs at 2.6A resolution 2018-01-30 2018-04-18 Pantel, L.,Florin, T.,Dobosz-Bartoszek, M.,Racine, E.,Sarciaux, M.,Serri, M.,Houard, J.,Campagne, J.M.,de Figueiredo, R.M.,Midrier, C.,Gaudriault, S.,Givaudan, A.,Lanois, A.,Forst, S.,Aumelas, A.,Cotteaux-Lautard, C.,Bolla, J.M.,Vingsbo Lundberg, C.,Huseby, D.L.,Hughes, D.,Villain-Guillot, P.,Mankin, A.S.,Polikanov, Y.S.,Gualtieri, M. Odilorhabdins, Antibacterial Agents that Cause Miscoding by Binding at a New Ribosomal Site. Mol. Cell 2018 70 83 0 6CAE 29625040 Crystal structure of the Thermus thermophilus 70S ribosome in complex with NOSO-95179 antibiotic and bound to mRNA and A-, P- and E-site tRNAs at 2.6A resolution 2018-01-30 2018-04-18 Pantel, L.,Florin, T.,Dobosz-Bartoszek, M.,Racine, E.,Sarciaux, M.,Serri, M.,Houard, J.,Campagne, J.M.,de Figueiredo, R.M.,Midrier, C.,Gaudriault, S.,Givaudan, A.,Lanois, A.,Forst, S.,Aumelas, A.,Cotteaux-Lautard, C.,Bolla, J.M.,Vingsbo Lundberg, C.,Huseby, D.L.,Hughes, D.,Villain-Guillot, P.,Mankin, A.S.,Polikanov, Y.S.,Gualtieri, M. Odilorhabdins, Antibacterial Agents that Cause Miscoding by Binding at a New Ribosomal Site. Mol. Cell 2018 70 83 0 6CMG 24130486 Crystal Structure of the Hendra Virus Attachment G Glycoprotein Bound to a Potent Cross-Reactive Neutralizing Human Monoclonal Antibody m102.3 2018-03-05 2018-04-18 Xu, K.,Rockx, B.,Xie, Y.,DeBuysscher, B.L.,Fusco, D.L.,Zhu, Z.,Chan, Y.P.,Xu, Y.,Luu, T.,Cer, R.Z.,Feldmann, H.,Mokashi, V.,Dimitrov, D.S.,Bishop-Lilly, K.A.,Broder, C.C.,Nikolov, D.B. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody. PLoS Pathog. 2013 9 0 0 6CMI 24130486 Crystal Structure of the Hendra Virus Attachment G Glycoprotein Bound to a Potent Cross-Reactive Neutralizing Human Monoclonal Antibody m102.3 2018-03-05 2018-04-18 Xu, K.,Rockx, B.,Xie, Y.,DeBuysscher, B.L.,Fusco, D.L.,Zhu, Z.,Chan, Y.P.,Xu, Y.,Luu, T.,Cer, R.Z.,Feldmann, H.,Mokashi, V.,Dimitrov, D.S.,Bishop-Lilly, K.A.,Broder, C.C.,Nikolov, D.B. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody. PLoS Pathog. 2013 9 0 0 5VSU 29717126 Structure of yeast U6 snRNP with 2'-phosphate terminated U6 RNA 2017-05-12 2018-05-09 Montemayor, E.J.,Didychuk, A.L.,Yake, A.D.,Sidhu, G.K.,Brow, D.A.,Butcher, S.E. Architecture of the U6 snRNP reveals specific recognition of 3'-end processed U6 snRNA. Nat Commun 2018 9 1749 1749 6BM8 29728654 Crystal structure of glycoprotein B from Herpes Simplex Virus type I 2017-11-13 2018-05-16 Cooper, R.S.,Georgieva, E.R.,Borbat, P.P.,Freed, J.H.,Heldwein, E.E. Structural basis for membrane anchoring and fusion regulation of the herpes simplex virus fusogen gB. Nat. Struct. Mol. Biol. 2018 25 416 424 6C0B 29748286 Structural basis for recognition of frizzled proteins by Clostridium difficile toxin B 2017-12-28 2018-05-16 Chen, P.,Tao, L.,Wang, T.,Zhang, J.,He, A.,Lam, K.H.,Liu, Z.,He, X.,Perry, K.,Dong, M.,Jin, R. Structural basis for recognition of frizzled proteins byClostridium difficiletoxin B. Science 2018 360 664 669 6CH2 29720631 Crystal structure of the cytoplasmic domain of FlhA and FliT-FliD complex 2018-02-21 2018-05-16 Xing, Q.,Shi, K.,Portaliou, A.,Rossi, P.,Economou, A.,Kalodimos, C.G. Structures of chaperone-substrate complexes docked onto the export gate in a type III secretion system. Nat Commun 2018 9 1773 1773 6D79 29792261 Structure of CysZ, a sulfate permease from Pseudomonas Fragi 2018-04-24 2018-05-16 Assur Sanghai, Z.,Liu, Q.,Clarke, O.B.,Belcher-Dufrisne, M.,Wiriyasermkul, P.,Giese, M.H.,Leal-Pinto, E.,Kloss, B.,Tabuso, S.,Love, J.,Punta, M.,Banerjee, S.,Rajashankar, K.R.,Rost, B.,Logothetis, D.,Quick, M.,Hendrickson, W.A.,Mancia, F. Structure-based analysis of CysZ-mediated cellular uptake of sulfate. Elife 2018 7 0 0 5VL4 31840320 Accidental minimum contact crystal lattice formed by a redesigned protein oligomer 2017-04-24 2018-05-23 Cannon, K.A.,Park, R.U.,Boyken, S.E.,Nattermann, U.,Yi, S.,Baker, D.,King, N.P.,Yeates, T.O. Design and structure of two new protein cages illustrate successes and ongoing challenges in protein engineering. Protein Sci. 2020 29 919 929 6B5C 29752405 Structural Basis for Katanin Self-Assembly 2017-09-29 2018-05-23 Nithianantham, S.,McNally, F.J.,Al-Bassam, J. Structural basis for disassembly of katanin heterododecamers. J. Biol. Chem. 2018 293 10590 10605 6B5D 29752405 Structural Basis for Katanin Self-Assembly 2017-09-29 2018-05-23 Nithianantham, S.,McNally, F.J.,Al-Bassam, J. Structural basis for disassembly of katanin heterododecamers. J. Biol. Chem. 2018 293 10590 10605 6D13 29733359 Crystal structure of E.coli RppH-DapF complex 2018-04-11 2018-05-23 Gao, A.,Vasilyev, N.,Luciano, D.J.,Levenson-Palmer, R.,Richards, J.,Marsiglia, W.M.,Traaseth, N.J.,Belasco, J.G.,Serganov, A. Structural and kinetic insights into stimulation of RppH-dependent RNA degradation by the metabolic enzyme DapF. Nucleic Acids Res. 2018 46 6841 6856 6D1Q 29733359 Crystal structure of E. coli RppH-DapF complex, monomer 2018-04-12 2018-05-23 Gao, A.,Vasilyev, N.,Luciano, D.J.,Levenson-Palmer, R.,Richards, J.,Marsiglia, W.M.,Traaseth, N.J.,Belasco, J.G.,Serganov, A. Structural and kinetic insights into stimulation of RppH-dependent RNA degradation by the metabolic enzyme DapF. Nucleic Acids Res. 2018 46 6841 6856 6D1V 29733359 Crystal structure of E. coli RppH-DapF complex, monomer bound to RNA 2018-04-12 2018-05-23 Gao, A.,Vasilyev, N.,Luciano, D.J.,Levenson-Palmer, R.,Richards, J.,Marsiglia, W.M.,Traaseth, N.J.,Belasco, J.G.,Serganov, A. Structural and kinetic insights into stimulation of RppH-dependent RNA degradation by the metabolic enzyme DapF. Nucleic Acids Res. 2018 46 6841 6856 6D9Z 29792261 Structure of CysZ, a sulfate permease from Pseudomonas Denitrificans 2018-04-30 2018-05-23 Assur Sanghai, Z.,Liu, Q.,Clarke, O.B.,Belcher-Dufrisne, M.,Wiriyasermkul, P.,Giese, M.H.,Leal-Pinto, E.,Kloss, B.,Tabuso, S.,Love, J.,Punta, M.,Banerjee, S.,Rajashankar, K.R.,Rost, B.,Logothetis, D.,Quick, M.,Hendrickson, W.A.,Mancia, F. Structure-based analysis of CysZ-mediated cellular uptake of sulfate. Elife 2018 7 0 0 6DEX Structure of Eremothecium gossypii Shu1:Shu2 complex 2018-05-13 2018-05-23 Singh, N.,Corbett, K.D. Structure of Eremothecium gossypii Shu1:Shu2 complex To Be Published 0 0 0 0 5W1G 29760382 CR1-07 unliganded Fab 2017-06-03 2018-05-30 Clark, L.E.,Mahmutovic, S.,Raymond, D.D.,Dilanyan, T.,Koma, T.,Manning, J.T.,Shankar, S.,Levis, S.C.,Briggiler, A.M.,Enria, D.A.,Wucherpfennig, K.W.,Paessler, S.,Abraham, J. Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses. Nat Commun 2018 9 1884 1884 6BN7 29892083 Crystal structure of DDB1-CRBN-BRD4(BD1) complex bound to dBET23 PROTAC. 2017-11-16 2018-05-30 Nowak, R.P.,DeAngelo, S.L.,Buckley, D.,He, Z.,Donovan, K.A.,An, J.,Safaee, N.,Jedrychowski, M.P.,Ponthier, C.M.,Ishoey, M.,Zhang, T.,Mancias, J.D.,Gray, N.S.,Bradner, J.E.,Fischer, E.S. Plasticity in binding confers selectivity in ligand-induced protein degradation. Nat. Chem. Biol. 2018 14 706 714 6BN9 29892083 Crystal structure of DDB1-CRBN-BRD4(BD1) complex bound to dBET70 PROTAC 2017-11-16 2018-05-30 Nowak, R.P.,DeAngelo, S.L.,Buckley, D.,He, Z.,Donovan, K.A.,An, J.,Safaee, N.,Jedrychowski, M.P.,Ponthier, C.M.,Ishoey, M.,Zhang, T.,Mancias, J.D.,Gray, N.S.,Bradner, J.E.,Fischer, E.S. Plasticity in binding confers selectivity in ligand-induced protein degradation. Nat. Chem. Biol. 2018 14 706 714 6BNB 29892083 Crystal structure of DDB1-CRBN-BRD4(BD1) complex bound to dBET57 PROTAC 2017-11-16 2018-05-30 Nowak, R.P.,DeAngelo, S.L.,Buckley, D.,He, Z.,Donovan, K.A.,An, J.,Safaee, N.,Jedrychowski, M.P.,Ponthier, C.M.,Ishoey, M.,Zhang, T.,Mancias, J.D.,Gray, N.S.,Bradner, J.E.,Fischer, E.S. Plasticity in binding confers selectivity in ligand-induced protein degradation. Nat. Chem. Biol. 2018 14 706 714 6C90 29844170 Human Mtr4 helicase in complex with ZCCHC8-CTD 2018-01-25 2018-05-30 Puno, M.R.,Lima, C.D. Structural basis for MTR4-ZCCHC8 interactions that stimulate the MTR4 helicase in the nuclear exosome-targeting complex. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6F7W 29673020 Crystal structure of dimethylated RSL - cucurbit[7]uril complex, C2221 Form 2017-12-12 2018-05-30 Guagnini, F.,Antonik, P.M.,Rennie, M.L.,O'Byrne, P.,Khan, A.R.,Pinalli, R.,Dalcanale, E.,Crowley, P.B. Cucurbit[7]uril-Dimethyllysine Recognition in a Model Protein. Angew. Chem. Int. Ed. Engl. 2018 57 7126 7130 6F7Y 29673020 Crystal structure of dimethylated RSL, cucurbituril-free form 2017-12-12 2018-05-30 Guagnini, F.,Antonik, P.M.,Rennie, M.L.,O'Byrne, P.,Khan, A.R.,Pinalli, R.,Dalcanale, E.,Crowley, P.B. Cucurbit[7]uril-Dimethyllysine Recognition in a Model Protein. Angew. Chem. Int. Ed. Engl. 2018 57 7126 7130 5W1A 31786266 The first X-ray crystal structure of an insect muscle myosin. Drosophila melanogaster, skeletal muscle myosin II, an embryonic isoform, subfragment-1 2017-06-02 2018-06-06 Caldwell, J.T.,Mermelstein, D.J.,Walker, R.C.,Bernstein, S.I.,Huxford, T. X-ray crystallographic and molecular dynamic analyses of Drosophila melanogaster embryonic muscle myosin define domains responsible for isoform-specific properties. J.Mol.Biol. 2019 0 0 0 5W1D 32963095 Crystal Structure of Mouse Protocadherin-15 EC4-7 2017-06-02 2018-06-06 Choudhary, D.,Narui, Y.,Neel, B.L.,Wimalasena, L.N.,Klanseck, C.F.,De-la-Torre, P.,Chen, C.,Araya-Secchi, R.,Tamilselvan, E.,Sotomayor, M. Structural determinants of protocadherin-15 mechanics and function in hearing and balance perception. Proc.Natl.Acad.Sci.USA 2020 0 0 0 6BN8 29892083 Crystal structure of DDB1-CRBN-BRD4(BD1) complex bound to dBET55 PROTAC. 2017-11-16 2018-06-06 Nowak, R.P.,DeAngelo, S.L.,Buckley, D.,He, Z.,Donovan, K.A.,An, J.,Safaee, N.,Jedrychowski, M.P.,Ponthier, C.M.,Ishoey, M.,Zhang, T.,Mancias, J.D.,Gray, N.S.,Bradner, J.E.,Fischer, E.S. Plasticity in binding confers selectivity in ligand-induced protein degradation. Nat. Chem. Biol. 2018 14 706 714 6C95 29754825 The Human NatA (Naa10/Naa15) amino-terminal acetyltransferase complex bound to HYPK 2018-01-25 2018-06-06 Gottlieb, L.,Marmorstein, R. Structure of Human NatA and Its Regulation by the Huntingtin Interacting Protein HYPK. Structure 2018 26 925 0 6C9M 29754825 The Human NatA (Naa10/Naa15) amino-terminal acetyltransferase complex 2018-01-26 2018-06-06 Gottlieb, L.,Marmorstein, R. Structure of Human NatA and Its Regulation by the Huntingtin Interacting Protein HYPK. Structure 2018 26 925 0 6DJT 29792696 Structure of TYW1 with a lysine-pyruvate adduct bound 2018-05-26 2018-06-13 Grell, T.A.J.,Young, A.P.,Drennan, C.L.,Bandarian, V. Biochemical and Structural Characterization of a Schiff Base in the Radical-Mediated Biosynthesis of 4-Demethylwyosine by TYW1. J. Am. Chem. Soc. 2018 140 6842 6852 5VOE 29863725 DesGla-XaS195A Bound to Aptamer 11F7t 2017-05-02 2018-06-20 Gunaratne, R.,Kumar, S.,Frederiksen, J.W.,Stayrook, S.,Lohrmann, J.L.,Perry, K.,Bompiani, K.M.,Chabata, C.V.,Thalji, N.K.,Ho, M.D.,Arepally, G.,Camire, R.M.,Krishnaswamy, S.,Sullenger, B.A. Combination of aptamer and drug for reversible anticoagulation in cardiopulmonary bypass. Nat. Biotechnol. 2018 36 606 613 5W55 Crystal Structure of the first bromodomain of human BRD4 in complex with the inhibitor JWG048 2017-06-14 2018-06-20 Xu, X.,Blacklow, S.C. Crystal Structure of the first bromodomain of human BRD4 in complex with the inhibitor JWG048 To Be Published 0 0 0 0 6C08 29872228 Zebrafish SLC38A9 with arginine bound in the cytosol open state 2017-12-28 2018-06-20 Lei, H.T.,Ma, J.,Sanchez Martinez, S.,Gonen, T. Crystal structure of arginine-bound lysosomal transporter SLC38A9 in the cytosol-open state. Nat. Struct. Mol. Biol. 2018 25 522 527 6C5D 29895618 N-terminal domain of Helicobacter pylori LlaJI.R1 2018-01-16 2018-06-27 Hosford, C.J.,Chappie, J.S. The crystal structure of theHelicobacter pyloriLlaJI.R1 N-terminal domain provides a model for site-specific DNA binding. J. Biol. Chem. 2018 293 11758 11771 6CC2 29901028 Crystal Structure of CDC45 from Entamoeba histolytica 2018-02-05 2018-06-27 Kurniawan, F.,Shi, K.,Kurahashi, K.,Bielinsky, A.K.,Aihara, H. Crystal Structure ofEntamoeba histolyticaCdc45 Suggests a Conformational Switch that May Regulate DNA Replication. iScience 2018 3 102 109 6D12 29946027 Crystal structure of C-terminal xRRM domain of human Larp7 bound to 7SK stem-loop 4 RNA 2018-04-11 2018-06-27 Eichhorn, C.D.,Yang, Y.,Repeta, L.,Feigon, J. Structural basis for recognition of human 7SK long noncoding RNA by the La-related protein Larp7. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6DCH 29906336 Structure of isonitrile biosynthesis enzyme ScoE 2018-05-07 2018-06-27 Harris, N.C.,Born, D.A.,Cai, W.,Huang, Y.,Martin, J.,Khalaf, R.,Drennan, C.L.,Zhang, W. Isonitrile Formation by a Non-Heme Iron(II)-Dependent Oxidase/Decarboxylase. Angew. Chem. Int. Ed. Engl. 2018 57 9707 9710 5WA5 30102854 Crystal Structure of the first bromodomain of human BRD4 in complex with the inhibitor XMD11-50 2017-06-24 2018-07-04 Wang, J.,Erazo, T.,Ferguson, F.M.,Buckley, D.L.,Gomez, N.,Munoz-Guardiola, P.,Dieguez-Martinez, N.,Deng, X.,Hao, M.,Massefski, W.,Fedorov, O.,Offei-Addo, N.K.,Park, P.M.,Dai, L.,DiBona, A.,Becht, K.,Kim, N.D.,McKeown, M.R.,Roberts, J.M.,Zhang, J.,Sim, T.,Alessi, D.R.,Bradner, J.E.,Lizcano, J.M.,Blacklow, S.C.,Qi, J.,Xu, X.,Gray, N.S. Structural and Atropisomeric Factors Governing the Selectivity of Pyrimido-benzodiazipinones as Inhibitors of Kinases and Bromodomains. ACS Chem. Biol. 2018 13 2438 2448 5WJ8 30033219 Crystal Structure of Human Cadherin-23 EC13-14 2017-07-21 2018-07-04 Jaiganesh, A.,De-la-Torre, P.,Patel, A.A.,Termine, D.J.,Velez-Cortes, F.,Chen, C.,Sotomayor, M. Zooming in on Cadherin-23: Structural Diversity and Potential Mechanisms of Inherited Deafness. Structure 2018 26 1210 0 6BJX 29910185 Group I self-splicing intron P4-P6 domain mutant U131A (with isopropanol soaking) 2017-11-07 2018-07-04 Shoffner, G.M.,Wang, R.,Podell, E.,Cech, T.R.,Guo, F. In Crystallo Selection to Establish New RNA Crystal Contacts. Structure 2018 26 1275 0 6BQC 30057024 Cyclopropane fatty acid synthase from E. coli 2017-11-27 2018-07-04 Hari, S.B.,Grant, R.A.,Sauer, R.T. Structural and Functional Analysis of E. coli Cyclopropane Fatty Acid Synthase. Structure 2018 26 1251 0 6CDD 29967539 Npl4 zinc finger and MPN domains (Chaetomium thermophilum) 2018-02-08 2018-07-04 Bodnar, N.O.,Kim, K.H.,Ji, Z.,Wales, T.E.,Svetlov, V.,Nudler, E.,Engen, J.R.,Walz, T.,Rapoport, T.A. Structure of the Cdc48 ATPase with its ubiquitin-binding cofactor Ufd1-Npl4. Nat. Struct. Mol. Biol. 2018 25 616 622 6D8M 29910185 Group I self-splicing intron P4-P6 domain mutant A125U/G126U 2018-04-26 2018-07-04 Shoffner, G.M.,Wang, R.,Podell, E.,Cech, T.R.,Guo, F. In Crystallo Selection to Establish New RNA Crystal Contacts. Structure 2018 26 1275 0 6D8O 29910185 Group I self-splicing intron P4-P6 domain mutant A230U 2018-04-26 2018-07-04 Shoffner, G.M.,Wang, R.,Podell, E.,Cech, T.R.,Guo, F. In Crystallo Selection to Establish New RNA Crystal Contacts. Structure 2018 26 1275 0 6DS2 29890074 Crystal structure of Ni(II)-bound human calprotectin 2018-06-13 2018-07-04 Nakashige, T.G.,Bowman, S.E.J.,Zygiel, E.M.,Drennan, C.L.,Nolan, E.M. Biophysical Examination of the Calcium-Modulated Nickel-Binding Properties of Human Calprotectin Reveals Conformational Change in the EF-Hand Domains and His3Asp Site. Biochemistry 2018 57 4155 4164 6C9D 30099988 Crystal structure of KA1-autoinhibited MARK1 kinase 2018-01-26 2018-07-11 Emptage, R.P.,Lemmon, M.A.,Ferguson, K.M.,Marmorstein, R. Structural Basis for MARK1 Kinase Autoinhibition by Its KA1 Domain. Structure 2018 26 1137 0 6ELC 29988048 Crystal Structure of O-linked Glycosylated VSG3 2017-09-28 2018-07-11 Pinger, J.,Nesic, D.,Ali, L.,Aresta-Branco, F.,Lilic, M.,Chowdhury, S.,Kim, H.S.,Verdi, J.,Raper, J.,Ferguson, M.A.J.,Papavasiliou, F.N.,Stebbins, C.E. African trypanosomes evade immune clearance by O-glycosylation of the VSG surface coat. Nat Microbiol 2018 3 932 938 6BVA 30033217 Ubiquitin Variant (UbV.Fl10.1) bound to a human Skp1-Fbl10 fragment complex. 2017-12-12 2018-07-18 Gorelik, M.,Manczyk, N.,Pavlenco, A.,Kurinov, I.,Sidhu, S.S.,Sicheri, F. A Structure-Based Strategy for Engineering Selective Ubiquitin Variant Inhibitors of Skp1-Cul1-F-Box Ubiquitin Ligases. Structure 2018 26 1226 0 6C16 30033217 Ubiquitin variant (UbV.Fbl10.1) bound to a human Skp1-Fbl11 fragment complex. 2018-01-04 2018-07-18 Gorelik, M.,Manczyk, N.,Pavlenco, A.,Kurinov, I.,Sidhu, S.S.,Sicheri, F. A Structure-Based Strategy for Engineering Selective Ubiquitin Variant Inhibitors of Skp1-Cul1-F-Box Ubiquitin Ligases. Structure 2018 26 1226 0 6CT9 30007416 Structure of the human cGAS-DNA complex 2018-03-22 2018-07-18 Zhou, W.,Whiteley, A.T.,de Oliveira Mann, C.C.,Morehouse, B.R.,Nowak, R.P.,Fischer, E.S.,Gray, N.S.,Mekalanos, J.J.,Kranzusch, P.J. Structure of the Human cGAS-DNA Complex Reveals Enhanced Control of Immune Surveillance. Cell 2018 174 300 0 6CTA 30007416 Structure of the human cGAS-DNA complex with ATP 2018-03-22 2018-07-18 Zhou, W.,Whiteley, A.T.,de Oliveira Mann, C.C.,Morehouse, B.R.,Nowak, R.P.,Fischer, E.S.,Gray, N.S.,Mekalanos, J.J.,Kranzusch, P.J. Structure of the Human cGAS-DNA Complex Reveals Enhanced Control of Immune Surveillance. Cell 2018 174 300 0 6D7O 29941865 Crystal Structure of Rat TRPV6* in complex with 2-Aminoethoxydiphenyl borate (2-APB) 2018-04-25 2018-07-18 Singh, A.K.,Saotome, K.,McGoldrick, L.L.,Sobolevsky, A.I. Structural bases of TRP channel TRPV6 allosteric modulation by 2-APB. Nat Commun 2018 9 2465 2465 6D7P 29941865 Crystal Structure of Rat TRPV6*-Y466A 2018-04-25 2018-07-18 Singh, A.K.,Saotome, K.,McGoldrick, L.L.,Sobolevsky, A.I. Structural bases of TRP channel TRPV6 allosteric modulation by 2-APB. Nat Commun 2018 9 2465 2465 6D7Q 29941865 Crystal Structure of Rat TRPV6*-Y466A in complex with 2-Aminoethoxydiphenyl borate (2-APB) 2018-04-25 2018-07-18 Singh, A.K.,Saotome, K.,McGoldrick, L.L.,Sobolevsky, A.I. Structural bases of TRP channel TRPV6 allosteric modulation by 2-APB. Nat Commun 2018 9 2465 2465 6D7V 29941865 Crystal Structure of Rat TRPV6*- in complex with brominated 2-Aminoethoxydiphenyl borate (2-APB-Br) 2018-04-25 2018-07-18 Singh, A.K.,Saotome, K.,McGoldrick, L.L.,Sobolevsky, A.I. Structural bases of TRP channel TRPV6 allosteric modulation by 2-APB. Nat Commun 2018 9 2465 2465 6D7X 29941865 Crystal Structure of Rat TRPV6*-Y466A- in complex with brominated 2-Aminoethoxydiphenyl borate (2-APB-Br) 2018-04-25 2018-07-18 Singh, A.K.,Saotome, K.,McGoldrick, L.L.,Sobolevsky, A.I. Structural bases of TRP channel TRPV6 allosteric modulation by 2-APB. Nat Commun 2018 9 2465 2465 6D8L 29910185 Group I self-splicing intron P4-P6 domain mutant U131A (without isopropanol soaking) 2018-04-26 2018-07-18 Shoffner, G.M.,Wang, R.,Podell, E.,Cech, T.R.,Guo, F. In Crystallo Selection to Establish New RNA Crystal Contacts. Structure 2018 26 1275 0 6D8N 29910185 Group I self-splicing intron P4-P6 domain mutant G134A/U185AA 2018-04-26 2018-07-18 Shoffner, G.M.,Wang, R.,Podell, E.,Cech, T.R.,Guo, F. In Crystallo Selection to Establish New RNA Crystal Contacts. Structure 2018 26 1275 0 6DGB 30289389 Crystal structure of the C-terminal catalytic domain of IS1535 TnpA, an IS607-like serine recombinase 2018-05-17 2018-07-18 Chen, W.,Mandali, S.,Hancock, S.P.,Kumar, P.,Collazo, M.,Cascio, D.,Johnson, R.C. Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition. Elife 2018 7 0 0 6DGC 30289389 Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase 2018-05-17 2018-07-18 Chen, W.,Mandali, S.,Hancock, S.P.,Kumar, P.,Collazo, M.,Cascio, D.,Johnson, R.C. Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition. Elife 2018 7 0 0 6D8A 29996105 RsAgo Ternary Complex with guide RNA and Target DNA Containing A-A Bulge Within the Seed Segment of the Target Strand 2018-04-26 2018-07-25 Liu, Y.,Esyunina, D.,Olovnikov, I.,Teplova, M.,Kulbachinskiy, A.,Aravin, A.A.,Patel, D.J. Accommodation of Helical Imperfections in Rhodobacter sphaeroides Argonaute Ternary Complexes with Guide RNA and Target DNA. Cell Rep 2018 24 453 462 6D8F 29996105 RsAgo Ternary Complex with Guide RNA and Target DNA Containing T-T Bulge Within the Seed Segment 2018-04-26 2018-07-25 Liu, Y.,Esyunina, D.,Olovnikov, I.,Teplova, M.,Kulbachinskiy, A.,Aravin, A.A.,Patel, D.J. Accommodation of Helical Imperfections in Rhodobacter sphaeroides Argonaute Ternary Complexes with Guide RNA and Target DNA. Cell Rep 2018 24 453 462 6D8P 29996105 Ternary RsAgo Complex Containing Guide RNA Paired with Target DNA 2018-04-26 2018-07-25 Liu, Y.,Esyunina, D.,Olovnikov, I.,Teplova, M.,Kulbachinskiy, A.,Aravin, A.A.,Patel, D.J. Accommodation of Helical Imperfections in Rhodobacter sphaeroides Argonaute Ternary Complexes with Guide RNA and Target DNA. Cell Rep 2018 24 453 462 6D92 29996105 Ternary RsAgo Complex with Guide RNA and Target DNA Containing A-A non-canonical pair at position 3 2018-04-27 2018-07-25 Liu, Y.,Esyunina, D.,Olovnikov, I.,Teplova, M.,Kulbachinskiy, A.,Aravin, A.A.,Patel, D.J. Accommodation of Helical Imperfections in Rhodobacter sphaeroides Argonaute Ternary Complexes with Guide RNA and Target DNA. Cell Rep 2018 24 453 462 6D9K 29996105 Ternary RsAgo Complex with Guide RNA and Target DNA Containing A-G Non-canonical Pair 2018-04-30 2018-07-25 Liu, Y.,Esyunina, D.,Olovnikov, I.,Teplova, M.,Kulbachinskiy, A.,Aravin, A.A.,Patel, D.J. Accommodation of Helical Imperfections in Rhodobacter sphaeroides Argonaute Ternary Complexes with Guide RNA and Target DNA. Cell Rep 2018 24 453 462 5WIL 30763067 JAK2 Pseudokinase in complex with AZD7762 2017-07-19 2018-08-01 McNally, R.,Li, Q.,Li, K.,Dekker, C.,Vangrevelinghe, E.,Jones, M.,Chene, P.,Machauer, R.,Radimerski, T.,Eck, M.J. Discovery and Structural Characterization of ATP-Site Ligands for the Wild-Type and V617F Mutant JAK2 Pseudokinase Domain. ACS Chem. Biol. 2019 14 587 593 6B22 29627985 Crystal structure OXA-24 beta-lactamase complexed with WCK 4234 by co-crystallization 2017-09-19 2018-08-01 Papp-Wallace, K.M.,Nguyen, N.Q.,Jacobs, M.R.,Bethel, C.R.,Barnes, M.D.,Kumar, V.,Bajaksouzian, S.,Rudin, S.D.,Rather, P.N.,Bhavsar, S.,Ravikumar, T.,Deshpande, P.K.,Patil, V.,Yeole, R.,Bhagwat, S.S.,Patel, M.V.,van den Akker, F.,Bonomo, R.A. Strategic Approaches to Overcome Resistance against Gram-Negative Pathogens Using beta-Lactamase Inhibitors and beta-Lactam Enhancers: Activity of Three Novel Diazabicyclooctanes WCK 5153, Zidebactam (WCK 5107), and WCK 4234. J. Med. Chem. 2018 61 4067 4086 6CV7 30057206 Mouse Protocadherin-15 Extracellular Cadherin Domains 1 through 3 2018-03-27 2018-08-01 Dionne, G.,Qiu, X.,Rapp, M.,Liang, X.,Zhao, B.,Peng, G.,Katsamba, P.S.,Ahlsen, G.,Rubinstein, R.,Potter, C.S.,Carragher, B.,Honig, B.,Muller, U.,Shapiro, L. Mechanotransduction by PCDH15 Relies on a Novel cis-Dimeric Architecture. Neuron 2018 99 480 0 6DD8 30657449 Structure of mouse SYCP3, P21 form 2018-05-09 2018-08-01 West, A.M.,Rosenberg, S.C.,Ur, S.N.,Lehmer, M.K.,Ye, Q.,Hagemann, G.,Caballero, I.,Uson, I.,MacQueen, A.J.,Herzog, F.,Corbett, K.D. A conserved filamentous assembly underlies the structure of the meiotic chromosome axis. Elife 2019 8 0 0 6DD9 30657449 Structure of mouse SYCP3, P1 form 2018-05-09 2018-08-01 West, A.M.,Rosenberg, S.C.,Ur, S.N.,Lehmer, M.K.,Ye, Q.,Hagemann, G.,Caballero, I.,Uson, I.,MacQueen, A.J.,Herzog, F.,Corbett, K.D. A conserved filamentous assembly underlies the structure of the meiotic chromosome axis. Elife 2019 8 0 0 5ULY 32963095 Crystal Structure of Human Protocadherin-15 EC2-3 2017-01-25 2018-08-08 Choudhary, D.,Narui, Y.,Neel, B.L.,Wimalasena, L.N.,Klanseck, C.F.,De-la-Torre, P.,Chen, C.,Araya-Secchi, R.,Tamilselvan, E.,Sotomayor, M. Structural determinants of protocadherin-15 mechanics and function in hearing and balance perception. Proc.Natl.Acad.Sci.USA 2020 0 0 0 5WKY 30157194 Bromide sites in the structure of an acid sensing ion channel in a resting state 2017-07-25 2018-08-08 Yoder, N.,Gouaux, E. Divalent cation and chloride ion sites of chicken acid sensing ion channel 1a elucidated by x-ray crystallography. PLoS ONE 2018 13 0 0 5WP1 Complex of ERK2 with 5,7-dihydroxychromone 2017-08-03 2018-08-08 Shin, S.H.,Malakhova, M.,Kurinov, I.,Lim, D.Y.,Bode, A.M.,Dong, Z. Multiple phytochemicals at low doses accumulatively inhibit one key protein in cancers To Be Published 0 0 0 0 5XYA 30049896 Crystal structure of a serine protease from Streptococcus species 2017-07-06 2018-08-08 Jobichen, C.,Tan, Y.C.,Prabhakar, M.T.,Nayak, D.,Biswas, D.,Pannu, N.S.,Hanski, E.,Sivaraman, J. Structure of ScpC, a virulence protease fromStreptococcus pyogenes, reveals the functional domains and maturation mechanism. Biochem. J. 2018 475 2847 2860 5XYR 30049896 Crystal structure of a serine protease from Streptococcus species 2017-07-10 2018-08-08 Jobichen, C.,Tan, Y.C.,Prabhakar, M.T.,Nayak, D.,Biswas, D.,Pannu, N.S.,Hanski, E.,Sivaraman, J. Structure of ScpC, a virulence protease fromStreptococcus pyogenes, reveals the functional domains and maturation mechanism. Biochem. J. 2018 475 2847 2860 6C63 29768001 Crystal Structure of the Mango-II Fluorescent Aptamer Bound to TO1-Biotin 2018-01-17 2018-08-08 Trachman 3rd., R.J.,Abdolahzadeh, A.,Andreoni, A.,Cojocaru, R.,Knutson, J.R.,Ryckelynck, M.,Unrau, P.J.,Ferre-D'Amare, A.R. Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness. Biochemistry 2018 57 3544 3548 6CBC 30093493 Crystal structure of an N-terminal fragment of Vps13. 2018-02-02 2018-08-08 Kumar, N.,Leonzino, M.,Hancock-Cerutti, W.,Horenkamp, F.A.,Li, P.,Lees, J.A.,Wheeler, H.,Reinisch, K.M.,De Camilli, P. VPS13A and VPS13C are lipid transport proteins differentially localized at ER contact sites. J. Cell Biol. 2018 217 3625 3639 6D95 29996105 Ternary RsAgo Complex with Guide RNA Paired and Target DNA containing A8-A8' Non-Canonical Pair 2018-04-27 2018-08-08 Liu, Y.,Esyunina, D.,Olovnikov, I.,Teplova, M.,Kulbachinskiy, A.,Aravin, A.A.,Patel, D.J. Accommodation of Helical Imperfections in Rhodobacter sphaeroides Argonaute Ternary Complexes with Guide RNA and Target DNA. Cell Rep 2018 24 453 462 6C10 30070639 Crystal structure of mouse PCDH15 EC11-EL 2018-01-03 2018-08-15 Ge, J.,Elferich, J.,Goehring, A.,Zhao, J.,Schuck, P.,Gouaux, E. Structure of mouse protocadherin 15 of the stereocilia tip link in complex with LHFPL5. Elife 2018 7 0 0 6E49 29141206 Pif1 peptide bound to PCNA trimer 2018-07-17 2018-08-22 Buzovetsky, O.,Kwon, Y.,Pham, N.T.,Kim, C.,Ira, G.,Sung, P.,Xiong, Y. Role of the Pif1-PCNA Complex in Pol delta-Dependent Strand Displacement DNA Synthesis and Break-Induced Replication. Cell Rep 2017 21 1707 1714 6BXI 29983373 X-ray crystal structure of NDR1 kinase domain 2017-12-18 2018-08-29 Xiong, S.,Lorenzen, K.,Couzens, A.L.,Templeton, C.M.,Rajendran, D.,Mao, D.Y.L.,Juang, Y.C.,Chiovitti, D.,Kurinov, I.,Guettler, S.,Gingras, A.C.,Sicheri, F. Structural Basis for Auto-Inhibition of the NDR1 Kinase Domain by an Atypically Long Activation Segment. Structure 2018 26 1101 0 6CD4 30102854 Crystal Structure of the first bromodomain of human BRD4 in complex with the inhibitor JWG046 2018-02-08 2018-08-29 Wang, J.,Erazo, T.,Ferguson, F.M.,Buckley, D.L.,Gomez, N.,Munoz-Guardiola, P.,Dieguez-Martinez, N.,Deng, X.,Hao, M.,Massefski, W.,Fedorov, O.,Offei-Addo, N.K.,Park, P.M.,Dai, L.,DiBona, A.,Becht, K.,Kim, N.D.,McKeown, M.R.,Roberts, J.M.,Zhang, J.,Sim, T.,Alessi, D.R.,Bradner, J.E.,Lizcano, J.M.,Blacklow, S.C.,Qi, J.,Xu, X.,Gray, N.S. Structural and Atropisomeric Factors Governing the Selectivity of Pyrimido-benzodiazipinones as Inhibitors of Kinases and Bromodomains. ACS Chem. Biol. 2018 13 2438 2448 6EDI 30571993 Crystal structure of Leishmania braziliensis glucokinase 2018-08-09 2018-08-29 Buechner, G.S.,Millington, M.E.,Perry, K.,D'Antonio, E.L. The crystal structure of glucokinase from Leishmania braziliensis. Mol. Biochem. Parasitol. 2019 227 47 52 6BCS 30297750 LilrB2 D1D2 domains complexed with benzamidine 2017-10-20 2018-09-05 Cao, Q.,Shin, W.S.,Chan, H.,Vuong, C.K.,Dubois, B.,Li, B.,Murray, K.A.,Sawaya, M.R.,Feigon, J.,Black, D.L.,Eisenberg, D.S.,Jiang, L. Inhibiting amyloid-beta cytotoxicity through its interaction with the cell surface receptor LilrB2 by structure-based design. Nat Chem 2018 10 1213 1221 6D0Z 30140014 Polymerase Eta cytarabine (AraC) extension ternary complex 2018-04-11 2018-09-05 Rechkoblit, O.,Choudhury, J.R.,Buku, A.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis for polymerase eta-promoted resistance to the anticancer nucleoside analog cytarabine. Sci Rep 2018 8 12702 12702 6D2Z 30215753 Structure of human Usb1 with uridine-adenosine, inactive H208Q mutant 2018-04-14 2018-09-05 Nomura, Y.,Roston, D.,Montemayor, E.J.,Cui, Q.,Butcher, S.E. Structural and mechanistic basis for preferential deadenylation of U6 snRNA by Usb1. Nucleic Acids Res. 2018 46 11488 11501 6D31 30215753 Structure of human Usb1 with adenosine 5'-monophosphate 2018-04-14 2018-09-05 Nomura, Y.,Roston, D.,Montemayor, E.J.,Cui, Q.,Butcher, S.E. Structural and mechanistic basis for preferential deadenylation of U6 snRNA by Usb1. Nucleic Acids Res. 2018 46 11488 11501 6DCF 30297823 Crystal structure of a Mycobacterium smegmatis transcription initiation complex with Rifampicin-resistant RNA polymerase and bound to kanglemycin A 2018-05-06 2018-09-05 Peek, J.,Lilic, M.,Montiel, D.,Milshteyn, A.,Woodworth, I.,Biggins, J.B.,Ternei, M.A.,Calle, P.Y.,Danziger, M.,Warrier, T.,Saito, K.,Braffman, N.,Fay, A.,Glickman, M.S.,Darst, S.A.,Campbell, E.A.,Brady, S.F. Rifamycin congeners kanglemycins are active against rifampicin-resistant bacteria via a distinct mechanism. Nat Commun 2018 9 4147 4147 6BBF 30160233 The CRAC channel Orai in an open conformation; H206A gain-of-function mutation 2017-10-18 2018-09-12 Hou, X.,Burstein, S.R.,Long, S.B. Structures reveal opening of the store-operated calcium channel Orai. Elife 2018 7 0 0 5WFV 31851823 Kelch domain of human Keap1 bound to Nrf2 ETGE peptide 2017-07-12 2018-09-19 Zhong, M.,Lynch, A.,Muellers, S.N.,Jehle, S.,Luo, L.,Hall, D.R.,Iwase, R.,Carolan, J.P.,Egbert, M.,Wakefield, A.,Streu, K.,Harvey, C.M.,Ortet, P.C.,Kozakov, D.,Vajda, S.,Allen, K.N.,Whitty, A. Interaction Energetics and Druggability of the Protein-Protein Interaction between Kelch-like ECH-Associated Protein 1 (KEAP1) and Nuclear Factor Erythroid 2 Like 2 (Nrf2). Biochemistry 2020 59 563 581 6CW2 30224453 Crystal structure of a yeast SAGA transcriptional coactivator Ada2/Gcn5 HAT subcomplex, crystal form 1 2018-03-29 2018-09-19 Sun, J.,Paduch, M.,Kim, S.A.,Kramer, R.M.,Barrios, A.F.,Lu, V.,Luke, J.,Usatyuk, S.,Kossiakoff, A.A.,Tan, S. Structural basis for activation of SAGA histone acetyltransferase Gcn5 by partner subunit Ada2. Proc. Natl. Acad. Sci. U.S.A. 2018 115 10010 10015 6CW3 30224453 Crystal structure of a yeast SAGA transcriptional coactivator Ada2/Gcn5 HAT subcomplex, crystal form 2 2018-03-29 2018-09-19 Sun, J.,Paduch, M.,Kim, S.A.,Kramer, R.M.,Barrios, A.F.,Lu, V.,Luke, J.,Usatyuk, S.,Kossiakoff, A.A.,Tan, S. Structural basis for activation of SAGA histone acetyltransferase Gcn5 by partner subunit Ada2. Proc. Natl. Acad. Sci. U.S.A. 2018 115 10010 10015 6EEI 32371491 Crystal structure of Arabidopsis thaliana phenylacetaldehyde synthase in complex with L-phenylalanine 2018-08-14 2018-09-19 Torrens-Spence, M.P.,Chiang, Y.C.,Smith, T.,Vicent, M.A.,Wang, Y.,Weng, J.K. Structural basis for divergent and convergent evolution of catalytic machineries in plant aromatic amino acid decarboxylase proteins. Proc.Natl.Acad.Sci.USA 2020 117 10806 10817 6EEQ 32371491 Crystal structure of Rhodiola rosea 4-hydroxyphenylacetaldehyde synthase 2018-08-15 2018-09-19 Torrens-Spence, M.P.,Chiang, Y.C.,Smith, T.,Vicent, M.A.,Wang, Y.,Weng, J.K. Structural basis for divergent and convergent evolution of catalytic machineries in plant aromatic amino acid decarboxylase proteins. Proc.Natl.Acad.Sci.USA 2020 117 10806 10817 6EEW 32371491 Crystal structure of Catharanthus roseus tryptophan decarboxylase in complex with L-tryptophan 2018-08-15 2018-09-19 Torrens-Spence, M.P.,Chiang, Y.C.,Smith, T.,Vicent, M.A.,Wang, Y.,Weng, J.K. Structural basis for divergent and convergent evolution of catalytic machineries in plant aromatic amino acid decarboxylase proteins. Proc.Natl.Acad.Sci.USA 2020 117 10806 10817 5VPO 30262649 The 70S P-site ASL SufA6 complex 2017-05-05 2018-09-26 Hong, S.,Sunita, S.,Maehigashi, T.,Hoffer, E.D.,Dunkle, J.A.,Dunham, C.M. Mechanism of tRNA-mediated +1 ribosomal frameshifting. Proc. Natl. Acad. Sci. U.S.A. 2018 115 11226 11231 5VPP 30262649 The 70S P-site tRNA SufA6 complex 2017-05-05 2018-09-26 Hong, S.,Sunita, S.,Maehigashi, T.,Hoffer, E.D.,Dunkle, J.A.,Dunham, C.M. Mechanism of tRNA-mediated +1 ribosomal frameshifting. Proc. Natl. Acad. Sci. U.S.A. 2018 115 11226 11231 6BG3 29547696 Structure of (3S,4S)-1-benzyl-4-(3-(3-(trifluoromethyl)phenyl)ureido)piperidin-3-yl acetate bound to DCN1 2017-10-27 2018-09-26 Hammill, J.T.,Scott, D.C.,Min, J.,Connelly, M.C.,Holbrook, G.,Zhu, F.,Matheny, A.,Yang, L.,Singh, B.,Schulman, B.A.,Guy, R.K. Piperidinyl Ureas Chemically Control Defective in Cullin Neddylation 1 (DCN1)-Mediated Cullin Neddylation. J. Med. Chem. 2018 61 2680 2693 6BG5 29547696 Structure of 1-(benzo[d][1,3]dioxol-5-ylmethyl)-1-(1-propylpiperidin-4-yl)-3-(3-(trifluoromethyl)phenyl)urea bound to DCN1 2017-10-27 2018-09-26 Hammill, J.T.,Scott, D.C.,Min, J.,Connelly, M.C.,Holbrook, G.,Zhu, F.,Matheny, A.,Yang, L.,Singh, B.,Schulman, B.A.,Guy, R.K. Piperidinyl Ureas Chemically Control Defective in Cullin Neddylation 1 (DCN1)-Mediated Cullin Neddylation. J. Med. Chem. 2018 61 2680 2693 6EEV 30199631 Structure of class II HMG-CoA reductase from Delftia acidovorans with mevalonate bound 2018-08-15 2018-09-26 Ragwan, E.R.,Arai, E.,Kung, Y. New Crystallographic Snapshots of Large Domain Movements in Bacterial 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase. Biochemistry 2018 57 5715 5725 6B6V 30277213 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase, as-isolated (protein batch 1), canonical C-cluster 2017-10-03 2018-10-03 Wittenborn, E.C.,Merrouch, M.,Ueda, C.,Fradale, L.,Leger, C.,Fourmond, V.,Pandelia, M.E.,Dementin, S.,Drennan, C.L. Redox-dependent rearrangements of the NiFeS cluster of carbon monoxide dehydrogenase. Elife 2018 7 0 0 6B6W 30277213 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase, as-isolated (protein batch 2), oxidized C-cluster 2017-10-03 2018-10-03 Wittenborn, E.C.,Merrouch, M.,Ueda, C.,Fradale, L.,Leger, C.,Fourmond, V.,Pandelia, M.E.,Dementin, S.,Drennan, C.L. Redox-dependent rearrangements of the NiFeS cluster of carbon monoxide dehydrogenase. Elife 2018 7 0 0 6B6X 30277213 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase, dithionite-reduced (protein batch 2), canonical C-cluster 2017-10-03 2018-10-03 Wittenborn, E.C.,Merrouch, M.,Ueda, C.,Fradale, L.,Leger, C.,Fourmond, V.,Pandelia, M.E.,Dementin, S.,Drennan, C.L. Redox-dependent rearrangements of the NiFeS cluster of carbon monoxide dehydrogenase. Elife 2018 7 0 0 6B6Y 30277213 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase, dithionite-reduced then oxygen-exposed (protein batch 2), oxidized C-cluster 2017-10-03 2018-10-03 Wittenborn, E.C.,Merrouch, M.,Ueda, C.,Fradale, L.,Leger, C.,Fourmond, V.,Pandelia, M.E.,Dementin, S.,Drennan, C.L. Redox-dependent rearrangements of the NiFeS cluster of carbon monoxide dehydrogenase. Elife 2018 7 0 0 6DC2 30277213 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase C301S variant 2018-05-04 2018-10-03 Wittenborn, E.C.,Merrouch, M.,Ueda, C.,Fradale, L.,Leger, C.,Fourmond, V.,Pandelia, M.E.,Dementin, S.,Drennan, C.L. Redox-dependent rearrangements of the NiFeS cluster of carbon monoxide dehydrogenase. Elife 2018 7 0 0 6DNW 30227134 Sequence Requirements of the Listeria innocua prophage attP site 2018-06-08 2018-10-03 Li, H.,Sharp, R.,Rutherford, K.,Gupta, K.,Van Duyne, G.D. Serine Integrase attP Binding and Specificity. J. Mol. Biol. 2018 430 4401 4418 6B4X Schistosoma mansoni (Blood Fluke) Sulfotransferase, F39Y Mutant 2017-09-27 2018-10-10 Rugel, A.R.,Guzman, M.A.,Taylor, A.B.,Chevalier, F.D.,Tarpley, R.S.,McHardy, S.F.,Cao, X.,Holloway, S.P.,Anderson, T.J.C.,Hart, P.J.,LoVerde, P.T. Why does oxamniquine kill Schistosoma mansoni and not S. haematobium and S. japonicum? Int.J.Parasitol. 2020 0 0 0 6B4Y Schistosoma mansoni (Blood Fluke) Sulfotransferase/Oxamniquine Complex, F39Y Mutant 2017-09-27 2018-10-10 Rugel, A.R.,Guzman, M.A.,Taylor, A.B.,Chevalier, F.D.,Tarpley, R.S.,McHardy, S.F.,Cao, X.,Holloway, S.P.,Anderson, T.J.C.,Hart, P.J.,LoVerde, P.T. Why does oxamniquine kill Schistosoma mansoni and not S. haematobium and S. japonicum? Int.J.Parasitol. 2020 0 0 0 6B51 Schistosoma haematobium (Blood Fluke) Sulfotransferase, Y54F Mutant 2017-09-27 2018-10-10 Rugel, A.R.,Guzman, M.A.,Taylor, A.B.,Chevalier, F.D.,Tarpley, R.S.,McHardy, S.F.,Cao, X.,Holloway, S.P.,Anderson, T.J.C.,Hart, P.J.,LoVerde, P.T. Why does oxamniquine kill Schistosoma mansoni and not S. haematobium and S. japonicum? Int.J.Parasitol. 2020 0 0 0 6B52 Schistosoma haematobium (Blood Fluke) Sulfotransferase/Oxamniquine Complex, Y54F Mutant 2017-09-27 2018-10-10 Rugel, A.R.,Guzman, M.A.,Taylor, A.B.,Chevalier, F.D.,Tarpley, R.S.,McHardy, S.F.,Cao, X.,Holloway, S.P.,Anderson, T.J.C.,Hart, P.J.,LoVerde, P.T. Why does oxamniquine kill Schistosoma mansoni and not S. haematobium and S. japonicum? Int.J.Parasitol. 2020 0 0 0 6CTF 30255846 Crystal structure of GltPh fast mutant - R276S/M395R 2018-03-23 2018-10-10 Oh, S.,Boudker, O. Kinetic mechanism of coupled binding in sodium-aspartate symporter GltPh. Elife 2018 7 0 0 6CZF 30559427 The structure of E. coli PurF in complex with ppGpp-Mg 2018-04-09 2018-10-10 Wang, B.,Dai, P.,Ding, D.,Del Rosario, A.,Grant, R.A.,Pentelute, B.L.,Laub, M.T. Affinity-based capture and identification of protein effectors of the growth regulator ppGpp. Nat. Chem. Biol. 2019 15 141 150 6DW3 30305425 SAMHD1 Bound to Cytarabine-TP in the Catalytic Pocket 2018-06-26 2018-10-10 Knecht, K.M.,Buzovetsky, O.,Schneider, C.,Thomas, D.,Srikanth, V.,Kaderali, L.,Tofoleanu, F.,Reiss, K.,Ferreiros, N.,Geisslinger, G.,Batista, V.S.,Ji, X.,Cinatl Jr., J.,Keppler, O.T.,Xiong, Y. The structural basis for cancer drug interactions with the catalytic and allosteric sites of SAMHD1. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6DW4 30305425 SAMHD1 Bound to Cladribine-TP in the Catalytic Pocket and Allosteric Pocket 2018-06-26 2018-10-10 Knecht, K.M.,Buzovetsky, O.,Schneider, C.,Thomas, D.,Srikanth, V.,Kaderali, L.,Tofoleanu, F.,Reiss, K.,Ferreiros, N.,Geisslinger, G.,Batista, V.S.,Ji, X.,Cinatl Jr., J.,Keppler, O.T.,Xiong, Y. The structural basis for cancer drug interactions with the catalytic and allosteric sites of SAMHD1. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6DW5 30305425 SAMHD1 Bound to Gemcitabine-TP in the Catalytic Pocket 2018-06-26 2018-10-10 Knecht, K.M.,Buzovetsky, O.,Schneider, C.,Thomas, D.,Srikanth, V.,Kaderali, L.,Tofoleanu, F.,Reiss, K.,Ferreiros, N.,Geisslinger, G.,Batista, V.S.,Ji, X.,Cinatl Jr., J.,Keppler, O.T.,Xiong, Y. The structural basis for cancer drug interactions with the catalytic and allosteric sites of SAMHD1. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6DWD 30305425 SAMHD1 Bound to Clofarabine-TP in the Catalytic Pocket and Allosteric Pocket 2018-06-26 2018-10-10 Knecht, K.M.,Buzovetsky, O.,Schneider, C.,Thomas, D.,Srikanth, V.,Kaderali, L.,Tofoleanu, F.,Reiss, K.,Ferreiros, N.,Geisslinger, G.,Batista, V.S.,Ji, X.,Cinatl Jr., J.,Keppler, O.T.,Xiong, Y. The structural basis for cancer drug interactions with the catalytic and allosteric sites of SAMHD1. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6DWK 30305425 SAMHD1 Bound to Fludarabine-TP in the Catalytic Pocket 2018-06-26 2018-10-10 Knecht, K.M.,Buzovetsky, O.,Schneider, C.,Thomas, D.,Srikanth, V.,Kaderali, L.,Tofoleanu, F.,Reiss, K.,Ferreiros, N.,Geisslinger, G.,Batista, V.S.,Ji, X.,Cinatl Jr., J.,Keppler, O.T.,Xiong, Y. The structural basis for cancer drug interactions with the catalytic and allosteric sites of SAMHD1. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6EGZ 30445810 Crystal structure of cytochrome c in complex with di-PEGylated sulfonatocalix[4]arene 2017-09-12 2018-10-10 Mummidivarapu, V.V.S.,Rennie, M.L.,Doolan, A.M.,Crowley, P.B. Noncovalent PEGylation via Sulfonatocalix[4]arene-A Crystallographic Proof. Bioconjug.Chem. 2018 29 3999 4003 6C40 30222354 CheY41PyTyrD54K from Thermotoga maritima 2018-01-11 2018-10-17 Merz, G.E.,Borbat, P.P.,Muok, A.R.,Srivastava, M.,Bunck, D.N.,Freed, J.H.,Crane, B.R. Site-Specific Incorporation of a Cu2+Spin Label into Proteins for Measuring Distances by Pulsed Dipolar Electron Spin Resonance Spectroscopy. J Phys Chem B 2018 122 9443 9451 6CI4 30346688 Crystal structure of the formyltransferase PseJ from Anoxybacillus kamchatkensis soaked with UDP-4-amino-4,6-dideoxy-L-AltNAc 2018-02-23 2018-10-17 Reimer, J.M.,Harb, I.,Ovchinnikova, O.G.,Jiang, J.,Whitfield, C.,Schmeing, T.M. Structural Insight into a Novel Formyltransferase and Evolution to a Nonribosomal Peptide Synthetase Tailoring Domain. ACS Chem. Biol. 2018 13 3161 3172 6DQ0 30279317 sfGFP D133 mutated to 4-nitro-L-phenylalanine 2018-06-10 2018-10-17 Maurici, N.,Savidge, N.,Lee, B.U.,Brewer, S.H.,Phillips-Piro, C.M. Crystal structures of green fluorescent protein with the unnatural amino acid 4-nitro-L-phenylalanine. Acta Crystallogr F Struct Biol 2018 74 650 655 6DXF 30291143 Crystal structure of chalcone synthase from Selaginella moellendorffii - hydrogen peroxide treated 2018-06-28 2018-10-17 Liou, G.,Chiang, Y.C.,Wang, Y.,Weng, J.K. Mechanistic basis for the evolution of chalcone synthase catalytic cysteine reactivity in land plants. J. Biol. Chem. 2018 293 18601 18612 6E3I 30322927 Human Bfl-1 in complex with the Bfl-1-specific designed peptide srt.F4 2018-07-14 2018-10-17 Jenson, J.M.,Xue, V.,Stretz, L.,Mandal, T.,Reich, L.L.,Keating, A.E. Peptide design by optimization on a data-parameterized protein interaction landscape. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6E3J 30322927 Human Bfl-1 in complex with the Bfl-1-specific designed peptide srt.F10 2018-07-14 2018-10-17 Jenson, J.M.,Xue, V.,Stretz, L.,Mandal, T.,Reich, L.L.,Keating, A.E. Peptide design by optimization on a data-parameterized protein interaction landscape. Proc. Natl. Acad. Sci. U.S.A. 2018 115 0 0 6EDK 30346688 Crystal structure of the formyltransferase PseJ from Anoxybacillus kamchatkensis with N10-formyltetrahydrofolate 2018-08-09 2018-10-17 Reimer, J.M.,Harb, I.,Ovchinnikova, O.G.,Jiang, J.,Whitfield, C.,Schmeing, T.M. Structural Insight into a Novel Formyltransferase and Evolution to a Nonribosomal Peptide Synthetase Tailoring Domain. ACS Chem. Biol. 2018 13 3161 3172 6MA3 30285435 Crystal structure of human O-GlcNAc transferase bound to a peptide from HCF-1 pro-repeat 2 (11-26) and inhibitor 2a 2018-08-25 2018-10-17 Martin, S.E.S.,Tan, Z.W.,Itkonen, H.M.,Duveau, D.Y.,Paulo, J.A.,Janetzko, J.,Boutz, P.L.,Tork, L.,Moss, F.A.,Thomas, C.J.,Gygi, S.P.,Lazarus, M.B.,Walker, S. Structure-Based Evolution of Low Nanomolar O-GlcNAc Transferase Inhibitors. J. Am. Chem. Soc. 2018 140 13542 13545 6MA4 30285435 Crystal structure of human O-GlcNAc transferase bound to a peptide from HCF-1 pro-repeat 2 (11-26) and inhibitor 3a 2018-08-25 2018-10-17 Martin, S.E.S.,Tan, Z.W.,Itkonen, H.M.,Duveau, D.Y.,Paulo, J.A.,Janetzko, J.,Boutz, P.L.,Tork, L.,Moss, F.A.,Thomas, C.J.,Gygi, S.P.,Lazarus, M.B.,Walker, S. Structure-Based Evolution of Low Nanomolar O-GlcNAc Transferase Inhibitors. J. Am. Chem. Soc. 2018 140 13542 13545 6MPS 29402087 TagT bound to LIIa-WTA 2018-10-08 2018-10-17 Schaefer, K.,Owens, T.W.,Kahne, D.,Walker, S. Substrate Preferences Establish the Order of Cell Wall Assembly in Staphylococcus aureus. J. Am. Chem. Soc. 2018 140 2442 2445 6MPT 29402087 TagT bound to LI-WTA 2018-10-08 2018-10-17 Schaefer, K.,Owens, T.W.,Kahne, D.,Walker, S. Substrate Preferences Establish the Order of Cell Wall Assembly in Staphylococcus aureus. J. Am. Chem. Soc. 2018 140 2442 2445 6DKQ 30301765 Crystal structure of the Shr Hemoglobin Interacting Domain 2 2018-05-30 2018-10-24 Macdonald, R.,Cascio, D.,Collazo, M.J.,Phillips, M.,Clubb, R.T. The Streptococcus pyogenes Shr protein captures human hemoglobin using two structurally unique binding domains. J.Biol.Chem. 2018 293 18365 18377 6E33 30212894 Crystal Structure of Pho7-DNA complex 2018-07-13 2018-10-24 Garg, A.,Goldgur, Y.,Schwer, B.,Shuman, S. Distinctive structural basis for DNA recognition by the fission yeast Zn2Cys6 transcription factor Pho7 and its role in phosphate homeostasis. Nucleic Acids Res. 2018 46 11262 11273 6DIX 30355736 NFVFGT segment from Human Immunoglobulin Light-Chain Variable Domain, Residues 98-103, assembled as an amyloid fibril 2018-05-23 2018-10-31 Brumshtein, B.,Esswein, S.R.,Sawaya, M.R.,Rosenberg, G.,Ly, A.T.,Landau, M.,Eisenberg, D.S. Identification of two principal amyloid-driving segments in variable domains of Ig light chains in systemic light-chain amyloidosis. J. Biol. Chem. 2018 293 19659 19671 6DIY 30355736 YTFGQ segment from Human Immunoglobulin Light-Chain Variable Domain, Residues 96-100, assembled as an amyloid fibril 2018-05-24 2018-10-31 Brumshtein, B.,Esswein, S.R.,Sawaya, M.R.,Rosenberg, G.,Ly, A.T.,Landau, M.,Eisenberg, D.S. Identification of two principal amyloid-driving segments in variable domains of Ig light chains in systemic light-chain amyloidosis. J. Biol. Chem. 2018 293 19659 19671 6EGK 30346736 T181N Cucumene Synthase 2018-08-20 2018-10-31 Blank, P.N.,Pemberton, T.A.,Chow, J.Y.,Poulter, C.D.,Christianson, D.W. Crystal Structure of Cucumene Synthase, a Terpenoid Cyclase That Generates a Linear Triquinane Sesquiterpene. Biochemistry 2018 57 6326 6335 6BHP 32168387 Crystal structure of the Chlamydomonas reinhardtii LCI1 channel 2017-10-31 2018-11-07 Kono, A.,Chou, T.H.,Radhakrishnan, A.,Bolla, J.R.,Sankar, K.,Shome, S.,Su, C.C.,Jernigan, R.L.,Robinson, C.V.,Yu, E.W.,Spalding, M.H. Structure and function of LCI1: a plasma membrane CO 2 channel in the Chlamydomonas CO 2 concentrating mechanism. Plant J. 2020 102 1107 1126 6MJC 31037469 Structure of Candida glabrata Csm1:Dsn1(43-67DD) complex 2018-09-20 2018-11-07 Plowman, R.,Singh, N.,Tromer, E.C.,Payan, A.,Duro, E.,Spanos, C.,Rappsilber, J.,Snel, B.,Kops, G.J.P.L.,Corbett, K.D.,Marston, A.L. The molecular basis of monopolin recruitment to the kinetochore. Chromosoma 2019 128 331 354 6BL3 31000626 Crystal Complex of Cyclooxygenase-2 with indomethacin-butyldiamine-dansyl conjugate 2017-11-09 2018-11-14 Xu, S.,Uddin, M.J.,Banerjee, S.,Duggan, K.,Musee, J.,Kiefer, J.R.,Ghebreselasie, K.,Rouzer, C.A.,Marnett, L.J. Fluorescent indomethacin-dansyl conjugates utilize the membrane-binding domain of cyclooxygenase-2 to block the opening to the active site. J.Biol.Chem. 2019 294 8690 8698 6BL4 31000626 Crystal Complex of Cyclooxygenase-2 with indomethacin-ethylenediamine-dansyl conjugate 2017-11-09 2018-11-14 Xu, S.,Uddin, M.J.,Banerjee, S.,Duggan, K.,Musee, J.,Kiefer, J.R.,Ghebreselasie, K.,Rouzer, C.A.,Marnett, L.J. Fluorescent indomethacin-dansyl conjugates utilize the membrane-binding domain of cyclooxygenase-2 to block the opening to the active site. J.Biol.Chem. 2019 294 8690 8698 6BUW 30476222 Thermus thermophilus 70S complex containing 16S G299A ram mutation and empty A site. 2017-12-11 2018-11-14 Hoffer, E.D.,Maehigashi, T.,Fredrick, K.,Dunham, C.M. Ribosomal ambiguity (ram) mutations promote the open (off) to closed (on) transition and thereby increase miscoding. Nucleic Acids Res. 2019 47 1557 1563 6BZ6 30476222 Thermus thermophilus 70S complex containing 16S G347U ram mutation and empty A site 2017-12-22 2018-11-14 Hoffer, E.D.,Maehigashi, T.,Fredrick, K.,Dunham, C.M. Ribosomal ambiguity (ram) mutations promote the open (off) to closed (on) transition and thereby increase miscoding. Nucleic Acids Res. 2019 47 1557 1563 6BZ7 30476222 Thermus thermophilus 70S containing 16S G299A point mutation and near-cognate ASL Leucine in A site. 2017-12-22 2018-11-14 Hoffer, E.D.,Maehigashi, T.,Fredrick, K.,Dunham, C.M. Ribosomal ambiguity (ram) mutations promote the open (off) to closed (on) transition and thereby increase miscoding. Nucleic Acids Res. 2019 47 1557 1563 6BZ8 30476222 Thermus thermophilus 70S containing 16S G347U point mutation and near-cognate ASL Leucine in A site 2017-12-22 2018-11-14 Hoffer, E.D.,Maehigashi, T.,Fredrick, K.,Dunham, C.M. Ribosomal ambiguity (ram) mutations promote the open (off) to closed (on) transition and thereby increase miscoding. Nucleic Acids Res. 2019 47 1557 1563 6DB8 30382099 Structural basis for promiscuous binding and activation of fluorogenic dyes by DIR2s RNA aptamer 2018-05-02 2018-11-14 Shelke, S.A.,Shao, Y.,Laski, A.,Koirala, D.,Weissman, B.P.,Fuller, J.R.,Tan, X.,Constantin, T.P.,Waggoner, A.S.,Bruchez, M.P.,Armitage, B.A.,Piccirilli, J.A. Structural basis for activation of fluorogenic dyes by an RNA aptamer lacking a G-quadruplex motif. Nat Commun 2018 9 4542 4542 6DB9 30382099 Structural basis for promiscuous binding and activation of fluorogenic dyes by DIR2s RNA aptamer 2018-05-02 2018-11-14 Shelke, S.A.,Shao, Y.,Laski, A.,Koirala, D.,Weissman, B.P.,Fuller, J.R.,Tan, X.,Constantin, T.P.,Waggoner, A.S.,Bruchez, M.P.,Armitage, B.A.,Piccirilli, J.A. Structural basis for activation of fluorogenic dyes by an RNA aptamer lacking a G-quadruplex motif. Nat Commun 2018 9 4542 4542 6DLR 30120360 PRPP Riboswitch bound to PRPP, iridium-hexamine soaked structure 2018-06-02 2018-11-14 Peselis, A.,Serganov, A. ykkC riboswitches employ an add-on helix to adjust specificity for polyanionic ligands. Nat. Chem. Biol. 2018 14 887 894 6E40 30387777 Crystal structure of the indoleamine 2,3-dioxygenase 1 (IDO1) in complexed with ferric heme and Epacadostat 2018-07-16 2018-11-14 Luo, S.,Xu, K.,Xiang, S.,Chen, J.,Chen, C.,Guo, C.,Tong, Y.,Tong, L. High-resolution structures of inhibitor complexes of human indoleamine 2,3-dioxygenase 1 in a new crystal form. Acta Crystallogr F Struct Biol 2018 74 717 724 6E42 30387777 CRYSTAL STRUCTURE OF HUMAN INDOLEAMINE 2,3-DIOXYGENASE 1 (IDO1) in complex with ferric heme and 4-Chlorophenyl imidazole 2018-07-16 2018-11-14 Luo, S.,Xu, K.,Xiang, S.,Chen, J.,Chen, C.,Guo, C.,Tong, Y.,Tong, L. High-resolution structures of inhibitor complexes of human indoleamine 2,3-dioxygenase 1 in a new crystal form. Acta Crystallogr F Struct Biol 2018 74 717 724 6E43 30387777 Crystal structure of human indoleamine 2,3-dioxygenase 1 (IDO1) in complex with a BMS-978587 analog 2018-07-16 2018-11-14 Luo, S.,Xu, K.,Xiang, S.,Chen, J.,Chen, C.,Guo, C.,Tong, Y.,Tong, L. High-resolution structures of inhibitor complexes of human indoleamine 2,3-dioxygenase 1 in a new crystal form. Acta Crystallogr F Struct Biol 2018 74 717 724 6E44 30387777 CRYSTAL STRUCTURE OF HUMAN INDOLEAMINE 2,3-DIOXYGENASE 1 (IDO1) free enzyme in the ferric state 2018-07-16 2018-11-14 Luo, S.,Xu, K.,Xiang, S.,Chen, J.,Chen, C.,Guo, C.,Tong, Y.,Tong, L. High-resolution structures of inhibitor complexes of human indoleamine 2,3-dioxygenase 1 in a new crystal form. Acta Crystallogr F Struct Biol 2018 74 717 724 6CHR 30410046 Crystal structure of a group II intron lariat with an intact 3' splice site (pre-2s state) 2018-02-22 2018-11-21 Chan, R.T.,Peters, J.K.,Robart, A.R.,Wiryaman, T.,Rajashankar, K.R.,Toor, N. Structural basis for the second step of group II intron splicing. Nat Commun 2018 9 4676 4676 6CIH 30410046 Crystal structure of a group II intron lariat in the post-catalytic state 2018-02-23 2018-11-21 Chan, R.T.,Peters, J.K.,Robart, A.R.,Wiryaman, T.,Rajashankar, K.R.,Toor, N. Structural basis for the second step of group II intron splicing. Nat Commun 2018 9 4676 4676 6BXZ 30527337 Crystal Structure of Pig Protocadherin-15 EC10-MAD12 2017-12-19 2018-11-28 De-la-Torre, P.,Choudhary, D.,Araya-Secchi, R.,Narui, Y.,Sotomayor, M. A Mechanically Weak Extracellular Membrane-Adjacent Domain Induces Dimerization of Protocadherin-15. Biophys. J. 2018 115 2368 2385 6EFZ 30467080 Crystal Structure of DIP-Theta Ig1-3 2018-08-17 2018-11-28 Cosmanescu, F.,Katsamba, P.S.,Sergeeva, A.P.,Ahlsen, G.,Patel, S.D.,Brewer, J.J.,Tan, L.,Xu, S.,Xiao, Q.,Nagarkar-Jaiswal, S.,Nern, A.,Bellen, H.J.,Zipursky, S.L.,Honig, B.,Shapiro, L. Neuron-Subtype-Specific Expression, Interaction Affinities, and Specificity Determinants of DIP/Dpr Cell Recognition Proteins. Neuron 2018 100 1385 0 6EG1 30467080 Crystal structure of Dpr2 Ig1-Ig2 in complex with DIP-Theta Ig1-Ig3 2018-08-17 2018-11-28 Cosmanescu, F.,Katsamba, P.S.,Sergeeva, A.P.,Ahlsen, G.,Patel, S.D.,Brewer, J.J.,Tan, L.,Xu, S.,Xiao, Q.,Nagarkar-Jaiswal, S.,Nern, A.,Bellen, H.J.,Zipursky, S.L.,Honig, B.,Shapiro, L. Neuron-Subtype-Specific Expression, Interaction Affinities, and Specificity Determinants of DIP/Dpr Cell Recognition Proteins. Neuron 2018 100 1385 0 6MZE 30422110 Structural Basis of Tubulin Recruitment and Assembly by Microtubule Polymerases with Tumor Overexpressed Gene (TOG) Domain Arrays 2018-11-05 2018-11-28 Nithianantham, S.,Cook, B.D.,Beans, M.,Guo, F.,Chang, F.,Al-Bassam, J. Structural basis of tubulin recruitment and assembly by microtubule polymerases with Tumor Overexpressed Gene (TOG) domain arrays. Elife 2018 7 0 0 6MZF 30422110 Structural Basis of Tubulin Recruitment and Assembly by Microtubule Polymerases with Tumor Overexpressed Gene (TOG) Domain Arrays 2018-11-05 2018-11-28 Nithianantham, S.,Cook, B.D.,Beans, M.,Guo, F.,Chang, F.,Al-Bassam, J. Structural basis of tubulin recruitment and assembly by microtubule polymerases with Tumor Overexpressed Gene (TOG) domain arrays. Elife 2018 7 0 0 6MZG 30422110 Structural Basis of Tubulin Recruitment and Assembly by Microtubule Polymerases with Tumor Overexpressed Gene (TOG) Domain Arrays 2018-11-05 2018-11-28 Nithianantham, S.,Cook, B.D.,Beans, M.,Guo, F.,Chang, F.,Al-Bassam, J. Structural basis of tubulin recruitment and assembly by microtubule polymerases with Tumor Overexpressed Gene (TOG) domain arrays. Elife 2018 7 0 0 6BTH 32195347 Crystal structure of human cellular retinol binding protein 2 (CRBP2) in complex with 2-arachidonoylglycerol (2-AG) 2017-12-06 2018-12-12 Lee, S.A.,Yang, K.J.Z.,Brun, P.J.,Silvaroli, J.A.,Yuen, J.J.,Shmarakov, I.,Jiang, H.,Feranil, J.B.,Li, X.,Lackey, A.I.,Krezel, W.,Leibel, R.L.,Libien, J.,Storch, J.,Golczak, M.,Blaner, W.S. Retinol-binding protein 2 (RBP2) binds monoacylglycerols and modulates gut endocrine signaling and body weight. Sci Adv 2020 6 0 0 6EBN 30484626 Crystal structure of Psilocybe cubensis noncanonical aromatic amino acid decarboxylase 2018-08-06 2018-12-12 Torrens-Spence, M.P.,Liu, C.T.,Pluskal, T.,Chung, Y.K.,Weng, J.K. Monoamine Biosynthesis via a Noncanonical Calcium-Activatable Aromatic Amino Acid Decarboxylase in Psilocybin Mushroom. ACS Chem. Biol. 2018 13 3343 3353 6ECD 30542153 Vlm2 thioesterase domain with genetically encoded 2,3-diaminopropionic acid bound with a tetradepsipeptide 2018-08-07 2018-12-12 Huguenin-Dezot, N.,Alonzo, D.A.,Heberlig, G.W.,Mahesh, M.,Nguyen, D.P.,Dornan, M.H.,Boddy, C.N.,Schmeing, T.M.,Chin, J.W. Trapping biosynthetic acyl-enzyme intermediates with encoded 2,3-diaminopropionic acid. Nature 2019 565 112 117 6N9E 30520988 Crystal structure of the Thermus thermophilus 70S ribosome in complex with a short substrate mimic CC-Pmn and bound to mRNA and P-site tRNA at 3.7A resolution 2018-12-03 2018-12-12 Melnikov, S.V.,Khabibullina, N.F.,Mairhofer, E.,Vargas-Rodriguez, O.,Reynolds, N.M.,Micura, R.,Soll, D.,Polikanov, Y.S. Mechanistic insights into the slow peptide bond formation with D-amino acids in the ribosomal active site. Nucleic Acids Res. 2019 47 2089 2100 6N9E 30520988 Crystal structure of the Thermus thermophilus 70S ribosome in complex with a short substrate mimic CC-Pmn and bound to mRNA and P-site tRNA at 3.7A resolution 2018-12-03 2018-12-12 Melnikov, S.V.,Khabibullina, N.F.,Mairhofer, E.,Vargas-Rodriguez, O.,Reynolds, N.M.,Micura, R.,Soll, D.,Polikanov, Y.S. Mechanistic insights into the slow peptide bond formation with D-amino acids in the ribosomal active site. Nucleic Acids Res. 2019 47 2089 2100 6N9F 30520988 Crystal structure of the Thermus thermophilus 70S ribosome in complex with a short substrate mimic ACCA-DPhe and bound to mRNA and P-site tRNA at 3.7A resolution 2018-12-03 2018-12-12 Melnikov, S.V.,Khabibullina, N.F.,Mairhofer, E.,Vargas-Rodriguez, O.,Reynolds, N.M.,Micura, R.,Soll, D.,Polikanov, Y.S. Mechanistic insights into the slow peptide bond formation with D-amino acids in the ribosomal active site. Nucleic Acids Res. 2019 47 2089 2100 6N9F 30520988 Crystal structure of the Thermus thermophilus 70S ribosome in complex with a short substrate mimic ACCA-DPhe and bound to mRNA and P-site tRNA at 3.7A resolution 2018-12-03 2018-12-12 Melnikov, S.V.,Khabibullina, N.F.,Mairhofer, E.,Vargas-Rodriguez, O.,Reynolds, N.M.,Micura, R.,Soll, D.,Polikanov, Y.S. Mechanistic insights into the slow peptide bond formation with D-amino acids in the ribosomal active site. Nucleic Acids Res. 2019 47 2089 2100 6DCB 30559425 Structure of methylphosphate capping enzyme methyltransferase domain in complex with 5' end of 7SK RNA 2018-05-04 2018-12-19 Yang, Y.,Eichhorn, C.D.,Wang, Y.,Cascio, D.,Feigon, J. Structural basis of 7SK RNA 5'-gamma-phosphate methylation and retention by MePCE. Nat. Chem. Biol. 2019 15 132 140 6DCC 30559425 Structure of methylphosphate capping enzyme methyltransferase domain in complex with 5' end of 7SK RNA 2018-05-04 2018-12-19 Yang, Y.,Eichhorn, C.D.,Wang, Y.,Cascio, D.,Feigon, J. Structural basis of 7SK RNA 5'-gamma-phosphate methylation and retention by MePCE. Nat. Chem. Biol. 2019 15 132 140 6E8C 30540931 Crystal structure of the double homeodomain of DUX4 in complex with DNA 2018-07-27 2018-12-26 Lee, J.K.,Bosnakovski, D.,Toso, E.A.,Dinh, T.,Banerjee, S.,Bohl, T.E.,Shi, K.,Orellana, K.,Kyba, M.,Aihara, H. Crystal Structure of the Double Homeodomain of DUX4 in Complex with DNA. Cell Rep 2018 25 2955 0 6MVS 30529746 Structure of a bacterial ALDH16 complexed with NAD 2018-10-28 2018-12-26 Liu, L.K.,Tanner, J.J. Crystal Structure of Aldehyde Dehydrogenase 16 Reveals Trans-Hierarchical Structural Similarity and a New Dimer. J. Mol. Biol. 2019 431 524 541 6MVU 30529746 Structure of a bacterial ALDH16 active site mutant C295A complexed with p-nitrophenylacetate 2018-10-28 2018-12-26 Liu, L.K.,Tanner, J.J. Crystal Structure of Aldehyde Dehydrogenase 16 Reveals Trans-Hierarchical Structural Similarity and a New Dimer. J. Mol. Biol. 2019 431 524 541 6MS4 30584092 Crystal structure of the DENR-MCT-1 complex 2018-10-16 2019-01-02 Lomakin, I.B.,Dmitriev, S.E.,Steitz, T.A. Crystal structure of the DENR-MCT-1 complex revealed zinc-binding site essential for heterodimer formation. Proc. Natl. Acad. Sci. U.S.A. 2019 116 528 533 6DLP 30635421 Crystal structure of LRRK2 WD40 domain dimer 2018-06-02 2019-01-09 Zhang, P.,Fan, Y.,Ru, H.,Wang, L.,Magupalli, V.G.,Taylor, S.S.,Alessi, D.R.,Wu, H. Crystal structure of the WD40 domain dimer of LRRK2. Proc. Natl. Acad. Sci. U.S.A. 2019 116 1579 1584 6MUA 30503773 Crystal structure of Csm1-Csm4 subcomplex in the type III-A CRISPR-Csm interference complex 2018-10-22 2019-01-09 Jia, N.,Mo, C.Y.,Wang, C.,Eng, E.T.,Marraffini, L.A.,Patel, D.J. Type III-A CRISPR-Cas Csm Complexes: Assembly, Periodic RNA Cleavage, DNase Activity Regulation, and Autoimmunity. Mol. Cell 2019 73 264 0 6N0V 30590734 tRNA ligase 2018-11-07 2019-01-09 Banerjee, A.,Ghosh, S.,Goldgur, Y.,Shuman, S. Structure and two-metal mechanism of fungal tRNA ligase. Nucleic Acids Res. 2019 47 1428 1439 6N60 30626643 Escherichia coli RNA polymerase sigma70-holoenzyme bound to upstream fork promoter DNA and Microcin J25 (MccJ25) 2018-11-23 2019-01-09 Braffman, N.R.,Piscotta, F.J.,Hauver, J.,Campbell, E.A.,Link, A.J.,Darst, S.A. Structural mechanism of transcription inhibition by lasso peptides microcin J25 and capistruin. Proc. Natl. Acad. Sci. U.S.A. 2019 116 1273 1278 6N62 30626643 Escherichia coli RNA polymerase sigma70-holoenzyme bound to upstream fork promoter DNA 2018-11-24 2019-01-09 Braffman, N.R.,Piscotta, F.J.,Hauver, J.,Campbell, E.A.,Link, A.J.,Darst, S.A. Structural mechanism of transcription inhibition by lasso peptides microcin J25 and capistruin. Proc. Natl. Acad. Sci. U.S.A. 2019 116 1273 1278 5WB4 31002736 Crystal structure of the TarA wall teichoic acid glycosyltransferase 2017-06-27 2019-01-16 Kattke, M.D.,Gosschalk, J.E.,Martinez, O.E.,Kumar, G.,Gale, R.T.,Cascio, D.,Sawaya, M.R.,Philips, M.,Brown, E.D.,Clubb, R.T. Structure and mechanism of TagA, a novel membrane-associated glycosyltransferase that produces wall teichoic acids in pathogenic bacteria. Plos Pathog. 2019 15 0 0 5WFG 31002736 Crystal structure of the TarA wall teichoic acid glycosyltransferase bound to UDP 2017-07-11 2019-01-16 Kattke, M.D.,Gosschalk, J.E.,Martinez, O.E.,Kumar, G.,Gale, R.T.,Cascio, D.,Sawaya, M.R.,Philips, M.,Brown, E.D.,Clubb, R.T. Structure and mechanism of TagA, a novel membrane-associated glycosyltransferase that produces wall teichoic acids in pathogenic bacteria. Plos Pathog. 2019 15 0 0 6NCG Crystal Structure of Human Vaccinia-related kinase 2 (VRK-2) bound to pyridin-benzenesulfonamide inhibitor 2018-12-11 2019-01-16 dos Reis, C.V.,Chiodi, C.G.,de Souza, G.P.,Azevedo, H.,Guimaraes, C.,Mascarello, A.,Gama, F.,Ferreira, M.,Counago, R.M.,Massirer, K.B.,Arruda, P.,Elkins, J.M.,Edwards, A.M.,Structural Genomics Consortium (SGC) Crystal Structure of Human Vaccinia-related kinase 2 (VRK-2) bound to pyridin-benzenesulfonamide inhibitor To Be Published 0 0 0 0 6ND3 30557011 wild-type choline TMA lyase in complex with betaine aldehyde 2018-12-13 2019-01-16 Orman, M.,Bodea, S.,Funk, M.A.,Campo, A.M.,Bollenbach, M.,Drennan, C.L.,Balskus, E.P. Structure-Guided Identification of a Small Molecule That Inhibits Anaerobic Choline Metabolism by Human Gut Bacteria. J.Am.Chem.Soc. 2019 141 33 37 6NHL 30341796 Crystal structure of QueE from Escherichia coli 2018-12-23 2019-01-16 Grell, T.A.J.,Bell, B.N.,Nguyen, C.,Dowling, D.P.,Bruender, N.A.,Bandarian, V.,Drennan, C.L. Crystal structure of AdoMet radical enzyme 7-carboxy-7-deazaguanine synthase from Escherichia coli suggests how modifications near [4Fe-4S] cluster engender flavodoxin specificity. Protein Sci. 2019 28 202 215 6ASV 30646888 E. coli PRPP Synthetase 2017-08-25 2019-01-23 Zhou, W.,Tsai, A.,Dattmore, D.A.,Stives, D.P.,Chitrakar, I.,D'alessandro, A.M.,Patil, S.,Hicks, K.A.,French, J.B. Crystal structure of E. coli PRPP synthetase. BMC Struct. Biol. 2019 19 1 1 6CRN 30713027 Structure of the USP15 deubiquitinase domain in complex with a high-affinity first-generation Ubv 2018-03-19 2019-01-23 Teyra, J.,Singer, A.U.,Schmitges, F.W.,Jaynes, P.,Kit Leng Lui, S.,Polyak, M.J.,Fodil, N.,Krieger, J.R.,Tong, J.,Schwerdtfeger, C.,Brasher, B.B.,Ceccarelli, D.F.J.,Moffat, J.,Sicheri, F.,Moran, M.F.,Gros, P.,Eichhorn, P.J.A.,Lenter, M.,Boehmelt, G.,Sidhu, S.S. Structural and Functional Characterization of Ubiquitin Variant Inhibitors of USP15. Structure 2019 27 590 0 6D7G 30552102 Structure of 5F3 TCR in complex with HLA-A2/MART-1 2018-04-24 2019-01-23 Benveniste, P.M.,Roy, S.,Nakatsugawa, M.,Chen, E.L.Y.,Nguyen, L.,Millar, D.G.,Ohashi, P.S.,Hirano, N.,Adams, E.J.,Zuniga-Pflucker, J.C. Generation and molecular recognition of melanoma-associated antigen-specific human gamma delta T cells. Sci Immunol 2018 3 0 0 6NDJ 30674671 Crystal structure of human NLRP6 PYD domain with MBP fusion 2018-12-13 2019-01-23 Shen, C.,Lu, A.,Xie, W.J.,Ruan, J.,Negro, R.,Egelman, E.H.,Fu, T.M.,Wu, H. Molecular mechanism for NLRP6 inflammasome assembly and activation. Proc. Natl. Acad. Sci. U.S.A. 2019 116 2052 2057 6NL6 30938154 Crystal structure of mutant B1 immunoglobulin-binding domain of Streptococcal Protein G (T16F, T18A, V21E, T25L, K28Y, V29I, K31R, Q32H, Y33L, N35K, D36H, N37Q) 2019-01-08 2019-01-23 Maniaci, B.,Lipper, C.H.,Anipindi, D.L.,Erlandsen, H.,Cole, J.L.,Stec, B.,Huxford, T.,Love, J.J. Design of High-Affinity Metal-Controlled Protein Dimers. Biochemistry 2019 58 2199 2207 5ZS3 30632633 Small heat shock protein from M. marinum:Form-1 2018-04-27 2019-01-30 Bhandari, S.,Biswas, S.,Chaudhary, A.,Dutta, S.,Suguna, K. Dodecameric structure of a small heat shock protein from Mycobacterium marinum M. Proteins 2019 87 365 379 5ZUL 30632633 Small heat shock protein from Mycobacterium marinum M : Form-3 2018-05-08 2019-01-30 Bhandari, S.,Biswas, S.,Chaudhary, A.,Dutta, S.,Suguna, K. Dodecameric structure of a small heat shock protein from Mycobacterium marinum M. Proteins 2019 87 365 379 6CSE 30659158 Crystal structure of sodium/alanine symporter AgcS with L-alanine bound 2018-03-20 2019-01-30 Ma, J.,Lei, H.T.,Reyes, F.E.,Sanchez-Martinez, S.,Sarhan, M.F.,Hattne, J.,Gonen, T. Structural basis for substrate binding and specificity of a sodium-alanine symporter AgcS. Proc. Natl. Acad. Sci. U.S.A. 2019 116 2086 2090 6CSF 30659158 Crystal structure of sodium/alanine symporter AgcS with D-alanine bound 2018-03-20 2019-01-30 Ma, J.,Lei, H.T.,Reyes, F.E.,Sanchez-Martinez, S.,Sarhan, M.F.,Hattne, J.,Gonen, T. Structural basis for substrate binding and specificity of a sodium-alanine symporter AgcS. Proc. Natl. Acad. Sci. U.S.A. 2019 116 2086 2090 6MSN 30645090 Crystal structure of cytosolic fumarate hydratase from Leishmania major in a complex with inhibitor thiomalate 2018-10-17 2019-01-30 Feliciano, P.R.,Drennan, C.L.,Nonato, M.C. Crystal Structures of Fumarate Hydratases from Leishmania major in a Complex with Inhibitor 2-Thiomalate. ACS Chem. Biol. 2019 14 266 275 6MSN 30645090 Crystal structure of cytosolic fumarate hydratase from Leishmania major in a complex with inhibitor thiomalate 2018-10-17 2019-01-30 Feliciano, P.R.,Drennan, C.L.,Nonato, M.C. Crystal Structures of Fumarate Hydratases from Leishmania major in a Complex with Inhibitor 2-Thiomalate. ACS Chem. Biol. 2019 14 266 275 6MSO 30645090 Crystal structure of mitochondrial fumarate hydratase from Leishmania major in a complex with inhibitor thiomalate 2018-10-17 2019-01-30 Feliciano, P.R.,Drennan, C.L.,Nonato, M.C. Crystal Structures of Fumarate Hydratases from Leishmania major in a Complex with Inhibitor 2-Thiomalate. ACS Chem. Biol. 2019 14 266 275 6MSO 30645090 Crystal structure of mitochondrial fumarate hydratase from Leishmania major in a complex with inhibitor thiomalate 2018-10-17 2019-01-30 Feliciano, P.R.,Drennan, C.L.,Nonato, M.C. Crystal Structures of Fumarate Hydratases from Leishmania major in a Complex with Inhibitor 2-Thiomalate. ACS Chem. Biol. 2019 14 266 275 6CAN 30786206 Prolyl oligopeptidase mutant S477C from Pyrococcus furiosus 2018-01-31 2019-02-06 Ellis-Guardiola, K.,Rui, H.,Beckner, R.L.,Srivastava, P.,Sukumar, N.,Roux, B.,Lewis, J.C. Crystal Structure and Conformational Dynamics of Pyrococcus furiosus Prolyl Oligopeptidase. Biochemistry 2019 58 1616 1626 6CBV 32221310 Crystal structure of BRIL bound to an affinity matured synthetic antibody. 2018-02-05 2019-02-06 Mukherjee, S.,Erramilli, S.K.,Ammirati, M.,Alvarez, F.J.D.,Fennell, K.F.,Purdy, M.D.,Skrobek, B.M.,Radziwon, K.,Coukos, J.,Kang, Y.,Dutka, P.,Gao, X.,Qiu, X.,Yeager, M.,Eric Xu, H.,Han, S.,Kossiakoff, A.A. Synthetic antibodies against BRIL as universal fiducial marks for single-particle cryoEM structure determination of membrane proteins. Nat Commun 2020 11 1598 1598 6EA6 30728498 Structure of VACV poxin 2'3' cGAMP-specific nuclease 2018-08-02 2019-02-06 Eaglesham, J.B.,Pan, Y.,Kupper, T.S.,Kranzusch, P.J. Viral and metazoan poxins are cGAMP-specific nucleases that restrict cGAS-STING signalling. Nature 2019 566 259 263 6N40 Crystal structure of MmpL3 from Mycobacterium smegmatis 2018-11-16 2019-02-06 Su, C.-C.,Yu, E.W. Crystal structure of MmpL3 from Mycobacterium smegmatis To be published 0 0 0 0 6C3I 30714568 Crystal structure of the Deinococcus radiodurans Nramp/MntH divalent transition metal transporter G45R mutant in an inward occluded state 2018-01-09 2019-02-13 Bozzi, A.T.,Zimanyi, C.M.,Nicoludis, J.M.,Lee, B.K.,Zhang, C.H.,Gaudet, R. Structures in multiple conformations reveal distinct transition metal and proton pathways in an Nramp transporter. Elife 2019 8 0 0 6D91 30714568 Crystal structure of the Deinococcus radiodurans Nramp/MntH divalent transition metal transporter in the outward-open, apo conformation 2018-04-27 2019-02-13 Bozzi, A.T.,Zimanyi, C.M.,Nicoludis, J.M.,Lee, B.K.,Zhang, C.H.,Gaudet, R. Structures in multiple conformations reveal distinct transition metal and proton pathways in an Nramp transporter. Elife 2019 8 0 0 6D9W 30714568 Crystal structure of Deinococcus radiodurans MntH, an Nramp-family transition metal transporter, in the inward-open apo state 2018-04-30 2019-02-13 Bozzi, A.T.,Zimanyi, C.M.,Nicoludis, J.M.,Lee, B.K.,Zhang, C.H.,Gaudet, R. Structures in multiple conformations reveal distinct transition metal and proton pathways in an Nramp transporter. Elife 2019 8 0 0 6D9W 30714568 Crystal structure of Deinococcus radiodurans MntH, an Nramp-family transition metal transporter, in the inward-open apo state 2018-04-30 2019-02-13 Bozzi, A.T.,Zimanyi, C.M.,Nicoludis, J.M.,Lee, B.K.,Zhang, C.H.,Gaudet, R. Structures in multiple conformations reveal distinct transition metal and proton pathways in an Nramp transporter. Elife 2019 8 0 0 6E5L 30721022 Crystal structure of human cellular retinol binding protein 1 in complex with abnormal-cannabidiol (abn-CBD) 2018-07-20 2019-02-13 Silvaroli, J.A.,Widjaja-Adhi, M.A.K.,Trischman, T.,Chelstowska, S.,Horwitz, S.,Banerjee, S.,Kiser, P.D.,Blaner, W.S.,Golczak, M. Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1. Acs Chem.Biol. 2019 14 434 448 6E5W 30721022 Crystal structure of human cellular retinol binding protein 3 in complex with abnormal-cannabidiol (abn-CBD) 2018-07-23 2019-02-13 Silvaroli, J.A.,Widjaja-Adhi, M.A.K.,Trischman, T.,Chelstowska, S.,Horwitz, S.,Banerjee, S.,Kiser, P.D.,Blaner, W.S.,Golczak, M. Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1. Acs Chem.Biol. 2019 14 434 448 6E6M 30721022 Crystal structure of human cellular retinol-binding protein 1 in complex with cannabidiorcin (CBDO) 2018-07-25 2019-02-13 Silvaroli, J.A.,Widjaja-Adhi, M.A.K.,Trischman, T.,Chelstowska, S.,Horwitz, S.,Banerjee, S.,Kiser, P.D.,Blaner, W.S.,Golczak, M. Abnormal Cannabidiol Modulates Vitamin A Metabolism by Acting as a Competitive Inhibitor of CRBP1. Acs Chem.Biol. 2019 14 434 448 6EAZ 30755530 Apo structure of the mitochondrial calcium uniporter protein MICU2 2018-08-03 2019-02-13 Kamer, K.J.,Jiang, W.,Kaushik, V.K.,Mootha, V.K.,Grabarek, Z. Crystal structure of MICU2 and comparison with MICU1 reveal insights into the uniporter gating mechanism. Proc. Natl. Acad. Sci. U.S.A. 2019 116 3546 3555 6EGF 30679311 Crystal structure of the inactive unphosphorylated IRAK4 kinase domain bound to AMP-PNP 2018-08-19 2019-02-13 Wang, L.,Ferrao, R.,Li, Q.,Hatcher, J.M.,Choi, H.G.,Buhrlage, S.J.,Gray, N.S.,Wu, H. Conformational flexibility and inhibitor binding to unphosphorylated interleukin-1 receptor-associated kinase 4 (IRAK4). J.Biol.Chem. 2019 294 4511 4519 6NHX 30718283 mycobacterial DNA ligase D complexed with ATP and MES 2018-12-24 2019-02-13 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Structures of ATP-bound DNA ligase D in a closed domain conformation reveal a network of amino acid and metal contacts to the ATP phosphates. J. Biol. Chem. 2019 294 5094 5104 6E0L 30787435 Structure of Rhodothermus marinus CdnE c-UMP-AMP synthase with Apcpp and Upnpp 2018-07-06 2019-02-20 Whiteley, A.T.,Eaglesham, J.B.,de Oliveira Mann, C.C.,Morehouse, B.R.,Lowey, B.,Nieminen, E.A.,Danilchanka, O.,King, D.S.,Lee, A.S.Y.,Mekalanos, J.J.,Kranzusch, P.J. Bacterial cGAS-like enzymes synthesize diverse nucleotide signals. Nature 2019 567 194 199 6E0M 30787435 Structure of Elizabethkingia meningoseptica CdnE cyclic dinucleotide synthase 2018-07-06 2019-02-20 Whiteley, A.T.,Eaglesham, J.B.,de Oliveira Mann, C.C.,Morehouse, B.R.,Lowey, B.,Nieminen, E.A.,Danilchanka, O.,King, D.S.,Lee, A.S.Y.,Mekalanos, J.J.,Kranzusch, P.J. Bacterial cGAS-like enzymes synthesize diverse nucleotide signals. Nature 2019 567 194 199 6EGA 30679311 IRAK4 in complex with a type II inhibitor 2018-08-19 2019-02-20 Wang, L.,Ferrao, R.,Li, Q.,Hatcher, J.M.,Choi, H.G.,Buhrlage, S.J.,Gray, N.S.,Wu, H. Conformational flexibility and inhibitor binding to unphosphorylated interleukin-1 receptor-associated kinase 4 (IRAK4). J.Biol.Chem. 2019 294 4511 4519 6M7K 30787435 Structure of mouse RECON (AKR1C13) in complex with cyclic AMP-AMP-GMP (cAAG) 2018-08-20 2019-02-20 Whiteley, A.T.,Eaglesham, J.B.,de Oliveira Mann, C.C.,Morehouse, B.R.,Lowey, B.,Nieminen, E.A.,Danilchanka, O.,King, D.S.,Lee, A.S.Y.,Mekalanos, J.J.,Kranzusch, P.J. Bacterial cGAS-like enzymes synthesize diverse nucleotide signals. Nature 2019 567 194 199 6ND6 30733327 Crystal structure of the Thermus thermophilus 70S ribosome in complex with erythromycin and bound to mRNA and A-, P-, and E-site tRNAs at 2.85A resolution 2018-12-13 2019-02-20 Svetlov, M.S.,Plessa, E.,Chen, C.W.,Bougas, A.,Krokidis, M.G.,Dinos, G.P.,Polikanov, Y.S. High-resolution crystal structures of ribosome-bound chloramphenicol and erythromycin provide the ultimate basis for their competition. RNA 2019 25 600 606 6CF1 30793388 Proteus vulgaris HigA antitoxin structure 2018-02-13 2019-02-27 Schureck, M.A.,Meisner, J.,Hoffer, E.D.,Wang, D.,Onuoha, N.,Ei Cho, S.,Lollar 3rd, P.,Dunham, C.M. Structural basis of transcriptional regulation by the HigA antitoxin. Mol.Microbiol. 2019 111 1449 1462 6NCE 30826165 Crystal structure of the human FOXN3 DNA binding domain in complex with a forkhead DNA sequence 2018-12-11 2019-02-27 Rogers, J.M.,Waters, C.T.,Seegar, T.C.M.,Jarrett, S.M.,Hallworth, A.N.,Blacklow, S.C.,Bulyk, M.L. Bispecific Forkhead Transcription Factor FoxN3 Recognizes Two Distinct Motifs with Different DNA Shapes. Mol. Cell 2019 74 245 0 6CKJ 31583886 N. meningitidis CMP-sialic acid synthetase, ligand-free 2018-02-28 2019-03-06 Matthews, M.M.,McArthur, J.B.,Li, Y.,Yu, H.,Chen, X.,Fisher, A.J. Catalytic Cycle ofNeisseria meningitidisCMP-Sialic Acid Synthetase Illustrated by High-Resolution Protein Crystallography. Biochemistry 2019 0 0 0 6MBB 30773399 Human Bfl-1 in complex with the designed peptide dF1 2018-08-29 2019-03-06 Frappier, V.,Jenson, J.M.,Zhou, J.,Grigoryan, G.,Keating, A.E. Tertiary Structural Motif Sequence Statistics Enable Facile Prediction and Design of Peptides that Bind Anti-apoptotic Bfl-1 and Mcl-1. Structure 2019 27 606 0 6MBC 30773399 Human Bfl-1 in complex with the designed peptide dF4 2018-08-29 2019-03-06 Frappier, V.,Jenson, J.M.,Zhou, J.,Grigoryan, G.,Keating, A.E. Tertiary Structural Motif Sequence Statistics Enable Facile Prediction and Design of Peptides that Bind Anti-apoptotic Bfl-1 and Mcl-1. Structure 2019 27 606 0 6E3A 30644400 tRNA 2'-phosphotransferase 2018-07-13 2019-03-20 Banerjee, A.,Munir, A.,Abdullahu, L.,Damha, M.J.,Goldgur, Y.,Shuman, S. Structure of tRNA splicing enzyme Tpt1 illuminates the mechanism of RNA 2'-PO4recognition and ADP-ribosylation. Nat Commun 2019 10 218 218 6EDE 30644400 tRNA 2'-phosphotransferase 2018-08-09 2019-03-20 Banerjee, A.,Munir, A.,Abdullahu, L.,Damha, M.J.,Goldgur, Y.,Shuman, S. Structure of tRNA splicing enzyme Tpt1 illuminates the mechanism of RNA 2'-PO4recognition and ADP-ribosylation. Nat Commun 2019 10 218 218 6N2N 31080943 Crystal structure of 2-oxoglutarate:ferredoxin oxidoreductase from Magnetococcus marinus 2018-11-13 2019-03-20 Chen, P.Y.,Li, B.,Drennan, C.L.,Elliott, S.J. A reverse TCA cycle 2-oxoacid:ferredoxin oxidoreductase that makes C-C bonds from CO2. Joule 2019 3 595 611 6N2O 31080943 2-oxoglutarate:ferredoxin oxidoreductase from Magnetococcus marinus with 2-oxoglutarate, coenzyme A and succinyl-CoA bound 2018-11-13 2019-03-20 Chen, P.Y.,Li, B.,Drennan, C.L.,Elliott, S.J. A reverse TCA cycle 2-oxoacid:ferredoxin oxidoreductase that makes C-C bonds from CO2. Joule 2019 3 595 611 6ND5 30733327 Crystal structure of the Thermus thermophilus 70S ribosome in complex with chloramphenicol and bound to mRNA and A-, P-, and E-site tRNAs at 2.60A resolution 2018-12-13 2019-03-20 Svetlov, M.S.,Plessa, E.,Chen, C.W.,Bougas, A.,Krokidis, M.G.,Dinos, G.P.,Polikanov, Y.S. High-resolution crystal structures of ribosome-bound chloramphenicol and erythromycin provide the ultimate basis for their competition. RNA 2019 25 600 606 6NX0 30846684 Crystal structure of the diheme peroxidase BthA from Burkholderia thailandensis E264 2019-02-07 2019-03-20 Rizzolo, K.,Cohen, S.E.,Weitz, A.C.,Lopez Munoz, M.M.,Hendrich, M.P.,Drennan, C.L.,Elliott, S.J. A widely distributed diheme enzyme from Burkholderia that displays an atypically stable bis-Fe(IV) state. Nat Commun 2019 10 1101 1101 6NS2 30861228 Crystal structure of fungal lipoxygenase from Fusarium graminearum. P212121 crystal form. 2019-01-24 2019-03-27 Pakhomova, S.,Boeglin, W.E.,Neau, D.B.,Bartlett, S.G.,Brash, A.R.,Newcomer, M.E. An ensemble of lipoxygenase structures reveals novel conformations of the Fe coordination sphere. Protein Sci. 2019 28 920 927 6NVO 30894417 Crystal structure of Pseudomonas putida nuclease MPE 2019-02-05 2019-03-27 Ejaz, A.,Goldgur, Y.,Shuman, S. Activity and structure ofPseudomonas putidaMPE, a manganese-dependent single-strand DNA endonuclease encoded in a nucleic acid repair gene cluster. J.Biol.Chem. 2019 294 7931 7941 6NVP 30894417 Crystal structure of Pseudomonas putida nuclease MPE 2019-02-05 2019-03-27 Ejaz, A.,Goldgur, Y.,Shuman, S. Activity and structure ofPseudomonas putidaMPE, a manganese-dependent single-strand DNA endonuclease encoded in a nucleic acid repair gene cluster. J.Biol.Chem. 2019 294 7931 7941 6M97 30918258 Crystal structure of the high-affinity copper transporter Ctr1 2018-08-22 2019-04-03 Ren, F.,Logeman, B.L.,Zhang, X.,Liu, Y.,Thiele, D.J.,Yuan, P. X-ray structures of the high-affinity copper transporter Ctr1. Nat Commun 2019 10 1386 1386 6M98 30918258 Crystal structure of the high-affinity copper transporter Ctr1 in complex with Cu(I) 2018-08-22 2019-04-03 Ren, F.,Logeman, B.L.,Zhang, X.,Liu, Y.,Thiele, D.J.,Yuan, P. X-ray structures of the high-affinity copper transporter Ctr1. Nat Commun 2019 10 1386 1386 6DKP 30617019 The complex among DMF5(alpha-D26Y, alpha-Y50A,beta-L98W) TCR, human Class I MHC HLA-A2 and MART-1(26-35)(A27L) peptide 2018-05-30 2019-04-10 Hellman, L.M.,Foley, K.C.,Singh, N.K.,Alonso, J.A.,Riley, T.P.,Devlin, J.R.,Ayres, C.M.,Keller, G.L.J.,Zhang, Y.,Vander Kooi, C.W.,Nishimura, M.I.,Baker, B.M. Improving T Cell Receptor On-Target Specificity via Structure-Guided Design. Mol. Ther. 2019 27 300 313 6E6B 30971825 Crystal structure of the Protocadherin GammaB4 extracellular domain 2018-07-24 2019-04-10 Brasch, J.,Goodman, K.M.,Noble, A.J.,Rapp, M.,Mannepalli, S.,Bahna, F.,Dandey, V.P.,Bepler, T.,Berger, B.,Maniatis, T.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Visualization of clustered protocadherin neuronal self-recognition complexes. Nature 2019 569 280 283 6MO6 30905673 Crystal structure of the selenomethionine-substituted human sulfide:quinone oxidoreductase 2018-10-04 2019-04-10 Jackson, M.R.,Loll, P.J.,Jorns, M.S. X-Ray Structure of Human Sulfide:Quinone Oxidoreductase: Insights into the Mechanism of Mitochondrial Hydrogen Sulfide Oxidation. Structure 2019 27 794 0 6MP5 30905673 Crystal structure of native human sulfide:quinone oxidoreductase 2018-10-05 2019-04-10 Jackson, M.R.,Loll, P.J.,Jorns, M.S. X-Ray Structure of Human Sulfide:Quinone Oxidoreductase: Insights into the Mechanism of Mitochondrial Hydrogen Sulfide Oxidation. Structure 2019 27 794 0 6MV5 30653992 Anti-PCSK9 fab 6E2 bound to the N-terminal peptide from PCSK9 (E32K) 2018-10-24 2019-04-10 Ultsch, M.,Li, W.,Eigenbrot, C.,Di Lello, P.,Lipari, M.T.,Gerhardy, S.,AhYoung, A.P.,Quinn, J.,Franke, Y.,Chen, Y.,Kong Beltran, M.,Peterson, A.,Kirchhofer, D. Identification of a Helical Segment within the Intrinsically Disordered Region of the PCSK9 Prodomain. J. Mol. Biol. 2019 431 885 903 6O44 30914195 Insight into subtilisin E-S7 cleavage pattern based on crystal structure and hydrolysates peptide analysis 2019-02-28 2019-04-10 Tang, H.,Zhang, J.,Shi, K.,Aihara, H.,Du, G. Insight into subtilisin E-S7 cleavage pattern based on crystal structure and hydrolysates peptide analysis. Biochem. Biophys. Res. Commun. 2019 512 623 628 6OCP 30971491 Crystal structure of a human GABAB receptor peptide bound to KCTD16 T1 2019-03-25 2019-04-10 Zuo, H.,Glaaser, I.,Zhao, Y.,Kurinov, I.,Mosyak, L.,Wang, H.,Liu, J.,Park, J.,Frangaj, A.,Sturchler, E.,Zhou, M.,McDonald, P.,Geng, Y.,Slesinger, P.A.,Fan, Q.R. Structural basis for auxiliary subunit KCTD16 regulation of the GABABreceptor. Proc.Natl.Acad.Sci.USA 2019 116 8370 8379 6DFQ 30952805 mouse diabetogenic TCR I.29 2018-05-15 2019-04-17 Wang, Y.,Sosinowski, T.,Novikov, A.,Crawford, F.,White, J.,Jin, N.,Liu, Z.,Zou, J.,Neau, D.,Davidson, H.W.,Nakayama, M.,Kwok, W.W.,Gapin, L.,Marrack, P.,Kappler, J.W.,Dai, S. How C-terminal additions to insulin B-chain fragments create superagonists for T cells in mouse and human type 1 diabetes. Sci Immunol 2019 4 0 0 6DFV 30952805 Mouse diabetogenic TCR 8F10 2018-05-15 2019-04-17 Wang, Y.,Sosinowski, T.,Novikov, A.,Crawford, F.,White, J.,Jin, N.,Liu, Z.,Zou, J.,Neau, D.,Davidson, H.W.,Nakayama, M.,Kwok, W.W.,Gapin, L.,Marrack, P.,Kappler, J.W.,Dai, S. How C-terminal additions to insulin B-chain fragments create superagonists for T cells in mouse and human type 1 diabetes. Sci Immunol 2019 4 0 0 6DFW 30952805 TCR 8F10 in complex with IAg7-p8G9E 2018-05-15 2019-04-17 Wang, Y.,Sosinowski, T.,Novikov, A.,Crawford, F.,White, J.,Jin, N.,Liu, Z.,Zou, J.,Neau, D.,Davidson, H.W.,Nakayama, M.,Kwok, W.W.,Gapin, L.,Marrack, P.,Kappler, J.W.,Dai, S. How C-terminal additions to insulin B-chain fragments create superagonists for T cells in mouse and human type 1 diabetes. Sci Immunol 2019 4 0 0 6E8S 30992561 Structure of the iMango-III aptamer bound to TO1-Biotin 2018-07-31 2019-04-17 Trachman 3rd., R.J.,Autour, A.,Jeng, S.C.Y.,Abdolahzadeh, A.,Andreoni, A.,Cojocaru, R.,Garipov, R.,Dolgosheina, E.V.,Knutson, J.R.,Ryckelynck, M.,Unrau, P.J.,Ferre-D'Amare, A.R. Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nat. Chem. Biol. 2019 15 472 479 6E8U 30992561 Structure of the Mango-III (A10U) aptamer bound to TO1-Biotin 2018-07-31 2019-04-17 Trachman 3rd., R.J.,Autour, A.,Jeng, S.C.Y.,Abdolahzadeh, A.,Andreoni, A.,Cojocaru, R.,Garipov, R.,Dolgosheina, E.V.,Knutson, J.R.,Ryckelynck, M.,Unrau, P.J.,Ferre-D'Amare, A.R. Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nat. Chem. Biol. 2019 15 472 479 6NC8 30988294 Lipid II flippase MurJ, inward occluded conformation 2018-12-11 2019-04-17 Kuk, A.C.Y.,Hao, A.,Guan, Z.,Lee, S.Y. Visualizing conformation transitions of the Lipid II flippase MurJ. Nat Commun 2019 10 1736 1736 6NQ7 30930064 Crystal structure of YetJ from Bacillus Subtilis crystallized in lipidic cubic phase 2019-01-19 2019-04-17 Guo, G.,Xu, M.,Chang, Y.,Luyten, T.,Seitaj, B.,Liu, W.,Zhu, P.,Bultynck, G.,Shi, L.,Quick, M.,Liu, Q. Ion and pH Sensitivity of a TMBIM Ca2+Channel. Structure 2019 27 1013 0 6O97 30793894 Crystal structure of the Thermus thermophilus 70S ribosome in complex with propylamycin and bound to mRNA and A-, P-, and E-site tRNAs at 2.75A resolution 2019-03-13 2019-04-17 Matsushita, T.,Sati, G.C.,Kondasinghe, N.,Pirrone, M.G.,Kato, T.,Waduge, P.,Kumar, H.S.,Sanchon, A.C.,Dobosz-Bartoszek, M.,Shcherbakov, D.,Juhas, M.,Hobbie, S.N.,Schrepfer, T.,Chow, C.S.,Polikanov, Y.S.,Schacht, J.,Vasella, A.,Bottger, E.C.,Crich, D. Design, Multigram Synthesis, and in Vitro and in Vivo Evaluation of Propylamycin: A Semisynthetic 4,5-Deoxystreptamine Class Aminoglycoside for the Treatment of Drug-Resistant Enterobacteriaceae and Other Gram-Negative Pathogens. J. Am. Chem. Soc. 2019 141 5051 5061 6OF1 30936109 Crystal structure of the Thermus thermophilus 70S ribosome in complex with dirithromycin and bound to mRNA and A-, P-, and E-site tRNAs at 2.80A resolution 2019-03-28 2019-04-17 Khabibullina, N.F.,Tereshchenkov, A.G.,Komarova, E.S.,Syroegin, E.A.,Shiriaev, D.I.,Paleskava, A.,Kartsev, V.G.,Bogdanov, A.A.,Konevega, A.L.,Dontsova, O.A.,Sergiev, P.V.,Osterman, I.A.,Polikanov, Y.S. Structure of Dirithromycin Bound to the Bacterial Ribosome Suggests New Ways for Rational Improvement of Macrolides. Antimicrob.Agents Chemother. 2019 63 0 0 6DTI 31945376 Structure of the Thermus thermophilus 30S ribosomal subunit complexed with an unmodifed anticodon stem loop (ASL) of Escherichia coli transfer RNA Arginine 2 (TRNAARG2) bound to an mRNA with an CGU-codon in the A-site and paromomycin 2018-06-16 2019-04-24 Vangaveti, S.,Cantara, W.A.,Spears, J.L.,DeMirci, H.,Murphy IV, F.V.,Ranganathan, S.V.,Sarachan, K.L.,Agris, P.F. A Structural Basis for Restricted Codon Recognition Mediated by 2-thiocytidine in tRNA Containing a Wobble Position Inosine. J.Mol.Biol. 2020 432 913 929 6MKN 31945376 Structure of the Thermus thermophilus 30S ribosomal subunit complexed with an inosine (I34) modified anticodon stem loop (ASL) of Escherichia coli transfer RNA Arginine 2 (TRNAARG2) bound to an mRNA with an CGU-codon in the A-site and paromomycin 2018-09-25 2019-04-24 Vangaveti, S.,Cantara, W.A.,Spears, J.L.,DeMirci, H.,Murphy IV, F.V.,Ranganathan, S.V.,Sarachan, K.L.,Agris, P.F. A Structural Basis for Restricted Codon Recognition Mediated by 2-thiocytidine in tRNA Containing a Wobble Position Inosine. J.Mol.Biol. 2020 432 913 929 6MPF 31945376 Structure of the Thermus thermophilus 30S ribosomal subunit complexed with a 2-thiocytidine (s2C32) and inosine (I34) modified anticodon stem loop (ASL) of Escherichia coli transfer RNA Arginine 1 (TRNAARG1) bound to an mRNA with an CGC-codon in the A-site and paromomycin 2018-10-05 2019-04-24 Vangaveti, S.,Cantara, W.A.,Spears, J.L.,DeMirci, H.,Murphy IV, F.V.,Ranganathan, S.V.,Sarachan, K.L.,Agris, P.F. A Structural Basis for Restricted Codon Recognition Mediated by 2-thiocytidine in tRNA Containing a Wobble Position Inosine. J.Mol.Biol. 2020 432 913 929 6MPI 31945376 Structure of the Thermus thermophilus 30S ribosomal subunit complexed with a 2-thiocytidine (s2C32) and inosine (I34) modified anticodon stem loop (ASL) of Escherichia coli transfer RNA Arginine 1 (TRNAARG1) bound to an mRNA with an CGU-codon in the A-site and paromomycin 2018-10-07 2019-04-24 Vangaveti, S.,Cantara, W.A.,Spears, J.L.,DeMirci, H.,Murphy IV, F.V.,Ranganathan, S.V.,Sarachan, K.L.,Agris, P.F. A Structural Basis for Restricted Codon Recognition Mediated by 2-thiocytidine in tRNA Containing a Wobble Position Inosine. J.Mol.Biol. 2020 432 913 929 6NXF 31003867 Crystal structure of mouse REC114 PH domain in complex with ANKRD31 C terminus 2019-02-08 2019-04-24 Boekhout, M.,Karasu, M.E.,Wang, J.,Acquaviva, L.,Pratto, F.,Brick, K.,Eng, D.Y.,Xu, J.,Camerini-Otero, R.D.,Patel, D.J.,Keeney, S. REC114 Partner ANKRD31 Controls Number, Timing, and Location of Meiotic DNA Breaks. Mol.Cell 2019 74 1053 0 6O19 31010807 Crystal Structure of Pho7 complex with pho1 promoter site 2 2019-02-18 2019-04-24 Garg, A.,Goldgur, Y.,Sanchez, A.M.,Schwer, B.,Shuman, S. Structure of Fission Yeast Transcription Factor Pho7 Bound topho1Promoter DNA and Effect of Pho7 Mutations on DNA Binding and Phosphate Homeostasis. Mol.Cell.Biol. 2019 39 0 0 6OE7 31235913 Crystal structure of HMCES cross-linked to DNA abasic site 2019-03-27 2019-04-24 Halabelian, L.,Ravichandran, M.,Li, Y.,Zeng, H.,Rao, A.,Aravind, L.,Arrowsmith, C.H. Structural basis of HMCES interactions with abasic DNA and multivalent substrate recognition. Nat.Struct.Mol.Biol. 2019 26 607 612 6IZ3 30770441 Structural basis for activity of TRIC counter-ion channels in calcium release 2018-12-18 2019-05-01 Wang, X.H.,Su, M.,Gao, F.,Xie, W.,Zeng, Y.,Li, D.L.,Liu, X.L.,Zhao, H.,Qin, L.,Li, F.,Liu, Q.,Clarke, O.B.,Lam, S.M.,Shui, G.H.,Hendrickson, W.A.,Chen, Y.H. Structural basis for activity of TRIC counter-ion channels in calcium release. Proc.Natl.Acad.Sci.USA 2019 116 4238 4243 6IZ5 30770441 Crystal Structure Analysis of a Eukaryotic Membrane Protein 2018-12-18 2019-05-01 Wang, X.H.,Su, M.,Gao, F.,Xie, W.,Zeng, Y.,Li, D.L.,Liu, X.L.,Zhao, H.,Qin, L.,Li, F.,Liu, Q.,Clarke, O.B.,Lam, S.M.,Shui, G.H.,Hendrickson, W.A.,Chen, Y.H. Structural basis for activity of TRIC counter-ion channels in calcium release. Proc.Natl.Acad.Sci.USA 2019 116 4238 4243 6IZ6 30770441 Crystal Structure Analysis of TRIC counter-ion channels in calcium release 2018-12-18 2019-05-01 Wang, X.H.,Su, M.,Gao, F.,Xie, W.,Zeng, Y.,Li, D.L.,Liu, X.L.,Zhao, H.,Qin, L.,Li, F.,Liu, Q.,Clarke, O.B.,Lam, S.M.,Shui, G.H.,Hendrickson, W.A.,Chen, Y.H. Structural basis for activity of TRIC counter-ion channels in calcium release. Proc.Natl.Acad.Sci.USA 2019 116 4238 4243 6IZF 30770441 Structural basis for activity of TRIC counter-ion channels in calcium release 2018-12-19 2019-05-01 Wang, X.H.,Su, M.,Gao, F.,Xie, W.,Zeng, Y.,Li, D.L.,Liu, X.L.,Zhao, H.,Qin, L.,Li, F.,Liu, Q.,Clarke, O.B.,Lam, S.M.,Shui, G.H.,Hendrickson, W.A.,Chen, Y.H. Structural basis for activity of TRIC counter-ion channels in calcium release. Proc.Natl.Acad.Sci.USA 2019 116 4238 4243 6DBP 31217428 RNA-recognition motif 1 of human MSI2 2018-05-03 2019-05-08 Minuesa, G.,Albanese, S.K.,Xie, W.,Kazansky, Y.,Worroll, D.,Chow, A.,Schurer, A.,Park, S.M.,Rotsides, C.Z.,Taggart, J.,Rizzi, A.,Naden, L.N.,Chou, T.,Gourkanti, S.,Cappel, D.,Passarelli, M.C.,Fairchild, L.,Adura, C.,Glickman, J.F.,Schulman, J.,Famulare, C.,Patel, M.,Eibl, J.K.,Ross, G.M.,Bhattacharya, S.,Tan, D.S.,Leslie, C.S.,Beuming, T.,Patel, D.J.,Goldgur, Y.,Chodera, J.D.,Kharas, M.G. Small-molecule targeting of MUSASHI RNA-binding activity in acute myeloid leukemia. Nat Commun 2019 10 2691 2691 6DE9 32382661 mitoNEET bound to furosemide 2018-05-11 2019-05-15 Geldenhuys, W.J.,Long, T.E.,Saralkar, P.,Iwasaki, T.,Nunez, R.A.A.,Nair, R.R.,Konkle, M.E.,Menze, M.A.,Pinti, M.V.,Hollander, J.M.,Hazlehurst, L.A.,Robart, A.R. Crystal structure of the mitochondrial protein mitoNEET bound to a benze-sulfonide ligand. Commun Chem 2019 2 0 0 6E2J 31036554 Crystal structure of the heterocomplex between human keratin 1 coil 1B containing S233L mutation and wild-type human keratin 10 coil 1B 2018-07-11 2019-05-15 Eldirany, S.A.,Ho, M.,Hinbest, A.J.,Lomakin, I.B.,Bunick, C.G. Human keratin 1/10-1B tetramer structures reveal a knob-pocket mechanism in intermediate filament assembly. Embo J. 2019 38 0 0 6EC0 31036554 Crystal structure of the wild-type heterocomplex between coil 1B domains of human intermediate filament proteins keratin 1 (KRT1) and keratin 10 (KRT10) 2018-08-07 2019-05-15 Eldirany, S.A.,Ho, M.,Hinbest, A.J.,Lomakin, I.B.,Bunick, C.G. Human keratin 1/10-1B tetramer structures reveal a knob-pocket mechanism in intermediate filament assembly. Embo J. 2019 38 0 0 6ON9 31043568 Crystal Structure of the ZIG-8-RIG-5 IG1-IG1 heterodimer, tetragonal form 2019-04-20 2019-05-15 Cheng, S.,Park, Y.,Kurleto, J.D.,Jeon, M.,Zinn, K.,Thornton, J.W.,Ozkan, E. Family of neural wiring receptors in bilaterians defined by phylogenetic, biochemical, and structural evidence. Proc.Natl.Acad.Sci.USA 2019 116 9837 9842 6ONB 31043568 Crystal Structure of the ZIG-8-RIG-5 IG1-IG1 heterodimer, monoclinic form 2019-04-20 2019-05-15 Cheng, S.,Park, Y.,Kurleto, J.D.,Jeon, M.,Zinn, K.,Thornton, J.W.,Ozkan, E. Family of neural wiring receptors in bilaterians defined by phylogenetic, biochemical, and structural evidence. Proc.Natl.Acad.Sci.USA 2019 116 9837 9842 6IEJ 31050338 The C2 domain of cytosolic phospholipase A2 alpha bound to phosphatidylcholine 2018-09-14 2019-05-22 Hirano, Y.,Gao, Y.G.,Stephenson, D.J.,Vu, N.T.,Malinina, L.,Simanshu, D.K.,Chalfant, C.E.,Patel, D.J.,Brown, R.E. Structural basis of phosphatidylcholine recognition by the C2-domain of cytosolic phospholipase A2alpha. Elife 2019 8 0 0 6EDB 31142647 Crystal structure of SRY.hcGAS-21bp dsDNA complex 2018-08-09 2019-05-29 Xie, W.,Lama, L.,Adura, C.,Tomita, D.,Glickman, J.F.,Tuschl, T.,Patel, D.J. Human cGAS catalytic domain has an additional DNA-binding interface that enhances enzymatic activity and liquid-phase condensation. Proc.Natl.Acad.Sci.USA 2019 116 11946 11955 6EDC 31142647 hcGAS-16bp dsDNA complex 2018-08-09 2019-05-29 Xie, W.,Lama, L.,Adura, C.,Tomita, D.,Glickman, J.F.,Tuschl, T.,Patel, D.J. Human cGAS catalytic domain has an additional DNA-binding interface that enhances enzymatic activity and liquid-phase condensation. Proc.Natl.Acad.Sci.USA 2019 116 11946 11955 6O3P 31101919 Crystal structure of the catalytic domain of mouse Nudt12 in complex with AMP and 3 Mg2+ ions 2019-02-27 2019-05-29 Grudzien-Nogalska, E.,Wu, Y.,Jiao, X.,Cui, H.,Mateyak, M.K.,Hart, R.P.,Tong, L.,Kiledjian, M. Structural and mechanistic basis of mammalian Nudt12 RNA deNADding. Nat.Chem.Biol. 2019 15 575 582 6OR2 31113875 MmpL3 is a lipid transporter that binds trehalose monomycolate and phosphatidylethanolamine 2019-04-29 2019-05-29 Su, C.C.,Klenotic, P.A.,Bolla, J.R.,Purdy, G.E.,Robinson, C.V.,Yu, E.W. MmpL3 is a lipid transporter that binds trehalose monomycolate and phosphatidylethanolamine. Proc.Natl.Acad.Sci.USA 2019 116 11241 11246 6DUK 31092401 EGFR with an allosteric inhibitor 2018-06-21 2019-06-05 To, C.,Jang, J.,Chen, T.,Park, E.,Mushajiang, M.,De Clercq, D.J.H.,Xu, M.,Wang, S.,Cameron, M.D.,Heppner, D.E.,Shin, B.H.,Gero, T.W.,Yang, A.,Dahlberg, S.E.,Wong, K.K.,Eck, M.J.,Gray, N.S.,Janne, P.A. Single and Dual Targeting of Mutant EGFR with an Allosteric Inhibitor. Cancer Discov 2019 9 926 943 6O3W 31104813 Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM1 2019-02-27 2019-06-05 Zhang, Y.,Chun, Y.,Buratowski, S.,Tong, L. Identification of Three Sequence Motifs in the Transcription Termination Factor Sen1 that Mediate Direct Interactions with Nrd1. Structure 2019 27 1156 0 6O3X 31104813 Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM2 2019-02-27 2019-06-05 Zhang, Y.,Chun, Y.,Buratowski, S.,Tong, L. Identification of Three Sequence Motifs in the Transcription Termination Factor Sen1 that Mediate Direct Interactions with Nrd1. Structure 2019 27 1156 0 6O3Y 31104813 Crystal structure of yeast Nrd1 CID in complex with Sen1 NIM3 2019-02-27 2019-06-05 Zhang, Y.,Chun, Y.,Buratowski, S.,Tong, L. Identification of Three Sequence Motifs in the Transcription Termination Factor Sen1 that Mediate Direct Interactions with Nrd1. Structure 2019 27 1156 0 6BUN 31181074 Crystal structures of cyanuric acid hydrolase from Moorella thermoacetica 2017-12-11 2019-06-12 Shi, K.,Cho, S.,Aukema, K.G.,Lee, T.,Bera, A.K.,Seffernick, J.L.,Wackett, L.P.,Aihara, H. Crystal structures of Moorella thermoacetica cyanuric acid hydrolase reveal conformational flexibility and asymmetry important for catalysis. Plos One 2019 14 0 0 6DNZ 31726063 Trypanosoma brucei PRMT1 enzyme-prozyme heterotetrameric complex with AdoHcy 2018-06-08 2019-06-12 Hashimoto, H.,Kafkova, L.,Raczkowski, A.,Jordan, K.D.,Read, L.K.,Debler, E.W. Structural Basis of Protein Arginine Methyltransferase Activation by a Catalytically Dead Homolog (Prozyme). J.Mol.Biol. 2020 432 410 426 6JQ6 31088965 Hatchet Ribozyme Structure soaking with Ir(NH3)6+ 2019-03-29 2019-06-12 Zheng, L.,Falschlunger, C.,Huang, K.,Mairhofer, E.,Yuan, S.,Wang, J.,Patel, D.J.,Micura, R.,Ren, A. Hatchet ribozyme structure and implications for cleavage mechanism. Proc.Natl.Acad.Sci.USA 2019 116 10783 10791 6O07 31155310 Structure and mechanism of acetylation by the N-terminal dual enzyme NatA/Naa50 complex 2019-02-15 2019-06-12 Deng, S.,Magin, R.S.,Wei, X.,Pan, B.,Petersson, E.J.,Marmorstein, R. Structure and Mechanism of Acetylation by the N-Terminal Dual Enzyme NatA/Naa50 Complex. Structure 2019 27 1057 0 6OP5 31332312 Crystal Structure of Piper methysticum Styrylpyrone Synthase 1 in complex with p-coumaroyl-CoA 2019-04-24 2019-06-12 Pluskal, T.,Torrens-Spence, M.P.,Fallon, T.R.,De Abreu, A.,Shi, C.H.,Weng, J.K. The biosynthetic origin of psychoactive kavalactones in kava. Nat.Plants 2019 5 867 878 6P4Z Structure of gadolinium-caged cobalt (III) insulin hexamer 2019-05-29 2019-06-12 Taylor, S.K.,Tran, T.H.,Liu, M.Z.,Harris, P.E.,Sun, Y.,Jambawalikar, S.R.,Tong, L.,Stojanovic, M.N. Insulin Hexamer-Caged Gadolinium Ion as MRI Contrast-o-phore ChemBioChem 2018 24 10646 10652 6CM2 31375673 SAMHD1 HD domain bound to decitabine triphosphate 2018-03-02 2019-06-19 Oellerich, T.,Schneider, C.,Thomas, D.,Knecht, K.M.,Buzovetsky, O.,Kaderali, L.,Schliemann, C.,Bohnenberger, H.,Angenendt, L.,Hartmann, W.,Wardelmann, E.,Rothenburger, T.,Mohr, S.,Scheich, S.,Comoglio, F.,Wilke, A.,Strobel, P.,Serve, H.,Michaelis, M.,Ferreiros, N.,Geisslinger, G.,Xiong, Y.,Keppler, O.T.,Cinatl Jr., J. Selective inactivation of hypomethylating agents by SAMHD1 provides a rationale for therapeutic stratification in AML. Nat Commun 2019 10 3475 3475 6MQA 31155311 Structure of HIV-1 CA P207S 2018-10-09 2019-06-19 Smaga, S.S.,Xu, C.,Summers, B.J.,Digianantonio, K.M.,Perilla, J.R.,Xiong, Y. MxB Restricts HIV-1 by Targeting the Tri-hexamer Interface of the Viral Capsid. Structure 2019 27 1234 0 6MQO 31155311 Structure of HIV-1 CA G208R 2018-10-10 2019-06-19 Smaga, S.S.,Xu, C.,Summers, B.J.,Digianantonio, K.M.,Perilla, J.R.,Xiong, Y. MxB Restricts HIV-1 by Targeting the Tri-hexamer Interface of the Viral Capsid. Structure 2019 27 1234 0 6MQP 31155311 Structure of HIV-1 CA T210K 2018-10-10 2019-06-19 Smaga, S.S.,Xu, C.,Summers, B.J.,Digianantonio, K.M.,Perilla, J.R.,Xiong, Y. MxB Restricts HIV-1 by Targeting the Tri-hexamer Interface of the Viral Capsid. Structure 2019 27 1234 0 6O83 31235585 S. pombe ubiquitin E1~ubiquitin-AMP tetrahedral intermediate mimic 2019-03-08 2019-06-19 Hann, Z.S.,Ji, C.,Olsen, S.K.,Lu, X.,Lux, M.C.,Tan, D.S.,Lima, C.D. Structural basis for adenylation and thioester bond formation in the ubiquitin E1. Proc.Natl.Acad.Sci.USA 2019 116 15475 15484 6OJU 31172516 Crystal structure of human thymidylate synthase Delta (7-29) in complex with dUMP and 2-amino-4-oxo-4,7-dihydro-pyrrolo[2,3-d]pyrimidine-methyl-phenyl-D-glutamic acid 2019-04-12 2019-06-19 Czyzyk, D.J.,Valhondo, M.,Jorgensen, W.L.,Anderson, K.S. Understanding the structural basis of species selective, stereospecific inhibition for Cryptosporidium and human thymidylate synthase. Febs Lett. 2019 593 2069 2078 6P0S 31616952 Crystal structure of ternary DNA complex ""FX2"" containing E. coli Fis and phage lambda Xis 2019-05-17 2019-06-19 Hancock, S.P.,Cascio, D.,Johnson, R.C. Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res. 2019 47 8874 8887 6P0T 31616952 Crystal structure of ternary DNA complex ""FX(1-2)-1Xis"" containing E. coli Fis and phage lambda Xis 2019-05-17 2019-06-19 Hancock, S.P.,Cascio, D.,Johnson, R.C. Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res. 2019 47 8874 8887 6P0U 31616952 Crystal structure of ternary DNA complex "" FX(1-2)-2Xis"" containing E. coli Fis and phage lambda Xis 2019-05-17 2019-06-19 Hancock, S.P.,Cascio, D.,Johnson, R.C. Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res. 2019 47 8874 8887 6QNM 31270241 Apo state of chemotaxis sensor ODP from T. denticola 2019-02-11 2019-06-19 Muok, A.R.,Deng, Y.,Gumerov, V.M.,Chong, J.E.,DeRosa, J.R.,Kurniyati, K.,Coleman, R.E.,Lancaster, K.M.,Li, C.,Zhulin, I.B.,Crane, B.R. A di-iron protein recruited as an Fe[II] and oxygen sensor for bacterial chemotaxis functions by stabilizing an iron-peroxy species. Proc.Natl.Acad.Sci.USA 2019 116 14955 14960 6DHJ 31181074 Crystal structures of cyanuric acid hydrolase from Moorella thermoacetica 2018-05-20 2019-06-26 Shi, K.,Cho, S.,Aukema, K.G.,Lee, T.,Bera, A.K.,Seffernick, J.L.,Wackett, L.P.,Aihara, H. Crystal structures of Moorella thermoacetica cyanuric acid hydrolase reveal conformational flexibility and asymmetry important for catalysis. Plos One 2019 14 0 0 6DUC Crystal structure of mutant beta-K167T tryptophan synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the alpha-site, cesium ion at the metal coordination site, and 2-aminophenol quinonoid (1D0) at the beta-site 2018-06-20 2019-06-26 Hilario, E.,Dunn, M.F.,Mueller, L.J.,Fan, L. Tryptophan synthase Q114A mutant in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the alpha-site, aminoacrylate (P1T) at the beta site, and cesium ion at the metal coordination site. To be Published 0 0 0 0 6EBU 31213552 Crystal structure of Aquifex aeolicus LpxE 2018-08-07 2019-06-26 Zhao, J.,An, J.,Hwang, D.,Wu, Q.,Wang, S.,Gillespie, R.A.,Yang, E.G.,Guan, Z.,Zhou, P.,Chung, H.S. The Lipid A 1-Phosphatase, LpxE, Functionally Connects Multiple Layers of Bacterial Envelope Biogenesis. Mbio 2019 10 0 0 6DWQ Subtilisin serine protease modified with the protease inhibitor cyanobenzylsulfonylfluoride 2018-06-27 2019-07-03 Luo, M.,Eaton, C.N.,Hess, K.R.,Phillips-Piro, C.M.,Brewer, S.H.,Fenlon, E.E. Paired Spectroscopic and Crystallographic Studies of Protease Active Sites Chemistryselect 2019 4 9836 9843 6M80 31588264 Collagen peptide containing aza-proline and aza-glycine 2018-08-21 2019-07-03 Kasznel, A.J.,Harris, T.,Porter, N.J.,Zhang, Y.,Chenoweth, D.M. Aza-proline effectively mimics l-proline stereochemistry in triple helical collagen. Chem Sci 2019 10 6979 6983 6OB6 31235912 Human equilibrative nucleoside transporter-1, S-(4-nitrobenzyl)-6-thioinosine bound, merohedrally twinned 2019-03-19 2019-07-03 Wright, N.J.,Lee, S.Y. Structures of human ENT1 in complex with adenosine reuptake inhibitors. Nat.Struct.Mol.Biol. 2019 26 599 606 6OB7 31235912 Human equilibrative nucleoside transporter-1, dilazep bound 2019-03-19 2019-07-03 Wright, N.J.,Lee, S.Y. Structures of human ENT1 in complex with adenosine reuptake inhibitors. Nat.Struct.Mol.Biol. 2019 26 599 606 6OPF 31384064 Crystal structure of dmNxf2 UBA domain fused with Panoramix helix 2019-04-24 2019-07-03 Batki, J.,Schnabl, J.,Wang, J.,Handler, D.,Andreev, V.I.,Stieger, C.E.,Novatchkova, M.,Lampersberger, L.,Kauneckaite, K.,Xie, W.,Mechtler, K.,Patel, D.J.,Brennecke, J. The nascent RNA binding complex SFiNX licenses piRNA-guided heterochromatin formation. Nat.Struct.Mol.Biol. 2019 26 720 731 6OUV 31239351 1-deoxy-D-xylulose 5-phosphate synthase (DXPS) from Deinococcus radiodurans with methylacetylphosphonate (MAP) bound 2019-05-05 2019-07-03 Chen, P.Y.,DeColli, A.A.,Freel Meyers, C.L.,Drennan, C.L. X-ray crystallography-based structural elucidation of enzyme-bound intermediates along the 1-deoxy-d-xylulose 5-phosphate synthase reaction coordinate. J.Biol.Chem. 2019 294 12405 12414 6OUW 31239351 1-deoxy-D-xylulose 5-phosphate synthase (DXPS) from Deinococcus radiodurans with enamine intermediate bound 2019-05-05 2019-07-03 Chen, P.Y.,DeColli, A.A.,Freel Meyers, C.L.,Drennan, C.L. X-ray crystallography-based structural elucidation of enzyme-bound intermediates along the 1-deoxy-d-xylulose 5-phosphate synthase reaction coordinate. J.Biol.Chem. 2019 294 12405 12414 6OM3 31263106 Crystal structure of the Orc1 BAH domain in complex with a nucleosome core particle 2019-04-18 2019-07-10 De Ioannes, P.,Leon, V.A.,Kuang, Z.,Wang, M.,Boeke, J.D.,Hochwagen, A.,Armache, K.J. Structure and function of the Orc1 BAH-nucleosome complex. Nat Commun 2019 10 2894 2894 6OQ5 31308519 Structure of the full-length Clostridium difficile toxin B in complex with 3 VHHs 2019-04-25 2019-07-10 Chen, P.,Lam, K.H.,Liu, Z.,Mindlin, F.A.,Chen, B.,Gutierrez, C.B.,Huang, L.,Zhang, Y.,Hamza, T.,Feng, H.,Matsui, T.,Bowen, M.E.,Perry, K.,Jin, R. Structure of the full-length Clostridium difficile toxin B. Nat.Struct.Mol.Biol. 2019 26 712 719 6OQ6 31308519 Structure of the pore forming fragment of Clostridium difficile toxin B in complex with VHH 5D 2019-04-25 2019-07-10 Chen, P.,Lam, K.H.,Liu, Z.,Mindlin, F.A.,Chen, B.,Gutierrez, C.B.,Huang, L.,Zhang, Y.,Hamza, T.,Feng, H.,Matsui, T.,Bowen, M.E.,Perry, K.,Jin, R. Structure of the full-length Clostridium difficile toxin B. Nat.Struct.Mol.Biol. 2019 26 712 719 6OQ8 31308519 Structure of the GTD domain of Clostridium difficile toxin B in complex with VHH 7F 2019-04-25 2019-07-10 Chen, P.,Lam, K.H.,Liu, Z.,Mindlin, F.A.,Chen, B.,Gutierrez, C.B.,Huang, L.,Zhang, Y.,Hamza, T.,Feng, H.,Matsui, T.,Bowen, M.E.,Perry, K.,Jin, R. Structure of the full-length Clostridium difficile toxin B. Nat.Struct.Mol.Biol. 2019 26 712 719 6OYZ 31266949 Crystal structure of MraY bound to capuramycin 2019-05-15 2019-07-10 Mashalidis, E.H.,Kaeser, B.,Terasawa, Y.,Katsuyama, A.,Kwon, D.Y.,Lee, K.,Hong, J.,Ichikawa, S.,Lee, S.Y. Chemical logic of MraY inhibition by antibacterial nucleoside natural products. Nat Commun 2019 10 2917 2917 6D68 31634471 Ube2G1 in complex with ubiquitin variant Ubv.G1.1 2018-04-20 2019-07-17 Garg, P.,Ceccarelli, D.F.,Keszei, A.F.A.,Kurinov, I.,Sicheri, F.,Sidhu, S.S. Structural and Functional Analysis of Ubiquitin-based Inhibitors That Target the Backsides of E2 Enzymes. J.Mol.Biol. 2020 432 952 966 6D6I 31634471 Ube2V1 in complex with ubiquitin variant Ubv.V1.1 and Ube2N/Ubc13 2018-04-21 2019-07-17 Garg, P.,Ceccarelli, D.F.,Keszei, A.F.A.,Kurinov, I.,Sicheri, F.,Sidhu, S.S. Structural and Functional Analysis of Ubiquitin-based Inhibitors That Target the Backsides of E2 Enzymes. J.Mol.Biol. 2020 432 952 966 6OS3 31251043 Crystal structure of native CymD prenyltransferase 2019-05-01 2019-07-17 Roose, B.W.,Christianson, D.W. Structural Basis of Tryptophan Reverse N-Prenylation Catalyzed by CymD. Biochemistry 2019 58 3232 3242 6E5D 31471317 Crystal structure of LpqN involved in cell envelope biogenesis of Mycobacterium tuberculosis 2018-07-20 2019-07-24 Melly, G.C.,Stokas, H.,Dunaj, J.L.,Hsu, F.F.,Rajavel, M.,Su, C.C.,Yu, E.W.,Purdy, G.E. Structural and functional evidence that lipoprotein LpqN supports cell envelope biogenesis inMycobacterium tuberculosis. J.Biol.Chem. 2019 294 15711 15723 6E5F 31471317 Crystal structure of LpqN involved in cell envelope biogenesis of Mycobacterium tuberculosis 2018-07-20 2019-07-24 Melly, G.C.,Stokas, H.,Dunaj, J.L.,Hsu, F.F.,Rajavel, M.,Su, C.C.,Yu, E.W.,Purdy, G.E. Structural and functional evidence that lipoprotein LpqN supports cell envelope biogenesis inMycobacterium tuberculosis. J.Biol.Chem. 2019 294 15711 15723 6ONC 31296570 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase produced without CooC, as-isolated 2019-04-21 2019-07-24 Wittenborn, E.C.,Cohen, S.E.,Merrouch, M.,Leger, C.,Fourmond, V.,Dementin, S.,Drennan, C.L. Structural insight into metallocofactor maturation in carbon monoxide dehydrogenase. J.Biol.Chem. 2019 294 13017 13026 6OND 31296570 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase produced without CooC, reduced 2019-04-21 2019-07-24 Wittenborn, E.C.,Cohen, S.E.,Merrouch, M.,Leger, C.,Fourmond, V.,Dementin, S.,Drennan, C.L. Structural insight into metallocofactor maturation in carbon monoxide dehydrogenase. J.Biol.Chem. 2019 294 13017 13026 6ONS 31296570 Crystal structure of Desulfovibrio vulgaris carbon monoxide dehydrogenase with the D-cluster ligating cysteines mutated to alanines, coexpressed with CooC, as-isolated 2019-04-22 2019-07-24 Wittenborn, E.C.,Cohen, S.E.,Merrouch, M.,Leger, C.,Fourmond, V.,Dementin, S.,Drennan, C.L. Structural insight into metallocofactor maturation in carbon monoxide dehydrogenase. J.Biol.Chem. 2019 294 13017 13026 6E6Z Structure of Wild Type Human Transthyretin in Complex with Tafamidis 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E70 Structure of Wild Type Human Transthyretin in Complex with Diflunisal 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E71 Structure of Human Transthyretin Val30Met/Thr119Met Mutant 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E72 Structure of Human Transthyretin Val30Met Mutant in Complex with Tafamidis 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E73 Structure of Human Transthyretin Val30Met Mutant in Complex with Diflunisal 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Cascio, D.,Sawaya, M.R.,Eisenberg, D.S. Structural Variants of Transthyretin to be published 0 0 0 0 6E74 Structure of Human Transthyretin Leu55Pro Mutant in Complex with Tafamidis 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E75 Structure of Human Transthyretin Asp38Ala Mutant 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E76 Structure of Human Transthyretin Asp38Ala/Thr119Met Mutant 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E77 Structure of Human Transthyretin Asp38Ala Mutant in Complex with Tafamidis 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E78 Structure of Human Transthyretin Asp38Ala Mutant in Complex with Diflunisal 2018-07-25 2019-07-31 Saelices, L.,Chung, K.,Esswein, S.,Chou, J.,Liang, W.,Li, J.H.,Sawaya, M.R.,Cascio, D.,Eisenberg, D. Structural Variants of Transthyretin To Be Published 0 0 0 0 6E8F 32963095 Crystal Structure of Human Protocadherin-15 EC3-5 CD2-1 2018-07-29 2019-07-31 Choudhary, D.,Narui, Y.,Neel, B.L.,Wimalasena, L.N.,Klanseck, C.F.,De-la-Torre, P.,Chen, C.,Araya-Secchi, R.,Tamilselvan, E.,Sotomayor, M. Structural determinants of protocadherin-15 mechanics and function in hearing and balance perception. Proc.Natl.Acad.Sci.USA 2020 0 0 0 6O6S 31326273 Crystal structure of Apo Csm6 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Yang, G.,Ouerfelli, O.,Patel, D.J. CRISPR-Cas III-A Csm6 CARF Domain Is a Ring Nuclease Triggering Stepwise cA4Cleavage with ApA>p Formation Terminating RNase Activity. Mol.Cell 2019 75 944 0 6O6T 31326273 Crystal structure of Csm6 H132A mutant 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Yang, G.,Ouerfelli, O.,Patel, D.J. CRISPR-Cas III-A Csm6 CARF Domain Is a Ring Nuclease Triggering Stepwise cA4Cleavage with ApA>p Formation Terminating RNase Activity. Mol.Cell 2019 75 944 0 6O6Y 31326273 Crystal structure of Csm6 in complex with cyclic-tetraadenylates (cA4) by cocrystallization of Csm6 and cA4 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Yang, G.,Ouerfelli, O.,Patel, D.J. CRISPR-Cas III-A Csm6 CARF Domain Is a Ring Nuclease Triggering Stepwise cA4Cleavage with ApA>p Formation Terminating RNase Activity. Mol.Cell 2019 75 944 0 6O70 31326273 Crystal structure of Csm6 H132A mutant in complex with cA4 by cocrystallization of cA4 and Csm6 H132A mutant 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Yang, G.,Ouerfelli, O.,Patel, D.J. CRISPR-Cas III-A Csm6 CARF Domain Is a Ring Nuclease Triggering Stepwise cA4Cleavage with ApA>p Formation Terminating RNase Activity. Mol.Cell 2019 75 944 0 6O71 31326273 Crystal structure of Csm6 in complex with cdA4 by soaking cdA4 into Csm6 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Yang, G.,Ouerfelli, O.,Patel, D.J. CRISPR-Cas III-A Csm6 CARF Domain Is a Ring Nuclease Triggering Stepwise cA4Cleavage with ApA>p Formation Terminating RNase Activity. Mol.Cell 2019 75 944 0 6O74 31326272 Crystal structure of Csm1-Csm4 cassette in complex with AMPPNP 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Sukenick, G.,Patel, D.J. Second Messenger cA4Formation within the Composite Csm1 Palm Pocket of Type III-A CRISPR-Cas Csm Complex and Its Release Path. Mol.Cell 2019 75 933 0 6O75 31326272 Crystal structure of Csm1-Csm4 cassette in complex with pppApA 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Sukenick, G.,Patel, D.J. Second Messenger cA4Formation within the Composite Csm1 Palm Pocket of Type III-A CRISPR-Cas Csm Complex and Its Release Path. Mol.Cell 2019 75 933 0 6O78 31326272 Crystal structure of Csm1-Csm4 cassette in complex with pppApApA 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Sukenick, G.,Patel, D.J. Second Messenger cA4Formation within the Composite Csm1 Palm Pocket of Type III-A CRISPR-Cas Csm Complex and Its Release Path. Mol.Cell 2019 75 933 0 6O79 31326272 Crystal structure of Csm1-Csm4 cassette in complex with cA3 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Sukenick, G.,Patel, D.J. Second Messenger cA4Formation within the Composite Csm1 Palm Pocket of Type III-A CRISPR-Cas Csm Complex and Its Release Path. Mol.Cell 2019 75 933 0 6O7D 31326272 Crystal structure of Csm1-Csm4 cassette in complex with one ATP 2019-03-07 2019-07-31 Jia, N.,Jones, R.,Sukenick, G.,Patel, D.J. Second Messenger cA4Formation within the Composite Csm1 Palm Pocket of Type III-A CRISPR-Cas Csm Complex and Its Release Path. Mol.Cell 2019 75 933 0 6OV0 31326273 Crystal structure of Csm6 in complex with A4>p by soaking A4>p into Csm6 2019-05-06 2019-07-31 Jia, N.,Jones, R.,Yang, G.,Ouerfelli, O.,Patel, D.J. CRISPR-Cas III-A Csm6 CARF Domain Is a Ring Nuclease Triggering Stepwise cA4Cleavage with ApA>p Formation Terminating RNase Activity. Mol.Cell 2019 75 944 0 6NJV 31400118 C-terminal region of the Xanthomonas campestris pv. campestris OLD protein phased with iodine 2019-01-04 2019-08-07 Schiltz, C.J.,Lee, A.,Partlow, E.A.,Hosford, C.J.,Chappie, J.S. Structural characterization of Class 2 OLD family nucleases supports a two-metal catalysis mechanism for cleavage. Nucleic Acids Res. 2019 47 9448 9463 6NJW 31400118 C-terminal region of the Xanthomonas campestris pv. campestris OLD protein phased with platinum 2019-01-04 2019-08-07 Schiltz, C.J.,Lee, A.,Partlow, E.A.,Hosford, C.J.,Chappie, J.S. Structural characterization of Class 2 OLD family nucleases supports a two-metal catalysis mechanism for cleavage. Nucleic Acids Res. 2019 47 9448 9463 6NJX 31400118 C-terminal region of the Xanthomonas campestris pv. campestris OLD protein phased with mercury 2019-01-04 2019-08-07 Schiltz, C.J.,Lee, A.,Partlow, E.A.,Hosford, C.J.,Chappie, J.S. Structural characterization of Class 2 OLD family nucleases supports a two-metal catalysis mechanism for cleavage. Nucleic Acids Res. 2019 47 9448 9463 6OP8 31397327 S. pombe Ubc7/U7BR complex 2019-04-24 2019-08-07 Hann, Z.S.,Metzger, M.B.,Weissman, A.M.,Lima, C.D. Crystal structure of the Schizosaccharomyces pombe U7BR E2-binding region in complex with Ubc7. Acta Crystallogr.,Sect.F 2019 75 552 560 6NDT 31406373 Dehydroalanine intermediate of the FlgE D2 domain 2018-12-14 2019-08-14 Lynch, M.J.,Miller, M.,James, M.,Zhang, S.,Zhang, K.,Li, C.,Charon, N.W.,Crane, B.R. Structure and chemistry of lysinoalanine crosslinking in the spirochaete flagella hook. Nat.Chem.Biol. 2019 15 959 965 6ECN 31415753 HIV-1 CA 1/2-hexamer-EE 2018-08-08 2019-08-21 Summers, B.J.,Digianantonio, K.M.,Smaga, S.S.,Huang, P.T.,Zhou, K.,Gerber, E.E.,Wang, W.,Xiong, Y. Modular HIV-1 Capsid Assemblies Reveal Diverse Host-Capsid Recognition Mechanisms. Cell Host Microbe 2019 26 203 0 6JXM 31396619 Crystal Structure of phi29 pRNA domain II 2019-04-24 2019-08-21 Cai, R.,Price, I.R.,Ding, F.,Wu, F.,Chen, T.,Zhang, Y.,Liu, G.,Jardine, P.J.,Lu, C.,Ke, A. ATP/ADP modulates gp16-pRNA conformational change in the Phi29 DNA packaging motor. Nucleic Acids Res. 2019 47 9818 9828 6JXM 31396619 Crystal Structure of phi29 pRNA domain II 2019-04-24 2019-08-21 Cai, R.,Price, I.R.,Ding, F.,Wu, F.,Chen, T.,Zhang, Y.,Liu, G.,Jardine, P.J.,Lu, C.,Ke, A. ATP/ADP modulates gp16-pRNA conformational change in the Phi29 DNA packaging motor. Nucleic Acids Res. 2019 47 9818 9828 6NY6 31501867 Structure of dimeric Escherichia coli toxin YoeB bound to the Thermus thermophilus 30S ribosome 2019-02-11 2019-08-21 Pavelich, I.J.,Maehigashi, T.,Hoffer, E.D.,Ruangprasert, A.,Miles, S.J.,Dunham, C.M. Monomeric YoeB toxin retains RNase activity but adopts an obligate dimeric form for thermal stability. Nucleic Acids Res. 2019 47 10400 10413 6OTR 31501867 Dimeric E.coli YoeB bound to Thermus thermophilus 70S post-cleavage (AAU) 2019-05-03 2019-08-21 Pavelich, I.J.,Maehigashi, T.,Hoffer, E.D.,Ruangprasert, A.,Miles, S.J.,Dunham, C.M. Monomeric YoeB toxin retains RNase activity but adopts an obligate dimeric form for thermal stability. Nucleic Acids Res. 2019 47 10400 10413 6OXA 31501867 Dimeric E.coli YoeB bound to Thermus thermophilus 70S pre-cleavage (AAU) 2019-05-13 2019-08-21 Pavelich, I.J.,Maehigashi, T.,Hoffer, E.D.,Ruangprasert, A.,Miles, S.J.,Dunham, C.M. Monomeric YoeB toxin retains RNase activity but adopts an obligate dimeric form for thermal stability. Nucleic Acids Res. 2019 47 10400 10413 6OXI 31501867 Dimeric E.coli YoeB bound to Thermus thermophilus 70S post-cleavage (UAA) 2019-05-13 2019-08-21 Pavelich, I.J.,Maehigashi, T.,Hoffer, E.D.,Ruangprasert, A.,Miles, S.J.,Dunham, C.M. Monomeric YoeB toxin retains RNase activity but adopts an obligate dimeric form for thermal stability. Nucleic Acids Res. 2019 47 10400 10413 6OBH 31415753 Structure of HIV-1 CA 1/2-hexamer 2019-03-20 2019-08-28 Summers, B.J.,Digianantonio, K.M.,Smaga, S.S.,Huang, P.T.,Zhou, K.,Gerber, E.E.,Wang, W.,Xiong, Y. Modular HIV-1 Capsid Assemblies Reveal Diverse Host-Capsid Recognition Mechanisms. Cell Host Microbe 2019 26 203 0 6M84 31744859 Crystal structure of cKir2.2 force open mutant in complex with PI(4,5)P2 2018-08-21 2019-09-04 Zangerl-Plessl, E.M.,Lee, S.J.,Maksaev, G.,Bernsteiner, H.,Ren, F.,Yuan, P.,Stary-Weinzinger, A.,Nichols, C.G. Atomistic basis of opening and conduction in mammalian inward rectifier potassium (Kir2.2) channels. J.Gen.Physiol. 2020 152 0 0 6M85 31744859 Crystal Structure of Inward Rectifier Kir2.2 in a different salt condition 2018-08-21 2019-09-04 Zangerl-Plessl, E.M.,Lee, S.J.,Maksaev, G.,Bernsteiner, H.,Ren, F.,Yuan, P.,Stary-Weinzinger, A.,Nichols, C.G. Atomistic basis of opening and conduction in mammalian inward rectifier potassium (Kir2.2) channels. J.Gen.Physiol. 2020 152 0 0 6M86 Crystal Structure of Inward Rectifier Kir2.2 Force Open Mutant 2018-08-21 2019-09-04 Lee, S.-J.,Nichols, C.G. Potassium conduction through an eukarytoic inwardly rectifying potassium channel To be published 0 0 0 0 6MEQ 31431536 PcdhgB3 EC1-4 in 50 mM HEPES 2018-09-06 2019-09-04 Nicoludis, J.M.,Green, A.G.,Walujkar, S.,May, E.J.,Sotomayor, M.,Marks, D.S.,Gaudet, R. Interaction specificity of clustered protocadherins inferred from sequence covariation and structural analysis. Proc.Natl.Acad.Sci.USA 2019 116 17825 17830 6MER 31431536 PcdhgB3 EC1-4 in 50 mM HEPES 2018-09-06 2019-09-04 Nicoludis, J.M.,Green, A.G.,Walujkar, S.,May, E.J.,Sotomayor, M.,Marks, D.S.,Gaudet, R. Interaction specificity of clustered protocadherins inferred from sequence covariation and structural analysis. Proc.Natl.Acad.Sci.USA 2019 116 17825 17830 6PU0 31484780 Pigeon Cryptochrome4 bound to flavin adenine dinucleotide 2019-07-16 2019-09-04 Zoltowski, B.D.,Chelliah, Y.,Wickramaratne, A.,Jarocha, L.,Karki, N.,Xu, W.,Mouritsen, H.,Hore, P.J.,Hibbs, R.E.,Green, C.B.,Takahashi, J.S. Chemical and structural analysis of a photoactive vertebrate cryptochrome from pigeon. Proc.Natl.Acad.Sci.USA 2019 116 19449 19457 6HH2 31552791 Rab29 small GTPase bound to GDP 2018-08-24 2019-09-11 McGrath, E.,Waschbusch, D.,Baker, B.M.,Khan, A.R. LRRK2 binds to the Rab32 subfamily in a GTP-dependent mannerviaits armadillo domain. Small GTPases 2019 0 1 14 6KEA 31484720 crystal structure of MBP-tagged REV7-IpaB complex 2019-07-04 2019-09-11 Wang, X.,Pernicone, N.,Pertz, L.,Hua, D.,Zhang, T.,Listovsky, T.,Xie, W. REV7 has a dynamic adaptor region to accommodate small GTPase RAN/ShigellaIpaB ligands, and its activity is regulated by the RanGTP/GDP switch. J.Biol.Chem. 2019 294 15733 15742 6MFO 32963095 Crystal Structure of Human Protocadherin-15 EC1-3 G16D N369D Q370N 2018-09-11 2019-09-18 Choudhary, D.,Narui, Y.,Neel, B.L.,Wimalasena, L.N.,Klanseck, C.F.,De-la-Torre, P.,Chen, C.,Araya-Secchi, R.,Tamilselvan, E.,Sotomayor, M. Structural determinants of protocadherin-15 mechanics and function in hearing and balance perception. Proc.Natl.Acad.Sci.USA 2020 0 0 0 6MNA 31471317 Crystal structure of LpqN involved in cell envelope biogenesis of Mycobacterium tuberculosis 2018-10-01 2019-09-18 Melly, G.C.,Stokas, H.,Dunaj, J.L.,Hsu, F.F.,Rajavel, M.,Su, C.C.,Yu, E.W.,Purdy, G.E. Structural and functional evidence that lipoprotein LpqN supports cell envelope biogenesis inMycobacterium tuberculosis. J.Biol.Chem. 2019 294 15711 15723 6PHZ 31436969 Crystal structure of Marinobacter subterrani acetylpolyamine amidohydrolase (msAPAH) complexed with 7-[(3-aminopropyl)amino]-1,1,1-trifluoroheptan-2-one 2019-06-25 2019-09-18 Osko, J.D.,Roose, B.W.,Shinsky, S.A.,Christianson, D.W. Structure and Function of the Acetylpolyamine Amidohydrolase from the Deep Earth HalophileMarinobacter subterrani. Biochemistry 2019 58 3755 3766 6PI1 31436969 Crystal structure of Marinobacter subterrani acetylpolyamine amidohydrolase (msAPAH) complexed with 4-(dimethylamino)-N-[7-hydroxyamino)-7-oxoheptyl]benzamide 2019-06-25 2019-09-18 Osko, J.D.,Roose, B.W.,Shinsky, S.A.,Christianson, D.W. Structure and Function of the Acetylpolyamine Amidohydrolase from the Deep Earth HalophileMarinobacter subterrani. Biochemistry 2019 58 3755 3766 6PID 31436969 Crystal structure of Marinobacter subterrani acetylpolyamine amidohydrolase (msAPAH) complexed with 8-amino-N-hydroxyoctanamide 2019-06-26 2019-09-18 Osko, J.D.,Roose, B.W.,Shinsky, S.A.,Christianson, D.W. Structure and Function of the Acetylpolyamine Amidohydrolase from the Deep Earth HalophileMarinobacter subterrani. Biochemistry 2019 58 3755 3766 6NRE 31525203 Monomeric Lipocalin Can F 6 2019-01-23 2019-09-25 Clayton, G.M.,White, J.,Lee, S.,Kappler, J.W.,Chan, S.K. Structural characteristics of lipocalin allergens: Crystal structure of the immunogenic dog allergen Can f 6. Plos One 2019 14 0 0 6P72 31548390 Crystal Structure of the Cedar henipavirus Attachment G Glycoprotein global domain 2019-06-04 2019-09-25 Laing, E.D.,Navaratnarajah, C.K.,Cheliout Da Silva, S.,Petzing, S.R.,Xu, Y.,Sterling, S.L.,Marsh, G.A.,Wang, L.F.,Amaya, M.,Nikolov, D.B.,Cattaneo, R.,Broder, C.C.,Xu, K. Structural and functional analyses reveal promiscuous and species specific use of ephrin receptors by Cedar virus. Proc.Natl.Acad.Sci.USA 2019 116 20707 20715 6P7S 31548390 Crystal Structure of the Cedar henipavirus Attachment G Glycoprotein globular domain in complex with the receptor ephrin-B1 2019-06-06 2019-09-25 Laing, E.D.,Navaratnarajah, C.K.,Cheliout Da Silva, S.,Petzing, S.R.,Xu, Y.,Sterling, S.L.,Marsh, G.A.,Wang, L.F.,Amaya, M.,Nikolov, D.B.,Cattaneo, R.,Broder, C.C.,Xu, K. Structural and functional analyses reveal promiscuous and species specific use of ephrin receptors by Cedar virus. Proc.Natl.Acad.Sci.USA 2019 116 20707 20715 6P7Y 31548390 Crystal Structure of the Cedar henipavirus Attachment G Glycoprotein globular domain in complex with the receptor ephrin-B2 2019-06-06 2019-09-25 Laing, E.D.,Navaratnarajah, C.K.,Cheliout Da Silva, S.,Petzing, S.R.,Xu, Y.,Sterling, S.L.,Marsh, G.A.,Wang, L.F.,Amaya, M.,Nikolov, D.B.,Cattaneo, R.,Broder, C.C.,Xu, K. Structural and functional analyses reveal promiscuous and species specific use of ephrin receptors by Cedar virus. Proc.Natl.Acad.Sci.USA 2019 116 20707 20715 6N2V 31541094 Manganese riboswitch from Xanthmonas oryzae bound to Mn(II) 2018-11-14 2019-10-02 Suddala, K.C.,Price, I.R.,Dandpat, S.S.,Janecek, M.,Kuhrova, P.,Sponer, J.,Banas, P.,Ke, A.,Walter, N.G. Local-to-global signal transduction at the core of a Mn2+sensing riboswitch. Nat Commun 2019 10 4304 4304 6PFB 31536894 Crystal structure of TS-DHFR from Cryptosporidium hominis in complex with NADPH, FdUMP and 3-(2-(4-((2-amino-4-oxo-4,7-dihydro-3H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl)benzamido)phenyl)propanoic acid. 2019-06-21 2019-10-02 Czyzyk, D.J.,Valhondo, M.,Deiana, L.,Tirado-Rives, J.,Jorgensen, W.L.,Anderson, K.S. Structure activity relationship towards design of cryptosporidium specific thymidylate synthase inhibitors. Eur.J.Med.Chem. 2019 183 111673 111673 6PFE 31536894 Crystal structure of TS-DHFR from Cryptosporidium hominis in complex with NADPH, FdUMP and 2-(4-((2-amino-4-oxo-4,7-dihydro-3H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl)benzamido)-4-methoxybenzoic acid. 2019-06-21 2019-10-02 Czyzyk, D.J.,Valhondo, M.,Deiana, L.,Tirado-Rives, J.,Jorgensen, W.L.,Anderson, K.S. Structure activity relationship towards design of cryptosporidium specific thymidylate synthase inhibitors. Eur.J.Med.Chem. 2019 183 111673 111673 6PFI 31536894 Crystal structure of TS-DHFR from Cryptosporidium hominis in complex with NADPH, FdUMP and 3-(4-((2-amino-4-oxo-4,7-dihydro-3H-pyrrolo[2,3-d]pyrimidin-5-yl)methyl)benzamido)-4-(carboxymethyl)benzoic acid. 2019-06-21 2019-10-02 Czyzyk, D.J.,Valhondo, M.,Deiana, L.,Tirado-Rives, J.,Jorgensen, W.L.,Anderson, K.S. Structure activity relationship towards design of cryptosporidium specific thymidylate synthase inhibitors. Eur.J.Med.Chem. 2019 183 111673 111673 6PNP 31566781 Crystal structure of the splice insert-free neurexin-1 LNS2 domain in complex with neurexophilin-1 2019-07-02 2019-10-09 Wilson, S.C.,White, K.I.,Zhou, Q.,Pfuetzner, R.A.,Choi, U.B.,Sudhof, T.C.,Brunger, A.T. Structures of neurexophilin-neurexin complexes reveal a regulatory mechanism of alternative splicing. Embo J. 2019 38 0 0 6PP9 31581174 Crystal structure of BRAF:MEK1 complex 2019-07-05 2019-10-09 Park, E.,Rawson, S.,Li, K.,Kim, B.W.,Ficarro, S.B.,Pino, G.G.,Sharif, H.,Marto, J.A.,Jeon, H.,Eck, M.J. Architecture of autoinhibited and active BRAF-MEK1-14-3-3 complexes. Nature 2019 575 545 550 6TZQ 31724696 A DNA G-quadruplex/i-motif hybrid 2019-08-13 2019-10-16 Chu, B.,Zhang, D.,Paukstelis, P.J. A DNA G-quadruplex/i-motif hybrid. Nucleic Acids Res. 2019 47 11921 11930 6TZR 31724696 A DNA G-quadruplex/i-motif hybrid 2019-08-13 2019-10-16 Chu, B.,Zhang, D.,Paukstelis, P.J. A DNA G-quadruplex/i-motif hybrid. Nucleic Acids Res. 2019 47 11921 11930 6NEP Structure of human PACRG-MEIG1 complex 2018-12-18 2019-10-23 Khan, N.,Pelletier, D.,Veyron, S.,Croteau, N.,Ichikawa, M.,Black, C.,Khalifa, A.A.Z.,Chaaban, S.,Kurinov, I.,Brouhard, G.,Bui, K.H.,Trempe, J.F. Crystal structure of human PACRG in complex with MEIG1 Biorxiv 2019 0 0 0 6ORR 31589440 Co-crystal structure of human NicotinamideN-Methyltransferase (NNMT) in complex with High-Affinity Alkynyl Bisubstrate Inhibitor NS1 2019-04-30 2019-10-23 Policarpo, R.L.,Decultot, L.,May, E.,Kuzmic, P.,Carlson, S.,Huang, D.,Chu, V.,Wright, B.A.,Dhakshinamoorthy, S.,Kannt, A.,Rani, S.,Dittakavi, S.,Panarese, J.D.,Gaudet, R.,Shair, M.D. High-Affinity Alkynyl Bisubstrate Inhibitors of NicotinamideN-Methyltransferase (NNMT). J.Med.Chem. 2019 62 9837 9873 6P41 31603693 Yeast cytochrome c peroxidase (W191Y:L232E) in complex with iso-1 cytochrome c 2019-05-25 2019-10-23 Yee, E.F.,Dzikovski, B.,Crane, B.R. Tuning Radical Relay Residues by Proton Management Rescues Protein Electron Hopping. J.Am.Chem.Soc. 2019 141 17571 17587 6P42 31603693 Yeast cytochrome c peroxidase (W191Y:L232H) in complex with iso-1 cytochrome c 2019-05-25 2019-10-23 Yee, E.F.,Dzikovski, B.,Crane, B.R. Tuning Radical Relay Residues by Proton Management Rescues Protein Electron Hopping. J.Am.Chem.Soc. 2019 141 17571 17587 6PAK 31615894 Insight into subtilisin E-S7 cleavage pattern based on crystal structure and hydrolysates peptide analysis 2019-06-11 2019-10-23 Tang, H.,Shi, K.,Shi, C.,Aihara, H.,Zhang, J.,Du, G. Enhancing subtilisin thermostability through a modified normalized B-factor analysis and loop-grafting strategy. J.Biol.Chem. 2019 294 18398 18407 6IVL 31263784 Crystal structure of a membrane protein L259A 2018-12-04 2019-11-06 Ji, C.,Kittredge, A.,Hopiavuori, A.,Ward, N.,Chen, S.,Fukuda, Y.,Zhang, Y.,Yang, T. Dual Ca2+-dependent gates in human Bestrophin1 underlie disease-causing mechanisms of gain-of-function mutations. Commun Biol 2019 2 240 240 6IVM 31263784 Crystal structure of a membrane protein P143A 2018-12-04 2019-11-06 Ji, C.,Kittredge, A.,Hopiavuori, A.,Ward, N.,Chen, S.,Fukuda, Y.,Zhang, Y.,Yang, T. Dual Ca2+-dependent gates in human Bestrophin1 underlie disease-causing mechanisms of gain-of-function mutations. Commun Biol 2019 2 240 240 6IVP 31263784 Crystal structure of a membrane protein P262A 2018-12-04 2019-11-06 Ji, C.,Kittredge, A.,Hopiavuori, A.,Ward, N.,Chen, S.,Fukuda, Y.,Zhang, Y.,Yang, T. Dual Ca2+-dependent gates in human Bestrophin1 underlie disease-causing mechanisms of gain-of-function mutations. Commun Biol 2019 2 240 240 6IVR 31263784 Crystal structure of a membrane protein W16A 2018-12-04 2019-11-06 Ji, C.,Kittredge, A.,Hopiavuori, A.,Ward, N.,Chen, S.,Fukuda, Y.,Zhang, Y.,Yang, T. Dual Ca2+-dependent gates in human Bestrophin1 underlie disease-causing mechanisms of gain-of-function mutations. Commun Biol 2019 2 240 240 6TZO 31722405 Crystal Structure of Fungal RNA Kinase 2019-08-12 2019-11-06 Banerjee, A.,Goldgur, Y.,Schwer, B.,Shuman, S. Atomic structures of the RNA end-healing 5'-OH kinase and 2',3'-cyclic phosphodiesterase domains of fungal tRNA ligase: conformational switches in the kinase upon binding of the GTP phosphate donor. Nucleic Acids Res. 2019 47 11826 11838 6TZX 31722405 Crystal Structure of Fungal RNA Kinase 2019-08-13 2019-11-06 Banerjee, A.,Goldgur, Y.,Schwer, B.,Shuman, S. Atomic structures of the RNA end-healing 5'-OH kinase and 2',3'-cyclic phosphodiesterase domains of fungal tRNA ligase: conformational switches in the kinase upon binding of the GTP phosphate donor. Nucleic Acids Res. 2019 47 11826 11838 6U05 31722405 Crystal Structure of Fungal RNA Kinase 2019-08-13 2019-11-06 Banerjee, A.,Goldgur, Y.,Schwer, B.,Shuman, S. Atomic structures of the RNA end-healing 5'-OH kinase and 2',3'-cyclic phosphodiesterase domains of fungal tRNA ligase: conformational switches in the kinase upon binding of the GTP phosphate donor. Nucleic Acids Res. 2019 47 11826 11838 6U53 31626803 Anti-Zaire ebolavirus Nucleoprotein Single Domain Antibody Zaire C (ZC) 2019-08-26 2019-11-06 Sherwood, L.J.,Taylor, A.B.,Hart, P.J.,Hayhurst, A. Paratope Duality and Gullying are Among the Atypical Recognition Mechanisms Used by a Trio of Nanobodies to Differentiate Ebolavirus Nucleoproteins. J.Mol.Biol. 2019 431 4848 4867 6IVW 31263784 Crystal structure of a bacterial Bestrophin homolog from Klebsiella pneumoniae with a mutation D269A 2018-12-04 2019-11-13 Ji, C.,Kittredge, A.,Hopiavuori, A.,Ward, N.,Chen, S.,Fukuda, Y.,Zhang, Y.,Yang, T. Dual Ca2+-dependent gates in human Bestrophin1 underlie disease-causing mechanisms of gain-of-function mutations. Commun Biol 2019 2 240 240 6JLF 31263784 Crystal structure of a bacterial Bestrophin homolog from Klebsiella pneumoniae D179A mutation - HR 2019-03-05 2019-11-13 Ji, C.,Kittredge, A.,Hopiavuori, A.,Ward, N.,Chen, S.,Fukuda, Y.,Zhang, Y.,Yang, T. Dual Ca2+-dependent gates in human Bestrophin1 underlie disease-causing mechanisms of gain-of-function mutations. Commun Biol 2019 2 240 240 6N0S 32652237 N-terminal domain of Staphylothermus marinus McrB 2018-11-07 2019-11-13 Hosford, C.J.,Adams, M.C.,Niu, Y.,Chappie, J.S. The N-terminal domain of Staphylothermus marinus McrB shares structural homology with PUA-like RNA binding proteins. J.Struct.Biol. 2020 211 107572 107572 6N1G 32695023 Crystal structure of Aquaglyceroporin AQP7 2018-11-08 2019-11-13 Moss, F.J.,Mahinthichaichan, P.,Lodowski, D.T.,Kowatz, T.,Tajkhorshid, E.,Engel, A.,Boron, W.F.,Vahedi-Faridi, A. Aquaporin-7: A Dynamic Aquaglyceroporin With Greater Water and Glycerol Permeability Than Its Bacterial Homolog GlpF. Front Physiol 2020 11 728 728 6N22 32963095 Crystal structure of mouse Protocadherin-15 EC1-2 BAP 2018-11-12 2019-11-13 Choudhary, D.,Narui, Y.,Neel, B.L.,Wimalasena, L.N.,Klanseck, C.F.,De-la-Torre, P.,Chen, C.,Araya-Secchi, R.,Tamilselvan, E.,Sotomayor, M. Structural determinants of protocadherin-15 mechanics and function in hearing and balance perception. Proc.Natl.Acad.Sci.USA 2020 117 24837 24848 6Q0R 31686031 Structure of DDB1-DDA1-DCAF15 complex bound to E7820 and RBM39 2019-08-02 2019-11-13 Faust, T.B.,Yoon, H.,Nowak, R.P.,Donovan, K.A.,Li, Z.,Cai, Q.,Eleuteri, N.A.,Zhang, T.,Gray, N.S.,Fischer, E.S. Structural complementarity facilitates E7820-mediated degradation of RBM39 by DCAF15. Nat.Chem.Biol. 2020 16 7 14 6Q0V 31686031 Structure of DDB1-DDA1-DCAF15 complex bound to tasisulam and RBM39 2019-08-02 2019-11-13 Faust, T.B.,Yoon, H.,Nowak, R.P.,Donovan, K.A.,Li, Z.,Cai, Q.,Eleuteri, N.A.,Zhang, T.,Gray, N.S.,Fischer, E.S. Structural complementarity facilitates E7820-mediated degradation of RBM39 by DCAF15. Nat.Chem.Biol. 2020 16 7 14 6Q0W 31686031 Structure of DDB1-DDA1-DCAF15 complex bound to Indisulam and RBM39 2019-08-02 2019-11-13 Faust, T.B.,Yoon, H.,Nowak, R.P.,Donovan, K.A.,Li, Z.,Cai, Q.,Eleuteri, N.A.,Zhang, T.,Gray, N.S.,Fischer, E.S. Structural complementarity facilitates E7820-mediated degradation of RBM39 by DCAF15. Nat.Chem.Biol. 2020 16 7 14 6UUI 32226330 Crystal structure of the heterocomplex between coil 2B domains of wild-type keratin 1 (KRT1) and keratin 10 (KRT10) containing mutation Cys401Ala 2019-10-30 2019-11-13 Lomakin, I.B.,Hinbest, A.J.,Ho, M.,Eldirany, S.A.,Bunick, C.G. Crystal Structure of Keratin 1/10(C401A) 2B Heterodimer Demonstrates a Proclivity for the C-Terminus of Helix 2B to Form Higher Order Molecular Contacts. Yale J Biol Med 2020 93 3 17 6MG0 31699907 Crystal structure of a 5-domain construct of LgrA in the thiolation state 2018-09-12 2019-11-20 Reimer, J.M.,Eivaskhani, M.,Harb, I.,Guarne, A.,Weigt, M.,Schmeing, T.M. Structures of a dimodular nonribosomal peptide synthetase reveal conformational flexibility. Science 2019 366 0 0 6PLK 31757867 Crystal structure of ZIKV-116 Fab in complex with ZIKV envelope DIII 2019-07-01 2019-11-20 Zhao, H.,Xu, L.,Bombardi, R.,Nargi, R.,Deng, Z.,Errico, J.M.,Nelson, C.A.,Dowd, K.A.,Pierson, T.C.,Crowe, J.E.,Diamond, M.S.,Fremont, D.H. Mechanism of differential Zika and dengue virus neutralization by a public antibody lineage targeting the DIII lateral ridge. J.Exp.Med. 2020 217 0 0 6Q02 31704958 Polymerase Eta-catalyzed insertion of the mismatched A opposite template cytarabine (AraC) residue 2019-08-01 2019-11-20 Rechkoblit, O.,Johnson, R.E.,Buku, A.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural insights into mutagenicity of anticancer nucleoside analog cytarabine during replication by DNA polymerase eta. Sci Rep 2019 9 16400 16400 6UFG 31740853 Co-crystal structure of M. tuberculosis ileS T-box in complex with tRNA-3'-OH 2019-09-24 2019-11-20 Battaglia, R.A.,Grigg, J.C.,Ke, A. Structural basis for tRNA decoding and aminoacylation sensing by T-box riboregulators. Nat.Struct.Mol.Biol. 2019 26 1106 1113 6N5K Structure of Human pir-miRNA-449c Apical Loop and One-base-pair Fused to the YdaO Riboswitch Scaffold 2018-11-22 2019-11-27 Shoffner, G.M.,Peng, Z.,Guo, F. Three-dimensional structures of pri-miRNA apical junctions and loops revealed by scaffold-directed crystallography To Be Published 0 0 0 0 6N5N Structure of Human pir-miRNA-208a Apical Loop and One-base-pair Fused to the YdaO Riboswitch Scaffold 2018-11-22 2019-11-27 Shoffner, G.M.,Peng, Z.,Guo, F. Three-dimensional structures of pri-miRNA apical junctions and loops revealed by scaffold-directed crystallography To Be Published 0 0 0 0 6N5O Structure of Human pir-miRNA-202 Apical Loop and One-base-pair Fused to the YdaO Riboswitch Scaffold 2018-11-22 2019-11-27 Shoffner, G.M.,Peng, Z.,Guo, F. Three-dimensional structures of pri-miRNA apical junctions and loops revealed by scaffold-directed crystallography To Be Published 0 0 0 0 6N5S Structure of Human pir-miRNA-320b-2 Apical Loop and One-base-pair Stem Fused to the YdaO Riboswitch Scaffold 2018-11-22 2019-11-27 Shoffner, G.M.,Peng, Z.,Guo, F. Three-dimensional structures of pri-miRNA apical junctions and loops revealed by scaffold-directed crystallography To Be Published 0 0 0 0 6PD4 23144952 Crystal Structure of Hendra Virus Attachment G Glycoprotein 2019-06-18 2019-11-27 Xu, K.,Chan, Y.P.,Rajashankar, K.R.,Khetawat, D.,Yan, L.,Kolev, M.V.,Broder, C.C.,Nikolov, D.B. New insights into the Hendra virus attachment and entry process from structures of the virus G glycoprotein and its complex with Ephrin-B2. PLoS ONE 2012 7 0 0 6PDL 23144952 Crystal Structure of Hendra Virus Attachment G Glycoprotein in Complex with Receptor Ephrin-B2 2019-06-19 2019-11-27 Xu, K.,Chan, Y.P.,Rajashankar, K.R.,Khetawat, D.,Yan, L.,Kolev, M.V.,Broder, C.C.,Nikolov, D.B. New insights into the Hendra virus attachment and entry process from structures of the virus G glycoprotein and its complex with Ephrin-B2. PLoS ONE 2012 7 0 0 6UO1 31672910 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA (containing pseudouridine at the first position of the codon) and deacylated A-, P-, and E-site tRNAs at 2.95A resolution 2019-10-14 2019-11-27 Eyler, D.E.,Franco, M.K.,Batool, Z.,Wu, M.Z.,Dubuke, M.L.,Dobosz-Bartoszek, M.,Jones, J.D.,Polikanov, Y.S.,Roy, B.,Koutmou, K.S. Pseudouridinylation of mRNA coding sequences alters translation. Proc.Natl.Acad.Sci.USA 2019 116 23068 23074 6JX6 31732561 Tetrameric form of Smac 2019-04-22 2019-12-04 Singh, S.,Ng, J.,Nayak, D.,Sivaraman, J. Structural insights into a HECT-type E3 ligase AREL1 and its ubiquitination activitiesin vitro. J.Biol.Chem. 2019 294 19934 19949 6U8K 31765566 Crystal structure of hepatitis C virus IRES junction IIIabc in complex with Fab HCV3 2019-09-05 2019-12-04 Koirala, D.,Lewicka, A.,Koldobskaya, Y.,Huang, H.,Piccirilli, J.A. Synthetic Antibody Binding to a Preorganized RNA Domain of Hepatitis C Virus Internal Ribosome Entry Site Inhibits Translation. Acs Chem.Biol. 2020 15 205 216 6UNZ 31743022 Crystal structure of cytosolic fumarate hydratase from Leishmania major 2019-10-14 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UO0 31743022 Crystal structure of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate 2019-10-14 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UO3 31755702 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 1 (CD1) complexed with AR-42 2019-10-14 2019-12-04 Osko, J.D.,Christianson, D.W. Structural Basis of Catalysis and Inhibition of HDAC6 CD1, the Enigmatic Catalytic Domain of Histone Deacetylase 6. Biochemistry 2019 58 4912 4924 6UO4 31755702 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 1 (CD1) Y363F mutant complexed with Trichostatin A 2019-10-14 2019-12-04 Osko, J.D.,Christianson, D.W. Structural Basis of Catalysis and Inhibition of HDAC6 CD1, the Enigmatic Catalytic Domain of Histone Deacetylase 6. Biochemistry 2019 58 4912 4924 6UO5 31755702 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 1 (CD1) Y363F mutant complexed with AR-42 2019-10-14 2019-12-04 Osko, J.D.,Christianson, D.W. Structural Basis of Catalysis and Inhibition of HDAC6 CD1, the Enigmatic Catalytic Domain of Histone Deacetylase 6. Biochemistry 2019 58 4912 4924 6UOI 31743022 Crystal structure of cytosolic fumarate hydratase from Leishmania major in a complex with malonate 2019-10-15 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UOJ 31743022 Crystal structure of cytosolic fumarate hydratase from Leishmania major in a complex with succinate 2019-10-15 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UP9 31743022 Crystal structure of T467A variant of cytosolic fumarate hydratase from Leishmania major in a complex with malonate 2019-10-16 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UPM 31743022 Crystal structure of T467A variant of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate 2019-10-17 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UPO 31743022 Crystal structure of H334A variant of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate 2019-10-18 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UQ8 31743022 Crystal structure of R421A variant of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate and malonate 2019-10-18 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UQ9 31743022 Crystal structure of R421A variant of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate 2019-10-18 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UQB 31743022 Crystal structure of R471A variant of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate and malonate 2019-10-18 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UQL 31743022 Crystal structure of R471A variant of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate 2019-10-21 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UQM 31743022 Crystal structure of R173A variant of cytosolic fumarate hydratase from Leishmania major in a complex with S-malate 2019-10-21 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6UQN 31743022 Crystal structure of R173A variant of cytosolic fumarate hydratase from Leishmania major in a complex with fumarate and S-malate 2019-10-21 2019-12-04 Feliciano, P.R.,Drennan, C.L. Structural and Biochemical Investigations of the [4Fe-4S] Cluster-Containing Fumarate Hydratase fromLeishmania major. Biochemistry 2019 58 5011 5021 6Q1M 31797816 Crystal structure of the wheat dwarf virus Rep domain 2019-08-05 2019-12-11 Everett, B.A.,Litzau, L.A.,Tompkins, K.,Shi, K.,Nelson, A.,Aihara, H.,Evans Iii, R.L.,Gordon, W.R. Crystal structure of the Wheat dwarf virus Rep domain. Acta Crystallogr.,Sect.F 2019 75 744 749 6P0F 31822563 N-terminal domain of Thermococcus Gammatolerans McrB 2019-05-17 2019-12-18 Hosford, C.J.,Bui, A.Q.,Chappie, J.S. The structure of theThermococcus gammatoleransMcrB N-terminal domain reveals a new mode of substrate recognition and specificity among McrB homologs. J.Biol.Chem. 2020 295 743 756 6UF1 31804735 Pistol ribozyme transition-state analog vanadate 2019-09-23 2019-12-18 Teplova, M.,Falschlunger, C.,Krasheninina, O.,Egger, M.,Ren, A.,Patel, D.J.,Micura, R. Crucial Roles of Two Hydrated Mg2+Ions in Reaction Catalysis of the Pistol Ribozyme. Angew.Chem.Int.Ed.Engl. 2020 59 2837 2843 6UFJ 31804735 Pistol ribozyme product crystal structure 2019-09-24 2019-12-18 Teplova, M.,Falschlunger, C.,Krasheninina, O.,Egger, M.,Ren, A.,Patel, D.J.,Micura, R. Crucial Roles of Two Hydrated Mg2+Ions in Reaction Catalysis of the Pistol Ribozyme. Angew.Chem.Int.Ed.Engl. 2020 59 2837 2843 6UFK 31804735 Pistol ribozyme product crystal soaked in Mn2+ 2019-09-24 2019-12-18 Teplova, M.,Falschlunger, C.,Krasheninina, O.,Egger, M.,Ren, A.,Patel, D.J.,Micura, R. Crucial Roles of Two Hydrated Mg2+Ions in Reaction Catalysis of the Pistol Ribozyme. Angew.Chem.Int.Ed.Engl. 2020 59 2837 2843 6P82 31932165 Structure of P. aeruginosa ATCC27853 CdnD, Apo form 1 2019-06-06 2019-12-25 Ye, Q.,Lau, R.K.,Mathews, I.T.,Birkholz, E.A.,Watrous, J.D.,Azimi, C.S.,Pogliano, J.,Jain, M.,Corbett, K.D. HORMA Domain Proteins and a Trip13-like ATPase Regulate Bacterial cGAS-like Enzymes to Mediate Bacteriophage Immunity. Mol.Cell 2020 77 709 0 6P8O 31932165 Structure of P. aeruginosa ATCC27853 HORMA2-deltaC 2019-06-07 2019-12-25 Ye, Q.,Lau, R.K.,Mathews, I.T.,Birkholz, E.A.,Watrous, J.D.,Azimi, C.S.,Pogliano, J.,Jain, M.,Corbett, K.D. HORMA Domain Proteins and a Trip13-like ATPase Regulate Bacterial cGAS-like Enzymes to Mediate Bacteriophage Immunity. Mol.Cell 2020 77 709 0 6P8P 31932165 Structure of P. aeruginosa ATCC27853 HORMA1 2019-06-07 2019-12-25 Ye, Q.,Lau, R.K.,Mathews, I.T.,Birkholz, E.A.,Watrous, J.D.,Azimi, C.S.,Pogliano, J.,Jain, M.,Corbett, K.D. HORMA Domain Proteins and a Trip13-like ATPase Regulate Bacterial cGAS-like Enzymes to Mediate Bacteriophage Immunity. Mol.Cell 2020 77 709 0 6P8R 31932165 Structure of P. aeruginosa ATCC27853 HORMA2 2019-06-07 2019-12-25 Ye, Q.,Lau, R.K.,Mathews, I.T.,Birkholz, E.A.,Watrous, J.D.,Azimi, C.S.,Pogliano, J.,Jain, M.,Corbett, K.D. HORMA Domain Proteins and a Trip13-like ATPase Regulate Bacterial cGAS-like Enzymes to Mediate Bacteriophage Immunity. Mol.Cell 2020 77 709 0 6P8U 31932165 Structure of P. aeruginosa ATCC27853 CdnD:HORMA2:Peptide 1 complex 2019-06-08 2019-12-25 Ye, Q.,Lau, R.K.,Mathews, I.T.,Birkholz, E.A.,Watrous, J.D.,Azimi, C.S.,Pogliano, J.,Jain, M.,Corbett, K.D. HORMA Domain Proteins and a Trip13-like ATPase Regulate Bacterial cGAS-like Enzymes to Mediate Bacteriophage Immunity. Mol.Cell 2020 77 709 0 6U7B 31932165 Structure of E. coli MS115-1 CdnC:HORMA-deltaN complex 2019-09-02 2019-12-25 Ye, Q.,Lau, R.K.,Mathews, I.T.,Birkholz, E.A.,Watrous, J.D.,Azimi, C.S.,Pogliano, J.,Jain, M.,Corbett, K.D. HORMA Domain Proteins and a Trip13-like ATPase Regulate Bacterial cGAS-like Enzymes to Mediate Bacteriophage Immunity. Mol.Cell 2020 77 709 0 6UCQ 31873307 Crystal structure of the Thermus thermophilus 70S ribosome recycling complex 2019-09-17 2019-12-25 Zhou, D.,Tanzawa, T.,Lin, J.,Gagnon, M.G. Structural basis for ribosome recycling by RRF and tRNA. Nat.Struct.Mol.Biol. 2020 27 25 32 6UCQ 31873307 Crystal structure of the Thermus thermophilus 70S ribosome recycling complex 2019-09-17 2019-12-25 Zhou, D.,Tanzawa, T.,Lin, J.,Gagnon, M.G. Structural basis for ribosome recycling by RRF and tRNA. Nat.Struct.Mol.Biol. 2020 27 25 32 6NXK 31350353 Ubiquitin binding variants 2019-02-08 2020-01-15 Watson, E.R.,Grace, C.R.R.,Zhang, W.,Miller, D.J.,Davidson, I.F.,Prabu, J.R.,Yu, S.,Bolhuis, D.L.,Kulko, E.T.,Vollrath, R.,Haselbach, D.,Stark, H.,Peters, J.M.,Brown, N.G.,Sidhu, S.S.,Schulman, B.A. Protein engineering of a ubiquitin-variant inhibitor of APC/C identifies a cryptic K48 ubiquitin chain binding site. Proc.Natl.Acad.Sci.USA 2019 116 17280 17289 6NY9 31740833 Alpha/beta hydrolase domain-containing protein 10 from mouse 2019-02-11 2020-01-22 Cao, Y.,Qiu, T.,Kathayat, R.S.,Azizi, S.A.,Thorne, A.K.,Ahn, D.,Fukata, Y.,Fukata, M.,Rice, P.A.,Dickinson, B.C. ABHD10 is an S-depalmitoylase affecting redox homeostasis through peroxiredoxin-5. Nat.Chem.Biol. 2019 15 1232 1240 6Q2P 31917549 Crystal structure of mouse viperin bound to cytidine triphosphate and S-adenosylhomocysteine 2019-08-08 2020-01-22 Fenwick, M.K.,Su, D.,Dong, M.,Lin, H.,Ealick, S.E. Structural Basis of the Substrate Selectivity of Viperin. Biochemistry 2020 59 652 662 6Q2Q 31917549 Crystal structure of mouse viperin bound to uridine triphosphate and S-adenosylhomocysteine 2019-08-08 2020-01-22 Fenwick, M.K.,Su, D.,Dong, M.,Lin, H.,Ealick, S.E. Structural Basis of the Substrate Selectivity of Viperin. Biochemistry 2020 59 652 662 6P74 32009148 OLD nuclease from Thermus Scotoductus 2019-06-04 2020-01-29 Schiltz, C.J.,Adams, M.C.,Chappie, J.S. The full-length structure of Thermus scotoductus OLD defines the ATP hydrolysis properties and catalytic mechanism of Class 1 OLD family nucleases. Nucleic Acids Res. 2020 48 2762 2776 6V0K 31978464 Crystal structure of Penicillium verruculosum copalyl diphosphate synthase (PvCPS) alpha prenyltransferase domain 2019-11-18 2020-01-29 Ronnebaum, T.A.,Gupta, K.,Christianson, D.W. Higher-order oligomerization of a chimeric alpha beta gamma bifunctional diterpene synthase with prenyltransferase and class II cyclase activities is concentration-dependent. J.Struct.Biol. 2020 210 107463 107463 6V9P 31925391 Crystal structure of the transposition protein TniQ 2019-12-14 2020-01-29 Jia, N.,Xie, W.,de la Cruz, M.J.,Eng, E.T.,Patel, D.J. Structure-function insights into the initial step of DNA integration by a CRISPR-Cas-Transposon complex. Cell Res. 2020 30 182 184 6PZR 31793776 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 2 complexed with Resminostat 2019-08-01 2020-02-05 Osko, J.D.,Porter, N.J.,Narayana Reddy, P.A.,Xiao, Y.C.,Rokka, J.,Jung, M.,Hooker, J.M.,Salvino, J.M.,Christianson, D.W. Exploring Structural Determinants of Inhibitor Affinity and Selectivity in Complexes with Histone Deacetylase 6. J.Med.Chem. 2020 63 295 308 6VCK 31960065 Crystal structure of E.coli RppH-DapF in complex with GDP, Mg2+ and F- 2019-12-21 2020-02-05 Gao, A.,Vasilyev, N.,Kaushik, A.,Duan, W.,Serganov, A. Principles of RNA and nucleotide discrimination by the RNA processing enzyme RppH. Nucleic Acids Res. 2020 48 3776 3788 6VCL 31960065 Crystal structure of E.coli RppH-DapF in complex with pppGpp, Mg2+ and F- 2019-12-21 2020-02-05 Gao, A.,Vasilyev, N.,Kaushik, A.,Duan, W.,Serganov, A. Principles of RNA and nucleotide discrimination by the RNA processing enzyme RppH. Nucleic Acids Res. 2020 48 3776 3788 6VCM 31960065 Crystal structure of E.coli RppH-DapF in complex with GTP, Mg2+ and F- 2019-12-21 2020-02-05 Gao, A.,Vasilyev, N.,Kaushik, A.,Duan, W.,Serganov, A. Principles of RNA and nucleotide discrimination by the RNA processing enzyme RppH. Nucleic Acids Res. 2020 48 3776 3788 6PIB 32041866 Structure of the Klebsiella pneumoniae LpxH-AZ1 complex 2019-06-26 2020-02-12 Cho, J.,Lee, M.,Cochrane, C.S.,Webster, C.G.,Fenton, B.A.,Zhao, J.,Hong, J.,Zhou, P. Structural basis of the UDP-diacylglucosamine pyrophosphohydrolase LpxH inhibition by sulfonyl piperazine antibiotics. Proc.Natl.Acad.Sci.USA 2020 117 4109 4116 6PJ3 32041866 Crystal structure of the Klebsiella pneumoniae LpxH/JH-LPH-33 complex 2019-06-27 2020-02-12 Cho, J.,Lee, M.,Cochrane, C.S.,Webster, C.G.,Fenton, B.A.,Zhao, J.,Hong, J.,Zhou, P. Structural basis of the UDP-diacylglucosamine pyrophosphohydrolase LpxH inhibition by sulfonyl piperazine antibiotics. Proc.Natl.Acad.Sci.USA 2020 117 4109 4116 6TYQ 32084237 Salmonella Typhi PltB Homopentamer with Neu-5NAc-9OAc-alpha-2-6-Gal-beta-1-4-GlcNAc Glycans 2019-08-09 2020-02-12 Nguyen, T.,Lee, S.,Yang, Y.A.,Ahn, C.,Sim, J.H.,Kei, T.G.,Barnard, K.N.,Yu, H.,Millano, S.K.,Chen, X.,Parrish, C.R.,Song, J. The role of 9-O-acetylated glycan receptor moieties in the typhoid toxin binding and intoxication. Plos Pathog. 2020 16 0 0 6V4K 31992706 Structure of TrkH-TrkA in complex with ADP 2019-11-27 2020-02-12 Zhang, H.,Pan, Y.,Hu, L.,Hudson, M.A.,Hofstetter, K.S.,Xu, Z.,Rong, M.,Wang, Z.,Prasad, B.V.V.,Lockless, S.W.,Chiu, W.,Zhou, M. TrkA undergoes a tetramer-to-dimer conversion to open TrkH which enables changes in membrane potential. Nat Commun 2020 11 547 547 6V4L 31992706 Structure of TrkH-TrkA in complex with ATPgammaS 2019-11-27 2020-02-12 Zhang, H.,Pan, Y.,Hu, L.,Hudson, M.A.,Hofstetter, K.S.,Xu, Z.,Rong, M.,Wang, Z.,Prasad, B.V.V.,Lockless, S.W.,Chiu, W.,Zhou, M. TrkA undergoes a tetramer-to-dimer conversion to open TrkH which enables changes in membrane potential. Nat Commun 2020 11 547 547 6VDC 32034423 POL domain of Pol1 from M. smegmatis 2019-12-24 2020-02-12 Ghosh, S.,Goldgur, Y.,Shuman, S. Mycobacterial DNA polymerase I: activities and crystal structures of the POL domain as apoenzyme and in complex with a DNA primer-template and of the full-length FEN/EXO-POL enzyme. Nucleic Acids Res. 2020 48 3165 3180 6VDD 32034423 POL domain of Pol1 from M. smegmatis complex with DNA primer-template and dNTP 2019-12-24 2020-02-12 Ghosh, S.,Goldgur, Y.,Shuman, S. Mycobacterial DNA polymerase I: activities and crystal structures of the POL domain as apoenzyme and in complex with a DNA primer-template and of the full-length FEN/EXO-POL enzyme. Nucleic Acids Res. 2020 48 3165 3180 6VDE 32034423 Full-length M. smegmatis Pol1 2019-12-24 2020-02-12 Ghosh, S.,Goldgur, Y.,Shuman, S. Mycobacterial DNA polymerase I: activities and crystal structures of the POL domain as apoenzyme and in complex with a DNA primer-template and of the full-length FEN/EXO-POL enzyme. Nucleic Acids Res. 2020 48 3165 3180 6UFY 32042200 B. theta Bile Salt Hydrolase 2019-09-25 2020-02-19 Adhikari, A.A.,Seegar, T.C.M.,Ficarro, S.B.,McCurry, M.D.,Ramachandran, D.,Yao, L.,Chaudhari, S.N.,Ndousse-Fetter, S.,Banks, A.S.,Marto, J.A.,Blacklow, S.C.,Devlin, A.S. Development of a covalent inhibitor of gut bacterial bile salt hydrolases. Nat.Chem.Biol. 2020 16 318 326 6UH4 32042200 B. theta Bile Salt Hydrolase with covalent inhibitor 2019-09-26 2020-02-19 Adhikari, A.A.,Seegar, T.C.M.,Ficarro, S.B.,McCurry, M.D.,Ramachandran, D.,Yao, L.,Chaudhari, S.N.,Ndousse-Fetter, S.,Banks, A.S.,Marto, J.A.,Blacklow, S.C.,Devlin, A.S. Development of a covalent inhibitor of gut bacterial bile salt hydrolases. Nat.Chem.Biol. 2020 16 318 326 6NTC 32086379 Crystal Structure of G12V HRas-GppNHp bound in complex with the engineered RBD variant 1 of CRAF Kinase protein 2019-01-28 2020-03-04 Wiechmann, S.,Maisonneuve, P.,Grebbin, B.M.,Hoffmeister, M.,Kaulich, M.,Clevers, H.,Rajalingam, K.,Kurinov, I.,Farin, H.F.,Sicheri, F.,Ernst, A. Conformation-specific inhibitors of activated Ras GTPases reveal limited Ras dependency of patient-derived cancer organoids. J.Biol.Chem. 2020 295 4526 4540 6NTD 32086379 Crystal Structure of G12V HRas-GppNHp bound in complex with the engineered RBD variant 12 of CRAF Kinase protein 2019-01-28 2020-03-04 Wiechmann, S.,Maisonneuve, P.,Grebbin, B.M.,Hoffmeister, M.,Kaulich, M.,Clevers, H.,Rajalingam, K.,Kurinov, I.,Farin, H.F.,Sicheri, F.,Ernst, A. Conformation-specific inhibitors of activated Ras GTPases reveal limited Ras dependency of patient-derived cancer organoids. J.Biol.Chem. 2020 295 4526 4540 6OVM 32107313 Crystal Structure of the Pseudomonas capeferrum Anti-sigma Regulator PupR C-terminal Cell-surface Signaling Domain in Complex with the Outer Membrane Transporter PupB N-terminal Signaling Domain (SeMet) 2019-05-08 2020-03-04 Jensen, J.L.,Jernberg, B.D.,Sinha, S.C.,Colbert, C.L. Structural basis of cell-surface signaling by a conserved sigma regulator in Gram-negative bacteria. J.Biol.Chem. 2020 295 5795 5806 6P4X 32108112 Crystal Structure of the S. cerevisiae glucokinase, Glk1 2019-05-28 2020-03-11 Stoddard, P.R.,Lynch, E.M.,Farrell, D.P.,Dosey, A.M.,DiMaio, F.,Williams, T.A.,Kollman, J.M.,Murray, A.W.,Garner, E.C. Polymerization in the actin ATPase clan regulates hexokinase activity in yeast. Science 2020 367 1039 1042 6VFP 32101743 Crystal structure of human protocadherin 1 EC1-EC4 2020-01-06 2020-03-11 Harrison, O.J.,Brasch, J.,Katsamba, P.S.,Ahlsen, G.,Noble, A.J.,Dan, H.,Sampogna, R.V.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Family-wide Structural and Biophysical Analysis of Binding Interactions among Non-clustered delta-Protocadherins. Cell Rep 2020 30 2655 0 6VFQ 32101743 Crystal structure of monomeric human protocadherin 10 EC1-EC4 2020-01-06 2020-03-11 Harrison, O.J.,Brasch, J.,Katsamba, P.S.,Ahlsen, G.,Noble, A.J.,Dan, H.,Sampogna, R.V.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Family-wide Structural and Biophysical Analysis of Binding Interactions among Non-clustered delta-Protocadherins. Cell Rep 2020 30 2655 0 6VFR 32101743 Crystal structure of human protocadherin 18 EC1-EC4 2020-01-06 2020-03-11 Harrison, O.J.,Brasch, J.,Katsamba, P.S.,Ahlsen, G.,Noble, A.J.,Dan, H.,Sampogna, R.V.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Family-wide Structural and Biophysical Analysis of Binding Interactions among Non-clustered delta-Protocadherins. Cell Rep 2020 30 2655 0 6VFU 32101743 Crystal structure of human protocadherin 19 EC1-EC4 2020-01-06 2020-03-11 Harrison, O.J.,Brasch, J.,Katsamba, P.S.,Ahlsen, G.,Noble, A.J.,Dan, H.,Sampogna, R.V.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Family-wide Structural and Biophysical Analysis of Binding Interactions among Non-clustered delta-Protocadherins. Cell Rep 2020 30 2655 0 6VFW 32101743 Crystal structure of human delta protocadherin 10 EC1-EC4 2020-01-06 2020-03-11 Harrison, O.J.,Brasch, J.,Katsamba, P.S.,Ahlsen, G.,Noble, A.J.,Dan, H.,Sampogna, R.V.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Family-wide Structural and Biophysical Analysis of Binding Interactions among Non-clustered delta-Protocadherins. Cell Rep 2020 30 2655 0 6VG1 32101743 xenopus protocadherin 8.1 EC1-6 2020-01-07 2020-03-11 Harrison, O.J.,Brasch, J.,Katsamba, P.S.,Ahlsen, G.,Noble, A.J.,Dan, H.,Sampogna, R.V.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Family-wide Structural and Biophysical Analysis of Binding Interactions among Non-clustered delta-Protocadherins. Cell Rep 2020 30 2655 0 6VG4 32101743 Human protocadherin 10 ectodomain 2020-01-07 2020-03-11 Harrison, O.J.,Brasch, J.,Katsamba, P.S.,Ahlsen, G.,Noble, A.J.,Dan, H.,Sampogna, R.V.,Potter, C.S.,Carragher, B.,Honig, B.,Shapiro, L. Family-wide Structural and Biophysical Analysis of Binding Interactions among Non-clustered delta-Protocadherins. Cell Rep 2020 30 2655 0 6VZH Structure of Human Vaccinia-related Kinase 1 (VRK1) Bound to LDSM311 2020-02-28 2020-03-11 dos Reis, C.V.,Dutra, L.A.,Gama, F.,Ferreira, M.,Mascarello, A.,Azevedo, H.,Guimaraes, C.R.W.,Massirer, K.B.,Arruda, P.,Edwards, A.M.,Counago, R.M. Structure of Human Vaccinia-related Kinase 1 (VRK1) Bound to LDSM311 To be Published 0 0 0 0 6U43 Crystal structure of Methanoperedens nitroreducens elongation factor 2 H595N bound to GMPPCP and magnesium (triclinic crystal form) 2019-08-22 2020-03-18 Fenwick, M.K.,Ealick, S.E. Structural basis of elongation factor 2 switching Curr Res Struct Biol 2020 2 25 34 6U44 Crystal structure of Methanoperedens nitroreducens elongation factor 2 H595N bound to GMPPCP and magnesium (monoclinic crystal form) 2019-08-22 2020-03-18 Fenwick, M.K.,Ealick, S.E. Structural basis of elongation factor 2 switching Curr Res Struct Biol 2020 2 25 34 6U45 Crystal structure of Methanoperedens nitroreducens elongation factor 2 bound to GMPPCP and magnesium 2019-08-22 2020-03-18 Fenwick, M.K.,Ealick, S.E. Structural basis of elongation factor 2 switching Curr Res Struct Biol 2020 2 25 34 6UFP 32159324 Structure of proline utilization A with the FAD covalently modified by L-thiazolidine-2-carboxylate and three cysteines (Cys46, Cys470, Cys638) modified to S,S-(2-HYDROXYETHYL)THIOCYSTEINE 2019-09-24 2020-03-18 Campbell, A.C.,Becker, D.F.,Gates, K.S.,Tanner, J.J. Covalent Modification of the Flavin in Proline Dehydrogenase by Thiazolidine-2-Carboxylate. Acs Chem.Biol. 2020 15 936 944 6OBL 32329617 JAK2 JH2 in complex with JAK168 2019-03-21 2020-03-25 Liosi, M.E.,Krimmer, S.G.,Newton, A.S.,Dawson, T.K.,Puleo, D.E.,Cutrona, K.J.,Suzuki, Y.,Schlessinger, J.,Jorgensen, W.L. Selective Janus Kinase 2 (JAK2) Pseudokinase Ligands with a Diaminotriazole Core. J.Med.Chem. 2020 63 5324 5340 6W2B 32618269 Anomalous bromine signal reveals the position of Br-paroxetine complexed with the serotonin transporter at the central site 2020-03-05 2020-03-25 Coleman, J.A.,Navratna, V.,Antermite, D.,Yang, D.,Bull, J.A.,Gouaux, E. Chemical and structural investigation of the paroxetine-human serotonin transporter complex. Elife 2020 9 0 0 6W2C 32618269 Anomalous iodine signal reveals the position of I-paroxetine complexed with the serotonin transporter at the central site 2020-03-05 2020-03-25 Coleman, J.A.,Navratna, V.,Antermite, D.,Yang, D.,Bull, J.A.,Gouaux, E. Chemical and structural investigation of the paroxetine-human serotonin transporter complex. Elife 2020 9 0 0 6OBG 31931008 Ricin A chain bound to VHH antibody V8E6 2019-03-20 2020-04-01 Rudolph, M.J.,Czajka, T.F.,Davis, S.A.,Thi Nguyen, C.M.,Li, X.P.,Tumer, N.E.,Vance, D.J.,Mantis, N.J. Intracellular Neutralization of Ricin Toxin by Single-domain Antibodies Targeting the Active Site. J.Mol.Biol. 2020 432 1109 1125 6OBO 31931008 Ricin A chain bound to VHH antibody V6A6 2019-03-21 2020-04-01 Rudolph, M.J.,Czajka, T.F.,Davis, S.A.,Thi Nguyen, C.M.,Li, X.P.,Tumer, N.E.,Vance, D.J.,Mantis, N.J. Intracellular Neutralization of Ricin Toxin by Single-domain Antibodies Targeting the Active Site. J.Mol.Biol. 2020 432 1109 1125 6VPQ 32257053 Crystal structure of the C-terminal domain of DENR 2020-02-04 2020-04-08 Lomakin, I.B.,De, S.,Wang, J.,Borkar, A.N.,Steitz, T.A. Crystal structure of the C-terminal domain of DENR. Comput Struct Biotechnol J 2020 18 696 704 6VPR 32257053 Crystal structure of the C-terminal domain of DENR 2020-02-04 2020-04-08 Lomakin, I.B.,De, S.,Wang, J.,Borkar, A.N.,Steitz, T.A. Crystal structure of the C-terminal domain of DENR. Comput Struct Biotechnol J 2020 18 696 704 6VT1 32315072 Naegleria gruberi RNA ligase D172A mutant apo 2020-02-12 2020-04-08 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Caveat mutator: alanine substitutions for conserved amino acids in RNA ligase elicit unexpected rearrangements of the active site for lysine adenylylation. Nucleic Acids Res. 2020 48 5603 5615 6VT5 32315072 Naegleria gruberi RNA ligase R4a K121A mutant apo 2020-02-12 2020-04-08 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Caveat mutator: alanine substitutions for conserved amino acids in RNA ligase elicit unexpected rearrangements of the active site for lysine adenylylation. Nucleic Acids Res. 2020 48 5603 5615 6VTE 32315072 Naegleria gruberi RNA Ligase K170M mutant with AMP and Mn 2020-02-12 2020-04-08 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Caveat mutator: alanine substitutions for conserved amino acids in RNA ligase elicit unexpected rearrangements of the active site for lysine adenylylation. Nucleic Acids Res. 2020 48 5603 5615 6VTF 32315072 Naegleria gruberi RNA ligase with PPi 2020-02-12 2020-04-08 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Caveat mutator: alanine substitutions for conserved amino acids in RNA ligase elicit unexpected rearrangements of the active site for lysine adenylylation. Nucleic Acids Res. 2020 48 5603 5615 6VTG 32315072 Naegleria gruberi RNA ligase E227A mutant apo 2020-02-12 2020-04-08 Unciuleac, M.C.,Goldgur, Y.,Shuman, S. Caveat mutator: alanine substitutions for conserved amino acids in RNA ligase elicit unexpected rearrangements of the active site for lysine adenylylation. Nucleic Acids Res. 2020 48 5603 5615 6VW8 32249211 Formate Dehydrogenase FdsABG subcomplex FdsBG from C. necator 2020-02-18 2020-04-08 Young, T.,Niks, D.,Hakopian, S.,Tam, T.K.,Yu, X.,Hille, R.,Blaha, G.M. Crystallographic and kinetic analyses of the FdsBG subcomplex of the cytosolic formate dehydrogenase FdsABG fromCupriavidus necator. J.Biol.Chem. 2020 295 6570 6585 6W2V 32245816 Junction 23, DHR14-DHR18 2020-03-08 2020-04-15 Brunette, T.J.,Bick, M.J.,Hansen, J.M.,Chow, C.M.,Kollman, J.M.,Baker, D. Modular repeat protein sculpting using rigid helical junctions. Proc.Natl.Acad.Sci.USA 2020 117 8870 8875 6VHN 32243152 Wild type EGFR in complex with LN2057 2020-01-10 2020-04-22 Heppner, D.E.,Gunther, M.,Wittlinger, F.,Laufer, S.A.,Eck, M.J. Structural Basis for EGFR Mutant Inhibition by Trisubstituted Imidazole Inhibitors. J.Med.Chem. 2020 63 4293 4305 6W7Y Crystal structure of SARS-CoV and SARS-CoV-2 reactive human antibody CR3022 2020-03-19 2020-05-06 Chen, W.H.,Joyce, M.G. Structure and Antigenicity of the SARS-CoV-2 Receptor Binding Domain To Be Published 0 0 0 0 6WKS 32709886 Structure of SARS-CoV-2 nsp16/nsp10 in complex with RNA cap analogue (m7GpppA) and S-adenosylmethionine 2020-04-16 2020-05-06 Viswanathan, T.,Arya, S.,Chan, S.H.,Qi, S.,Dai, N.,Misra, A.,Park, J.G.,Oladunni, F.,Kovalskyy, D.,Hromas, R.A.,Martinez-Sobrido, L.,Gupta, Y.K. Structural basis of RNA cap modification by SARS-CoV-2. Nat Commun 2020 11 3718 3718 6N2W 32393899 The structure of Stable-5-Lipoxygenase bound to NDGA 2018-11-14 2020-05-13 Gilbert, N.C.,Gerstmeier, J.,Schexnaydre, E.E.,Borner, F.,Garscha, U.,Neau, D.B.,Werz, O.,Newcomer, M.E. Structural and mechanistic insights into 5-lipoxygenase inhibition by natural products. Nat.Chem.Biol. 2020 16 783 790 6NCF 32393899 The structure of Stable-5-Lipoxygenase bound to AKBA 2018-12-11 2020-05-13 Gilbert, N.C.,Gerstmeier, J.,Schexnaydre, E.E.,Borner, F.,Garscha, U.,Neau, D.B.,Werz, O.,Newcomer, M.E. Structural and mechanistic insights into 5-lipoxygenase inhibition by natural products. Nat.Chem.Biol. 2020 16 783 790 6P8L 32283930 Escherichia coli Bacterioferritin Substituted with Zinc Protoporphyrin IX (Zn Absorption Edge X-ray Data) 2019-06-07 2020-05-13 Benavides, B.S.,Valandro, S.,Cioloboc, D.,Taylor, A.B.,Schanze, K.S.,Kurtz Jr., D.M. Structure of a Zinc Porphyrin-Substituted Bacterioferritin and Photophysical Properties of Iron Reduction. Biochemistry 2020 59 1618 1629 6P8L 32283930 Escherichia coli Bacterioferritin Substituted with Zinc Protoporphyrin IX (Zn Absorption Edge X-ray Data) 2019-06-07 2020-05-13 Benavides, B.S.,Valandro, S.,Cioloboc, D.,Taylor, A.B.,Schanze, K.S.,Kurtz Jr., D.M. Structure of a Zinc Porphyrin-Substituted Bacterioferritin and Photophysical Properties of Iron Reduction. Biochemistry 2020 59 1618 1629 6T3K 32503992 Structure of Oceanobacillus iheyensis group II intron G-mutant (C289G/C358G/G385C) in the presence of K+, Mg2+ and 5'-exon 2019-10-11 2020-05-13 Manigrasso, J.,Chillon, I.,Genna, V.,Vidossich, P.,Somarowthu, S.,Pyle, A.M.,De Vivo, M.,Marcia, M. Visualizing group II intron dynamics between the first and second steps of splicing. Nat Commun 2020 11 2837 2837 6T3K 32503992 Structure of Oceanobacillus iheyensis group II intron G-mutant (C289G/C358G/G385C) in the presence of K+, Mg2+ and 5'-exon 2019-10-11 2020-05-13 Manigrasso, J.,Chillon, I.,Genna, V.,Vidossich, P.,Somarowthu, S.,Pyle, A.M.,De Vivo, M.,Marcia, M. Visualizing group II intron dynamics between the first and second steps of splicing. Nat Commun 2020 11 2837 2837 6T3S 32503992 Structure of Oceanobacillus iheyensis group II intron U-mutant (C289U/C358U/G385A) in the presence of Na+, Mg2+ and 5'-exon 2019-10-11 2020-05-13 Manigrasso, J.,Chillon, I.,Genna, V.,Vidossich, P.,Somarowthu, S.,Pyle, A.M.,De Vivo, M.,Marcia, M. Visualizing group II intron dynamics between the first and second steps of splicing. Nat Commun 2020 11 2837 2837 6T3S 32503992 Structure of Oceanobacillus iheyensis group II intron U-mutant (C289U/C358U/G385A) in the presence of Na+, Mg2+ and 5'-exon 2019-10-11 2020-05-13 Manigrasso, J.,Chillon, I.,Genna, V.,Vidossich, P.,Somarowthu, S.,Pyle, A.M.,De Vivo, M.,Marcia, M. Visualizing group II intron dynamics between the first and second steps of splicing. Nat Commun 2020 11 2837 2837 6TZW 32378283 Coiled-coil registry shifts in the F684I mutant of Bicaudal D result in cargo-independent activation of dynein motility 2019-08-13 2020-05-13 Cui, H.,Ali, M.Y.,Goyal, P.,Zhang, K.,Loh, J.Y.,Trybus, K.M.,Solmaz, S.R. Coiled-coil registry shifts in the F684I mutant of Bicaudal D result in cargo-independent activation of dynein motility. Traffic 2020 21 463 478 6U9S 32338599 Crystal structure of human CD81 large extracellular loop in complex with 5A6 Fab 2019-09-09 2020-05-13 Susa, K.J.,Seegar, T.C.,Blacklow, S.C.,Kruse, A.C. A dynamic interaction between CD19 and the tetraspanin CD81 controls B cell co-receptor trafficking. Elife 2020 9 0 0 6VNQ 32348628 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Bishydroxamic Acid Based Inhibitor 2020-01-29 2020-05-13 Morgen, M.,Steimbach, R.R.,Geraldy, M.,Hellweg, L.,Sehr, P.,Ridinger, J.,Witt, O.,Oehme, I.,Herbst-Gervasoni, C.J.,Osko, J.D.,Porter, N.J.,Christianson, D.W.,Gunkel, N.,Miller, A.K. Design and Synthesis of Dihydroxamic Acids as HDAC6/8/10 Inhibitors. Chemmedchem 2020 15 1163 1174 6V9B 32386573 Co-crystal structure of the fluorogenic Mango-IV homodimer bound to TO1-Biotin 2019-12-13 2020-05-20 Trachman 3rd, R.J.,Cojocaru, R.,Wu, D.,Piszczek, G.,Ryckelynck, M.,Unrau, P.J.,Ferre-D'Amare, A.R. Structure-Guided Engineering of the Homodimeric Mango-IV Fluorescence Turn-on Aptamer Yields an RNA FRET Pair. Structure 2020 28 776 0 6WGH 32393580 Crystal structure of GDP-bound NRAS with ten residues long internal tandem duplication in the switch II region 2020-04-05 2020-05-20 Nelson, A.C.,Turbyville, T.J.,Dharmaiah, S.,Rigby, M.,Yang, R.,Wang, T.Y.,Columbus, J.,Stephens, R.,Taylor, T.,Sciacca, D.,Onsongo, G.,Sarver, A.,Subramanian, S.,Nissley, D.V.,Simanshu, D.K.,Lou, E. RASinternal tandem duplication disrupts GTPase-activating protein (GAP) binding to activate oncogenic signaling. J.Biol.Chem. 2020 295 9335 9348 6WUU 33067239 Crystal structure of the SARS CoV-2 Papain-like protease in complex with peptide inhibitor VIR250 2020-05-05 2020-05-20 Rut, W.,Lv, Z.,Zmudzinski, M.,Patchett, S.,Nayak, D.,Snipas, S.J.,El Oualid, F.,Huang, T.T.,Bekes, M.,Drag, M.,Olsen, S.K. Activity profiling and crystal structures of inhibitor-bound SARS-CoV-2 papain-like protease: A framework for anti-COVID-19 drug design. Sci Adv 2020 6 0 0 6WX4 33067239 Crystal structure of the SARS CoV-2 Papain-like protease in complex with peptide inhibitor VIR251 2020-05-09 2020-05-20 Rut, W.,Lv, Z.,Zmudzinski, M.,Patchett, S.,Nayak, D.,Snipas, S.J.,El Oualid, F.,Huang, T.T.,Bekes, M.,Drag, M.,Olsen, S.K. Activity profiling and crystal structures of inhibitor-bound SARS-CoV-2 papain-like protease: A framework for anti-COVID-19 drug design. Sci Adv 2020 6 0 0 6P00 RebH Variant 8F, Tryptamine 6-halogenase 2019-05-16 2020-05-27 Andorfer, M.A.,Yang, S.,He, C.Q.,Evans, D.,Girlich, A.M.,Vergara-Coll, J.,Sukumar, N.,Houk, K.N.,Lewis, J.C. Structural and Computational Analysis of Laboratory-Evolved Halogenases Reveals Molecular Details of Site-Selectivity To Be Published 0 0 0 0 6P38 31620231 Crystal Structure Analysis of TAF1 Bromodomain 2019-05-23 2020-05-27 Remillard, D.,Buckley, D.L.,Seo, H.S.,Ferguson, F.M.,Dhe-Paganon, S.,Bradner, J.E.,Gray, N.S. Dual Inhibition of TAF1 and BET Bromodomains from the BI-2536 Kinase Inhibitor Scaffold. Acs Med.Chem.Lett. 2019 10 1443 1449 6P39 Crystal Structure Analysis of TAF1 Bromodomain 2019-05-23 2020-05-27 Seo, H.-S.,Dhe-Paganon, S. Crystal Structure Analysis of TAF1 Bromodomain To Be Published 0 0 0 0 6P45 33206666 Crystal structure of the G-quadruplex formed by (TGGGT)4 in complex with N-methylmesoporphryin IX 2019-05-26 2020-05-27 Lin, L.Y.,McCarthy, S.,Powell, B.M.,Manurung, Y.,Xiang, I.M.,Dean, W.L.,Chaires, B.,Yatsunyk, L.A. Biophysical and X-ray structural studies of the (GGGTT)3GGG G-quadruplex in complex with N-methyl mesoporphyrin IX. Plos One 2020 15 0 0 6VG3 Structure of unliganded, inactive PTK7 kinase domain 2020-01-07 2020-05-27 Sheetz, J.B.,Mathea, S.,Karvonen, H.,Malhotra, K.,Chaterjee, D.,Perttila, R.,Niininen, W.,Stayrook, S.E.,Radhakrishnan, R.,Ungureanu, D.,Knapp, S.,Lemmon, M.A. Structural insights into receptor tyrosine kinase pseudokinase function Mol.Cell 2020 0 0 0 6VO4 32413285 Crystal Structure Analysis of BFL1 2020-01-29 2020-06-03 Harvey, E.P.,Hauseman, Z.J.,Cohen, D.T.,Rettenmaier, T.J.,Lee, S.,Huhn, A.J.,Wales, T.E.,Seo, H.S.,Luccarelli, J.,Newman, C.E.,Guerra, R.M.,Bird, G.H.,Dhe-Paganon, S.,Engen, J.R.,Wells, J.A.,Walensky, L.D. Identification of a Covalent Molecular Inhibitor of Anti-apoptotic BFL-1 by Disulfide Tethering. Cell Chem Biol 2020 27 647 0 6P4F 32986831 Crystal structure of the XPB-Bax1-forked DNA ternary complex 2019-05-27 2020-06-17 He, F.,DuPrez, K.,Hilario, E.,Chen, Z.,Fan, L. Structural basis of the XPB helicase-Bax1 nuclease complex interacting with the repair bubble DNA. Nucleic Acids Res. 2020 48 11695 11705 6PSC 32493775 Antibody scFv-M204 trimeric state 2019-07-12 2020-06-17 Abskharon, R.,Seidler, P.M.,Sawaya, M.R.,Cascio, D.,Yang, T.P.,Philipp, S.,Williams, C.K.,Newell, K.L.,Ghetti, B.,DeTure, M.A.,Dickson, D.W.,Vinters, H.V.,Felgner, P.L.,Nakajima, R.,Glabe, C.G.,Eisenberg, D.S. Crystal structure of a conformational antibody that binds tau oligomers and inhibits pathological seeding by extracts from donors with Alzheimer's disease. J.Biol.Chem. 2020 295 10662 10676 6WAM 32544385 Structure of Acinetobacter baumannii Cap4 SAVED/CARF-domain containing receptor 2020-03-25 2020-06-17 Lowey, B.,Whiteley, A.T.,Keszei, A.F.A.,Morehouse, B.R.,Mathews, I.T.,Antine, S.P.,Cabrera, V.J.,Kashin, D.,Niemann, P.,Jain, M.,Schwede, F.,Mekalanos, J.J.,Shao, S.,Lee, A.S.Y.,Kranzusch, P.J. CBASS Immunity Uses CARF-Related Effectors to Sense 3'-5'- and 2'-5'-Linked Cyclic Oligonucleotide Signals and Protect Bacteria from Phage Infection. Cell 2020 182 38 0 6WAN 32544385 Structure of Acinetobacter baumannii Cap4 SAVED/CARF-domain containing receptor with the cyclic trinucleotide 3'3'3'-cAAA 2020-03-25 2020-06-17 Lowey, B.,Whiteley, A.T.,Keszei, A.F.A.,Morehouse, B.R.,Mathews, I.T.,Antine, S.P.,Cabrera, V.J.,Kashin, D.,Niemann, P.,Jain, M.,Schwede, F.,Mekalanos, J.J.,Shao, S.,Lee, A.S.Y.,Kranzusch, P.J. CBASS Immunity Uses CARF-Related Effectors to Sense 3'-5'- and 2'-5'-Linked Cyclic Oligonucleotide Signals and Protect Bacteria from Phage Infection. Cell 2020 182 38 0 6WAX 32540970 C-terminal SH2 domain of p120RasGAP 2020-03-26 2020-06-17 Jaber Chehayeb, R.,Wang, J.,Stiegler, A.L.,Boggon, T.J. The GTPase-activating protein p120RasGAP has an evolutionarily conserved ""FLVR-unique"" SH2 domain. J.Biol.Chem. 2020 295 10511 10521 6WAY 32540970 C-terminal SH2 domain of p120RasGAP in complex with p190RhoGAP phosphotyrosine peptide 2020-03-26 2020-06-17 Jaber Chehayeb, R.,Wang, J.,Stiegler, A.L.,Boggon, T.J. The GTPase-activating protein p120RasGAP has an evolutionarily conserved ""FLVR-unique"" SH2 domain. J.Biol.Chem. 2020 295 10511 10521 6WF2 32470559 Crystal structure of mouse SCD1 with a diiron center 2020-04-03 2020-06-17 Shen, J.,Wu, G.,Tsai, A.L.,Zhou, M. Structure and Mechanism of a Unique Diiron Center in Mammalian Stearoyl-CoA Desaturase. J.Mol.Biol. 2020 432 5152 5161 6WPU 32527723 Structure of S-allyl-L-cysteine S-oxygenase from Allium sativum 2020-04-27 2020-06-17 Valentino, H.,Campbell, A.C.,Schuermann, J.P.,Sultana, N.,Nam, H.G.,LeBlanc, S.,Tanner, J.J.,Sobrado, P. Structure and function of a flavin-dependent S-monooxygenase from garlic (Allium sativum). J.Biol.Chem. 2020 295 11042 11055 6OPE 32601241 Crystal structure of tRNA^ Ala(GGC) U32-A38 bound to near-cognate 70S A site 2019-04-24 2020-06-24 Nguyen, H.A.,Sunita, S.,Dunham, C.M. Disruption of evolutionarily correlated tRNA elements impairs accurate decoding. Proc.Natl.Acad.Sci.USA 2020 117 16333 16338 6ORD 32601241 Crystal structure of tRNA^ Ala(GGC) U32-A38 bound to cognate 70S A site 2019-04-30 2020-06-24 Nguyen, H.A.,Sunita, S.,Dunham, C.M. Disruption of evolutionarily correlated tRNA elements impairs accurate decoding. Proc.Natl.Acad.Sci.USA 2020 117 16333 16338 6PER 33333022 Crystal Structure of Ligand-Free iSeroSnFR 2019-06-20 2020-06-24 Unger, E.K.,Keller, J.P.,Altermatt, M.,Liang, R.,Matsui, A.,Dong, C.,Hon, O.J.,Yao, Z.,Sun, J.,Banala, S.,Flanigan, M.E.,Jaffe, D.A.,Hartanto, S.,Carlen, J.,Mizuno, G.O.,Borden, P.M.,Shivange, A.V.,Cameron, L.P.,Sinning, S.,Underhill, S.M.,Olson, D.E.,Amara, S.G.,Temple Lang, D.,Rudnick, G.,Marvin, J.S.,Lavis, L.D.,Lester, H.A.,Alvarez, V.A.,Fisher, A.J.,Prescher, J.A.,Kash, T.L.,Yarov-Yarovoy, V.,Gradinaru, V.,Looger, L.L.,Tian, L. Directed Evolution of a Selective and Sensitive Serotonin Sensor via Machine Learning. Cell 2020 183 1986 0 6PIL 32493775 Antibody scFv-M204 monomeric state 2019-06-26 2020-06-24 Abskharon, R.,Seidler, P.M.,Sawaya, M.R.,Cascio, D.,Yang, T.P.,Philipp, S.,Williams, C.K.,Newell, K.L.,Ghetti, B.,DeTure, M.A.,Dickson, D.W.,Vinters, H.V.,Felgner, P.L.,Nakajima, R.,Glabe, C.G.,Eisenberg, D.S. Crystal structure of a conformational antibody that binds tau oligomers and inhibits pathological seeding by extracts from donors with Alzheimer's disease. J.Biol.Chem. 2020 295 10662 10676 6WIS 32571874 Copper resistance protein copG- Form 1 2020-04-10 2020-06-24 Hausrath, A.C.,Ramirez, N.A.,Ly, A.T.,McEvoy, M.M. The bacterial copper resistance protein CopG contains a cysteine-bridged tetranuclear copper cluster. J.Biol.Chem. 2020 295 11364 11376 6V5A 32513714 Crystal structure of the human BK channel gating ring L390P mutant 2019-12-03 2020-07-01 Geng, Y.,Deng, Z.,Zhang, G.,Budelli, G.,Butler, A.,Yuan, P.,Cui, J.,Salkoff, L.,Magleby, K.L. Coupling of Ca2+and voltage activation in BK channels through the alpha B helix/voltage sensor interface. Proc.Natl.Acad.Sci.USA 2020 117 14512 14521 6X7U 32432673 Crystal Structure of the Human Nudix Hydrolase Nudt16 in complex with FAD 2020-05-30 2020-07-01 Sharma, S.,Grudzien-Nogalska, E.,Hamilton, K.,Jiao, X.,Yang, J.,Tong, L.,Kiledjian, M. Mammalian Nudix proteins cleave nucleotide metabolite caps on RNAs. Nucleic Acids Res. 2020 48 6788 6798 6X7V 32432673 Crystal Structure of the Human Nudix Hydrolase Nudt16 2020-05-30 2020-07-01 Sharma, S.,Grudzien-Nogalska, E.,Hamilton, K.,Jiao, X.,Yang, J.,Tong, L.,Kiledjian, M. Mammalian Nudix proteins cleave nucleotide metabolite caps on RNAs. Nucleic Acids Res. 2020 48 6788 6798 6PNK 33206666 Crystal structure of the G-quadruplex formed by (GGGTT)3GGG in complex with N-methylmesoporphryin IX 2019-07-02 2020-07-08 Lin, L.Y.,McCarthy, S.,Powell, B.M.,Manurung, Y.,Xiang, I.M.,Dean, W.L.,Chaires, B.,Yatsunyk, L.A. Biophysical and X-ray structural studies of the (GGGTT)3GGG G-quadruplex in complex with N-methyl mesoporphyrin IX. Plos One 2020 15 0 0 6V59 32564595 Crystal structure of the diheme peroxidase BthA Y463M variant from Burkholderia thailandensis E264 2019-12-03 2020-07-08 Rizzolo, K.,Weitz, A.C.,Cohen, S.E.,Drennan, C.L.,Hendrich, M.P.,Elliott, S.J. A Stable Ferryl Porphyrin at the Active Site of Y463M BthA. J.Am.Chem.Soc. 2020 142 11978 11982 6W0F 32615129 Closed-gate KcsA soaked in 0mM KCl/5mM BaCl2 2020-02-29 2020-07-08 Rohaim, A.,Gong, L.,Li, J.,Rui, H.,Blachowicz, L.,Roux, B. Open and Closed Structures of a Barium-Blocked Potassium Channel. J.Mol.Biol. 2020 432 4783 4798 6W0G 32615129 Closed-gate KcsA soaked in 1mM KCl/5mM BaCl2 2020-02-29 2020-07-08 Rohaim, A.,Gong, L.,Li, J.,Rui, H.,Blachowicz, L.,Roux, B. Open and Closed Structures of a Barium-Blocked Potassium Channel. J.Mol.Biol. 2020 432 4783 4798 6W0H 32615129 Closed-gate KcsA soaked in 5mM KCl/5mM BaCl2 2020-02-29 2020-07-08 Rohaim, A.,Gong, L.,Li, J.,Rui, H.,Blachowicz, L.,Roux, B. Open and Closed Structures of a Barium-Blocked Potassium Channel. J.Mol.Biol. 2020 432 4783 4798 6W0I 32615129 Closed-gate KcsA soaked in 10mM KCl/5mM BaCl2 2020-02-29 2020-07-08 Rohaim, A.,Gong, L.,Li, J.,Rui, H.,Blachowicz, L.,Roux, B. Open and Closed Structures of a Barium-Blocked Potassium Channel. J.Mol.Biol. 2020 432 4783 4798 6W8V Crystal structure of mouse DNMT1 in complex with ACG DNA 2020-03-21 2020-07-08 Adam, S.,Anteneh, H.,Hornisch, M.,Wagner, V.,Lu, J.,Radde, N.E.,Bashtrykov, P.,Song, J.,Jeltsch, A. DNMT1 activity, base flipping mechanism and genome-wide DNA methylation are regulated by the DNA sequence context Nat Commun 2020 0 0 0 6V6F 32697994 Crystal structure of Q61L KRAS(GMPPNP)-NF1(GRD)-SPRED1(EVH1) complex 2019-12-05 2020-07-15 Yan, W.,Markegard, E.,Dharmaiah, S.,Urisman, A.,Drew, M.,Esposito, D.,Scheffzek, K.,Nissley, D.V.,McCormick, F.,Simanshu, D.K. Structural Insights into the SPRED1-Neurofibromin-KRAS Complex and Disruption of SPRED1-Neurofibromin Interaction by Oncogenic EGFR. Cell Rep 2020 32 107909 107909 6VW9 32679039 C-terminal regulatory domain of the chloride transporter KCC-1 from C. elegans, proteolyzed during crystallization 2020-02-19 2020-07-15 Zimanyi, C.M.,Guo, M.,Mahmood, A.,Hendrickson, W.A.,Hirsh, D.,Cheung, J. Structure of the Regulatory Cytosolic Domain of a Eukaryotic Potassium-Chloride Cotransporter. Structure 2020 28 1051 0 6WBQ 32659072 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Tubastatin A 2020-03-27 2020-07-22 Herbst-Gervasoni, C.J.,Steimbach, R.R.,Morgen, M.,Miller, A.K.,Christianson, D.W. Structural Basis for the Selective Inhibition of HDAC10, the Cytosolic Polyamine Deacetylase. Acs Chem.Biol. 2020 15 2154 2163 6WDV 32659072 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Dimethylaminomethylindole Phenylhydroxamate Inhibitor 2020-04-01 2020-07-22 Herbst-Gervasoni, C.J.,Steimbach, R.R.,Morgen, M.,Miller, A.K.,Christianson, D.W. Structural Basis for the Selective Inhibition of HDAC10, the Cytosolic Polyamine Deacetylase. Acs Chem.Biol. 2020 15 2154 2163 6WDY 32659072 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Indole Phenylhydroxamate Inhibitor 2020-04-01 2020-07-22 Herbst-Gervasoni, C.J.,Steimbach, R.R.,Morgen, M.,Miller, A.K.,Christianson, D.W. Structural Basis for the Selective Inhibition of HDAC10, the Cytosolic Polyamine Deacetylase. Acs Chem.Biol. 2020 15 2154 2163 6XPH 32885887 CutR dimer with domain swap 2020-07-08 2020-07-22 Ochoa, J.M.,Nguyen, V.N.,Nie, M.,Sawaya, M.R.,Bobik, T.A.,Yeates, T.O. Symmetry breaking and structural polymorphism in a bacterial microcompartment shell protein for choline utilization. Protein Sci. 2020 29 2201 2212 6XPI 32885887 CutR flat hexamer, form 1 2020-07-08 2020-07-22 Ochoa, J.M.,Nguyen, V.N.,Nie, M.,Sawaya, M.R.,Bobik, T.A.,Yeates, T.O. Symmetry breaking and structural polymorphism in a bacterial microcompartment shell protein for choline utilization. Protein Sci. 2020 29 2201 2212 6XPJ 32885887 CutR flat hexamer, form 2 2020-07-08 2020-07-22 Ochoa, J.M.,Nguyen, V.N.,Nie, M.,Sawaya, M.R.,Bobik, T.A.,Yeates, T.O. Symmetry breaking and structural polymorphism in a bacterial microcompartment shell protein for choline utilization. Protein Sci. 2020 29 2201 2212 6XPK 32885887 CutR Screw, form 1 with 41.9 angstrom pitch 2020-07-08 2020-07-22 Ochoa, J.M.,Nguyen, V.N.,Nie, M.,Sawaya, M.R.,Bobik, T.A.,Yeates, T.O. Symmetry breaking and structural polymorphism in a bacterial microcompartment shell protein for choline utilization. Protein Sci. 2020 29 2201 2212 6PXK 33472065 3.65 Angstroms resolution structure of HslU with an axial-channel plug 2019-07-26 2020-07-29 Baytshtok, V.,Fei, X.,Shih, T.T.,Grant, R.A.,Santos, J.C.,Baker, T.A.,Sauer, R.T. Heat activates the AAA+ HslUV protease by melting an axial autoinhibitory plug. Cell Rep 2021 34 108639 108639 6PXL 33472065 3.74 Angstroms resolution structure of HlsU with an axial-channel plug 2019-07-26 2020-07-29 Baytshtok, V.,Fei, X.,Shih, T.T.,Grant, R.A.,Santos, J.C.,Baker, T.A.,Sauer, R.T. Heat activates the AAA+ HslUV protease by melting an axial autoinhibitory plug. Cell Rep 2021 34 108639 108639 6PYE 32803970 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 2 complexed with NR160 2019-07-29 2020-07-29 Ressing, N.,Sonnichsen, M.,Osko, J.D.,Scholer, A.,Schliehe-Diecks, J.,Skerhut, A.,Borkhardt, A.,Hauer, J.,Kassack, M.U.,Christianson, D.W.,Bhatia, S.,Hansen, F.K. Multicomponent Synthesis, Binding Mode, and Structure-Activity Relationship of Selective Histone Deacetylase 6 (HDAC6) Inhibitors with Bifurcated Capping Groups. J.Med.Chem. 2020 63 10339 10351 6VWY 32655979 Crystal structure of C45G/T50C D. vulgaris carbon monoxide dehydrogenase (anaerobic) 2020-02-20 2020-07-29 Wittenborn, E.C.,Guendon, C.,Merrouch, M.,Benvenuti, M.,Fourmond, V.,Leger, C.,Drennan, C.L.,Dementin, S. The Solvent-Exposed Fe-S D-Cluster Contributes to Oxygen-Resistance inDesulfovibrio vulgarisNi-Fe Carbon Monoxide Dehydrogenase. Acs Catalysis 2020 10 7328 7335 6VWZ 32655979 Crystal structure of air-exposed C45G/T50C D. vulgaris carbon monoxide dehydrogenase (20 minute air exposure) 2020-02-20 2020-07-29 Wittenborn, E.C.,Guendon, C.,Merrouch, M.,Benvenuti, M.,Fourmond, V.,Leger, C.,Drennan, C.L.,Dementin, S. The Solvent-Exposed Fe-S D-Cluster Contributes to Oxygen-Resistance inDesulfovibrio vulgarisNi-Fe Carbon Monoxide Dehydrogenase. Acs Catalysis 2020 10 7328 7335 6VX0 32655979 Crystal structure of air-exposed C45G/T50C D. vulgaris carbon monoxide dehydrogenase (2 hour air exposure) 2020-02-20 2020-07-29 Wittenborn, E.C.,Guendon, C.,Merrouch, M.,Benvenuti, M.,Fourmond, V.,Leger, C.,Drennan, C.L.,Dementin, S. The Solvent-Exposed Fe-S D-Cluster Contributes to Oxygen-Resistance inDesulfovibrio vulgarisNi-Fe Carbon Monoxide Dehydrogenase. Acs Catalysis 2020 10 7328 7335 6VX1 32655979 Crystal structure of air-exposed C45G/T50C D. vulgaris carbon monoxide dehydrogenase (2 day air exposure) 2020-02-20 2020-07-29 Wittenborn, E.C.,Guendon, C.,Merrouch, M.,Benvenuti, M.,Fourmond, V.,Leger, C.,Drennan, C.L.,Dementin, S. The Solvent-Exposed Fe-S D-Cluster Contributes to Oxygen-Resistance inDesulfovibrio vulgarisNi-Fe Carbon Monoxide Dehydrogenase. Acs Catalysis 2020 10 7328 7335 6WII 32663666 Crystal structure of the K. pneumoniae LpxH/JH-LPH-41 complex 2020-04-09 2020-07-29 Kwak, S.H.,Cochrane, C.S.,Ennis, A.F.,Lim, W.Y.,Webster, C.G.,Cho, J.,Fenton, B.A.,Zhou, P.,Hong, J. Synthesis and evaluation of sulfonyl piperazine LpxH inhibitors. Bioorg.Chem. 2020 102 104055 104055 6S8X 32744247 Crystal structure of the Rab-binding domain of FIP2 2019-07-10 2020-08-05 Kearney, A.M.,Khan, A.R. Crystal structure of the Rab-binding domain of Rab11 family-interacting protein 2. Acta Crystallogr.,Sect.F 2020 76 357 363 6VGS 32855421 Alpha-ketoisovalerate decarboxylase (KivD) from Lactococcus lactis, thermostable mutant 2020-01-08 2020-08-05 Sherkhanov, S.,Korman, T.P.,Chan, S.,Faham, S.,Liu, H.,Sawaya, M.R.,Hsu, W.T.,Vikram, E.,Cheng, T.,Bowie, J.U. Isobutanol production freed from biological limits using synthetic biochemistry. Nat Commun 2020 11 4292 4292 6VK6 32692178 Crystal Structure of Methylosinus trichosporium OB3b Soluble Methane Monooxygenase Hydroxylase 2020-01-18 2020-08-05 Jones, J.C.,Banerjee, R.,Shi, K.,Aihara, H.,Lipscomb, J.D. Structural Studies of theMethylosinus trichosporiumOB3b Soluble Methane Monooxygenase Hydroxylase and Regulatory Component Complex Reveal a Transient Substrate Tunnel. Biochemistry 2020 59 2946 2961 6VK8 32692178 Crystal Structure of Methylosinus trichosporium OB3b Soluble Methane Monooxygenase Hydroxylase and Regulatory Component Complex with small organic carboxylate at active center 2020-01-18 2020-08-05 Jones, J.C.,Banerjee, R.,Shi, K.,Aihara, H.,Lipscomb, J.D. Structural Studies of theMethylosinus trichosporiumOB3b Soluble Methane Monooxygenase Hydroxylase and Regulatory Component Complex Reveal a Transient Substrate Tunnel. Biochemistry 2020 59 2946 2961 6X0H 32723870 Structure of oxidized SidA ornithine hydroxylase with the FAD in the ""out"" conformation 2020-05-15 2020-08-05 Campbell, A.C.,Stiers, K.M.,Martin Del Campo, J.S.,Mehra-Chaudhary, R.,Sobrado, P.,Tanner, J.J. Trapping conformational states of a flavin-dependent N -monooxygenase in crystallo reveals protein and flavin dynamics. J.Biol.Chem. 2020 295 13239 13249 6X0J 32723870 Structure of reduced SidA ornithine hydroxylase with the FAD ""in"" and complexed with NADP and L-ornithine 2020-05-15 2020-08-05 Campbell, A.C.,Stiers, K.M.,Martin Del Campo, J.S.,Mehra-Chaudhary, R.,Sobrado, P.,Tanner, J.J. Trapping conformational states of a flavin-dependent N -monooxygenase in crystallo reveals protein and flavin dynamics. J.Biol.Chem. 2020 295 13239 13249 6NWX Structure of mouse GILT, an enzyme involved in antigen processing 2019-02-07 2020-08-12 Cresswell, P. Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action To Be Published 0 0 0 0 6W47 34094319 Peptoid-Containing Collagen Peptide 2020-03-10 2020-08-12 Melton, S.D.,Brackhahn, E.A.E.,Orlin, S.J.,Jin, P.,Chenoweth, D.M. Rules for the design of aza-glycine stabilized triple-helical collagen peptides. Chem Sci 2020 11 10638 10646 6TZL The structure of the Streptococcus gordonii surface protein SspB in complex with TEV peptide provides clues to the adherence of oral streptococcal adherence to salivary agglutinin 2019-08-12 2020-08-19 Schormann, N.,Deivanayagam, C. The structure of the Streptococcus gordonii surface protein SspB in complex with TEV peptide provides clues to the adherence of oral streptococcal adherence to salivary agglutinin To Be Published 0 0 0 0 6TZN 33131423 Structure of S. pombe telomerase accessory protein Pof8 C-terminal domain 2019-08-12 2020-08-19 Basu, R.,Eichhorn, C.D.,Cheng, R.,Peterson, R.D.,Feigon, J. Structure of S. pombe telomerase protein Pof8 C-terminal domain is an xRRM conserved among LARP7 proteins. Rna Biol. 2021 18 1181 1192 6UTV 32829286 E. coli sigma-S transcription initiation complex with a 6-nt RNA (""Fresh"" crystal soaked with CTP, UTP, GTP, and ddATP for 150 seconds) 2019-10-30 2020-08-26 Zuo, Y.,De, S.,Feng, Y.,Steitz, T.A. Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience 2020 23 101445 101445 6UTX 32829286 E. coli sigma-S transcription initiation complex with an empty bubble (""Old"" crystal) 2019-10-30 2020-08-26 Zuo, Y.,De, S.,Feng, Y.,Steitz, T.A. Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience 2020 23 101445 101445 6V0O 34358446 PRMT5 bound to the PBM peptide from pICln 2019-11-19 2020-08-26 Mulvaney, K.M.,Blomquist, C.,Acharya, N.,Li, R.,Ranaghan, M.J.,O'Keefe, M.,Rodriguez, D.J.,Young, M.J.,Kesar, D.,Pal, D.,Stokes, M.,Nelson, A.J.,Jain, S.S.,Yang, A.,Mullin-Bernstein, Z.,Columbus, J.,Bozal, F.K.,Skepner, A.,Raymond, D.,LaRussa, S.,McKinney, D.C.,Freyzon, Y.,Baidi, Y.,Porter, D.,Aguirre, A.J.,Ianari, A.,McMillan, B.,Sellers, W.R. Molecular basis for substrate recruitment to the PRMT5 methylosome. Mol.Cell 2021 81 3481 0 7JQM 32787108 Crystal structure of the Thermus thermophilus 70S ribosome in complex with Bac7-002, mRNA, and deacylated P-site tRNA at 3.05A resolution 2020-08-11 2020-08-26 Mardirossian, M.,Sola, R.,Beckert, B.,Valencic, E.,Collis, D.W.P.,Borisek, J.,Armas, F.,Di Stasi, A.,Buchmann, J.,Syroegin, E.A.,Polikanov, Y.S.,Magistrato, A.,Hilpert, K.,Wilson, D.N.,Scocchi, M. Peptide Inhibitors of Bacterial Protein Synthesis with Broad Spectrum and SbmA-Independent Bactericidal Activity against Clinical Pathogens. J.Med.Chem. 2020 63 9590 9602 7JU0 RebH Variant 0S, Tryptamine 7-halogenase with bound tryptamine 2020-08-18 2020-08-26 Andorfer, M.A.,Yang, S.,He, C.Q.,Evans, D.,Girlich, A.M.,Vergara-Coll, J.,Sukumar, N.,Houk, K.N.,Lewis, J.C. Structural and Computational Analysis of Laboratory-Evolved Halogenases Reveals Molecular Details of Site-Selectivity To Be Published 0 0 0 0 6U6Z 33531504 Human SAMHD1 bound to deoxyribo(TG*TTCA)-oligonucleotide 2019-08-30 2020-09-02 Yu, C.H.,Bhattacharya, A.,Persaud, M.,Taylor, A.B.,Wang, Z.,Bulnes-Ramos, A.,Xu, J.,Selyutina, A.,Martinez-Lopez, A.,Cano, K.,Demeler, B.,Kim, B.,Hardies, S.C.,Diaz-Griffero, F.,Ivanov, D.N. Nucleic acid binding by SAMHD1 contributes to the antiretroviral activity and is enhanced by the GpsN modification. Nat Commun 2021 12 731 731 6U6Z 33531504 Human SAMHD1 bound to deoxyribo(TG*TTCA)-oligonucleotide 2019-08-30 2020-09-02 Yu, C.H.,Bhattacharya, A.,Persaud, M.,Taylor, A.B.,Wang, Z.,Bulnes-Ramos, A.,Xu, J.,Selyutina, A.,Martinez-Lopez, A.,Cano, K.,Demeler, B.,Kim, B.,Hardies, S.C.,Diaz-Griffero, F.,Ivanov, D.N. Nucleic acid binding by SAMHD1 contributes to the antiretroviral activity and is enhanced by the GpsN modification. Nat Commun 2021 12 731 731 6VJG 32826317 Csx3-I222 Crystal Form at 1.8 Angstrom Resolution 2020-01-15 2020-09-02 Brown, S.,Gauvin, C.C.,Charbonneau, A.A.,Burman, N.,Lawrence, C.M. Csx3 is a cyclic oligonucleotide phosphodiesterase associated with type III CRISPR-Cas that degrades the second messenger cA 4 . J.Biol.Chem. 2020 295 14963 14972 6WYO 32880591 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 1 (CD1) H82F F202Y double mutant complexed with Trichostatin A 2020-05-13 2020-09-02 Osko, J.D.,Christianson, D.W. Binding of inhibitors to active-site mutants of CD1, the enigmatic catalytic domain of histone deacetylase 6. Acta Crystallogr.,Sect.F 2020 76 428 437 6WT8 32877915 Structure of a STING-associated CdnE c-di-GMP synthase from Flavobacteriaceae sp. 2020-05-01 2020-09-09 Morehouse, B.R.,Govande, A.A.,Millman, A.,Keszei, A.F.A.,Lowey, B.,Ofir, G.,Shao, S.,Sorek, R.,Kranzusch, P.J. STING cyclic dinucleotide sensing originated in bacteria. Nature 2020 586 429 433 6XNV 32843560 CRYSTAL STRUCTURE OF LISTERIA MONOCYTOGENES CBPB PROTEIN (LMO1009) IN COMPLEX WITH C-DI-AMP 2020-07-04 2020-09-09 Peterson, B.N.,Young, M.K.M.,Luo, S.,Wang, J.,Whiteley, A.T.,Woodward, J.J.,Tong, L.,Wang, J.D.,Portnoy, D.A. (p)ppGpp and c-di-AMP Homeostasis Is Controlled by CbpB in Listeria monocytogenes. Mbio 2020 11 0 0 6U9Q Crystal Structure Analysis of DNA-BCL11A Znf domain complex 2019-09-09 2020-09-16 Viennet, T.,Yin, M.,Jayaraj, A.,Kim, W.,Sun, Z.Y.J.,Fujiwara, Y.,Zhang, K.,Seruggia, D.,Seo, H.S.,Dhe-Paganon, S.,Orkin, S.H.,Arthanari, H. Structural insights into the DNA-binding mechanism of BCL11A: The integral role of ZnF6 Structure 2024 0 0 0 6UA3 Human Mcl-1 in complex with a modified Bim BH3 peptide 2019-09-10 2020-09-16 Mandal, T.,Grant, R.A.,Keating, A.E. Inhibitor peptides against Mcl-1 containing non-natural amino acids show potent apoptotic response. To Be Published 0 0 0 0 6UAB Human Mcl-1 in complex with a modified unnatural Bim BH3 peptide 2019-09-10 2020-09-16 Mandal, T.,Grant, R.A.,Keating, A.E. Inhibitor peptides against Mcl-1 containing non-natural amino acids show potent apoptotic response. To Be Published 0 0 0 0 6VZF 32896530 Crystal Structure of Atg11 Coiled-Coil 3 2020-02-28 2020-09-16 Margolis, H.K.,Katzenell, S.,Leary, K.A.,Ragusa, M.J. The Third Coiled Coil Domain of Atg11 Is Required for Shaping Mitophagy Initiation Sites. J.Mol.Biol. 2020 432 5752 5764 6UCX 33058266 S2 symmetric peptide design number 1, Wednesday 2019-09-18 2020-09-23 Mulligan, V.K.,Kang, C.S.,Sawaya, M.R.,Rettie, S.,Li, X.,Antselovich, I.,Craven, T.W.,Watkins, A.M.,Labonte, J.W.,DiMaio, F.,Yeates, T.O.,Baker, D. Computational design of mixed chirality peptide macrocycles with internal symmetry. Protein Sci. 2020 29 2433 2445 6VE8 33027636 Structure of the Glutamate-Like Receptor GLR3.2 ligand-binding domain in complex with Methionine 2019-12-30 2020-09-23 Gangwar, S.P.,Green, M.N.,Michard, E.,Simon, A.A.,Feijo, J.A.,Sobolevsky, A.I. Structure of the Arabidopsis Glutamate Receptor-like Channel GLR3.2 Ligand-Binding Domain. Structure 2021 29 161 0 6VEA 33027636 Structure of the Glutamate-Like Receptor GLR3.2 ligand-binding domain in complex with Glycine 2019-12-30 2020-09-23 Gangwar, S.P.,Green, M.N.,Michard, E.,Simon, A.A.,Feijo, J.A.,Sobolevsky, A.I. Structure of the Arabidopsis Glutamate Receptor-like Channel GLR3.2 Ligand-Binding Domain. Structure 2021 29 161 0 6W0R 32895378 Human 8-oxoguanine glycosylase interrogating fully intrahelical undamaged DNA 2020-03-02 2020-09-23 Shigdel, U.K.,Ovchinnikov, V.,Lee, S.J.,Shih, J.A.,Karplus, M.,Nam, K.,Verdine, G.L. The trajectory of intrahelical lesion recognition and extrusion by the human 8-oxoguanine DNA glycosylase. Nat Commun 2020 11 4437 4437 6SQ2 Structure of a phosphomimetic switch 2 variant of Rab8a in complex with the phospho-Rab binding domain of RILPL2 2019-09-03 2020-09-30 Khan, A.R.,Waschbusch, D. Structure of a phosphomimetic switch 2 variant of Rab8a in complex with the phospho-Rab binding domain of RILPL2 To Be Published 0 0 0 0 6U32 33795886 Crystal structure of HaloTag bound to tetramethylrhodamine-HaloTag ligand 2019-08-21 2020-09-30 Deo, C.,Abdelfattah, A.S.,Bhargava, H.K.,Berro, A.J.,Falco, N.,Farrants, H.,Moeyaert, B.,Chupanova, M.,Lavis, L.D.,Schreiter, E.R. The HaloTag as a general scaffold for far-red tunable chemigenetic indicators. Nat.Chem.Biol. 2021 17 718 723 6WA6 33048983 Structure of the Chlamydia pneumoniae CdsV protein 2020-03-24 2020-09-30 Jensen, J.L.,Yamini, S.,Rietsch, A.,Spiller, B.W. ""The structure of the Type III secretion system export gate with CdsO, an ATPase lever arm"". Plos Pathog. 2020 16 0 0 6WGX 32975004 Cocrystal of BRD4(D1) with a selective inhibitor 2020-04-06 2020-10-07 Cui, H.,Divakaran, A.,Pandey, A.K.,Johnson, J.A.,Zahid, H.,Hoell, Z.J.,Ellingson, M.O.,Shi, K.,Aihara, H.,Harki, D.A.,Pomerantz, W.C.K. Selective N-Terminal BET Bromodomain Inhibitors by Targeting Non-Conserved Residues and Structured Water Displacement*. Angew.Chem.Int.Ed.Engl. 2021 60 1220 1226 6X44 32955133 High Resolution Crystal Structure Analysis of SERA5 proenzyme from plasmodium falciparum 2020-05-22 2020-10-07 Smith, N.A.,Clarke, O.B.,Lee, M.,Hodder, A.N.,Smith, B.J. Structure of the Plasmodium falciparum PfSERA5 pseudo-zymogen. Protein Sci. 2020 29 2245 2258 6X5K Crystal structure of CODH/ACS with carbon monoxide bound to the A-cluster 2020-05-26 2020-10-07 Cohen, S.E.,Can, M.,Wittenborn, E.C.,Hendrickson, R.A.,Ragsdale, S.W.,Drennan, C.L. Crystallographic Characterization of the Carbonylated A-Cluster in Carbon Monoxide Dehydrogenase/Acetyl-CoA Synthase Acs Catalysis 2020 10 9741 9746 6NUO 33016876 Modified tRNA(Pro) bound to Thermus thermophilus 70S (cognate) 2019-02-01 2020-10-14 Hoffer, E.,Hong, S.,Sunita, S.,Maehigashi, T.,Gonzalez Jnr, R.L.,Whitford, P.,Dunham, C.M. Structural insights into mRNA reading frame regulation by tRNA modification and slippery codon-anticodon pairing. Elife 2020 9 0 0 6NWY 33016876 Modified tRNA(Pro) bound to Thermus thermophilus 70S (near-cognate) 2019-02-07 2020-10-14 Hoffer, E.,Hong, S.,Sunita, S.,Maehigashi, T.,Gonzalez Jnr, R.L.,Whitford, P.,Dunham, C.M. Structural insights into mRNA reading frame regulation by tRNA modification and slippery codon-anticodon pairing. Elife 2020 9 0 0 6O3M 33016876 Unmodified tRNA(Pro) bound to Thermus thermophilus 70S (cognate) 2019-02-26 2020-10-14 Hoffer, E.,Hong, S.,Sunita, S.,Maehigashi, T.,Gonzalez Jnr, R.L.,Whitford, P.,Dunham, C.M. Structural insights into mRNA reading frame regulation by tRNA modification and slippery codon-anticodon pairing. Elife 2020 9 0 0 6OSI 33016876 Unmodified tRNA(Pro) bound to Thermus thermophilus 70S (near cognate) 2019-05-01 2020-10-14 Hoffer, E.,Hong, S.,Sunita, S.,Maehigashi, T.,Gonzalez Jnr, R.L.,Whitford, P.,Dunham, C.M. Structural insights into mRNA reading frame regulation by tRNA modification and slippery codon-anticodon pairing. Elife 2020 9 0 0 6XKC 33398170 Crystal structure of E3 ligase 2020-06-26 2020-10-14 Yan, X.,Wang, X.,Li, Y.,Zhou, M.,Li, Y.,Song, L.,Mi, W.,Min, J.,Dong, C. Molecular basis for ubiquitin ligase CRL2 FEM1C -mediated recognition of C-degron. Nat.Chem.Biol. 2021 17 263 271 6UP0 33376189 Structure of the Mango-III fluorescent aptamer bound to YO3-Biotin 2019-10-16 2020-10-21 Jeng, S.C.Y.,Trachman III, R.J.,Weissenboeck, F.,Truong, L.,Link, K.A.,Jepsen, M.D.E.,Knutson, J.R.,Andersen, E.S.,Ferre-D'Amare, A.R.,Unrau, P.J. Fluorogenic aptamers resolve the flexibility of RNA junctions using orientation-dependent FRET. Rna 2021 27 433 444 6VVS 33199626 Crystal structure of a Mycobacterium smegmatis RNA polymerase transcription initiation complex with antibiotic Sorangicin 2020-02-18 2020-10-21 Lilic, M.,Chen, J.,Boyaci, H.,Braffman, N.,Hubin, E.A.,Herrmann, J.,Muller, R.,Mooney, R.,Landick, R.,Darst, S.A.,Campbell, E.A. The antibiotic sorangicin A inhibits promoter DNA unwinding in a Mycobacterium tuberculosis rifampicin-resistant RNA polymerase. Proc.Natl.Acad.Sci.USA 2020 117 30423 30432 6VVT 33199626 Crystal structure of a Mycobacterium smegmatis transcription initiation complex with Rifampicin-resistant RNA polymerase and antibiotic Sorangicin 2020-02-18 2020-10-21 Lilic, M.,Chen, J.,Boyaci, H.,Braffman, N.,Hubin, E.A.,Herrmann, J.,Muller, R.,Mooney, R.,Landick, R.,Darst, S.A.,Campbell, E.A. The antibiotic sorangicin A inhibits promoter DNA unwinding in a Mycobacterium tuberculosis rifampicin-resistant RNA polymerase. Proc.Natl.Acad.Sci.USA 2020 117 30423 30432 6VVV 33199626 Crystal structure of a Mycobacterium smegmatis transcription initiation complex with Rifampicin-resistant RNA polymerase 2020-02-18 2020-10-21 Lilic, M.,Chen, J.,Boyaci, H.,Braffman, N.,Hubin, E.A.,Herrmann, J.,Muller, R.,Mooney, R.,Landick, R.,Darst, S.A.,Campbell, E.A. The antibiotic sorangicin A inhibits promoter DNA unwinding in a Mycobacterium tuberculosis rifampicin-resistant RNA polymerase. Proc.Natl.Acad.Sci.USA 2020 117 30423 30432 6U75 34585421 Crystal Structure of S. Cerevisiae SUMO E3 Ligase SIZ2 2019-08-31 2020-10-28 Cappadocia, L.,Kochanczyk, T.,Lima, C.D. DNA asymmetry promotes SUMO modification of the single-stranded DNA-binding protein RPA. Embo J. 2021 40 0 0 6Y1Y 33188180 CheA dimerization domain of Treponema denticola 2020-02-14 2020-10-28 Muok, A.R.,Ortega, D.R.,Kurniyati, K.,Yang, W.,Maschmann, Z.A.,Sidi Mabrouk, A.,Li, C.,Crane, B.R.,Briegel, A. Atypical chemoreceptor arrays accommodate high membrane curvature. Nat Commun 2020 11 5763 5763 6WYC 33058314 Crystal Structure of Chlamydia trachomatis Glyceraldehyde 3-phosphate dehydrogenase 2020-05-12 2020-11-04 Schormann, N.,Campos, J.,Motamed, R.,Hayden, K.L.,Gould, J.R.,Green, T.J.,Senkovich, O.,Banerjee, S.,Ulett, G.C.,Chattopadhyay, D. Chlamydia trachomatis glyceraldehyde 3-phosphate dehydrogenase: Enzyme kinetics, high-resolution crystal structure, and plasminogen binding. Protein Sci. 2020 29 2446 2458 6X2E 33058314 Crystal Structure of Chlamydia trachomatis mixed (apo/holo) Glyceraldehyde 3-phosphate dehydrogenase 2020-05-20 2020-11-04 Schormann, N.,Campos, J.,Motamed, R.,Hayden, K.L.,Gould, J.R.,Green, T.J.,Senkovich, O.,Banerjee, S.,Ulett, G.C.,Chattopadhyay, D. Chlamydia trachomatis glyceraldehyde 3-phosphate dehydrogenase: Enzyme kinetics, high-resolution crystal structure, and plasminogen binding. Protein Sci. 2020 29 2446 2458 6WV3 33154105 Human VKOR with warfarin 2020-05-05 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WV4 33154105 Human VKOR C43S with warfarin 2020-05-05 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WV5 33154105 Human VKOR C43S mutant with vitamin K1 epoxide 2020-05-05 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WV6 33154105 Human VKOR with phenindione 2020-05-05 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WV7 33154105 Human VKOR with Chlorophacinone 2020-05-05 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WV8 33154105 Takifugu rubripes VKOR-like C138S mutant with vitamin K1 2020-05-05 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WVB 33154105 Takifugu rubripes VKOR-like with warfarin 2020-05-05 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WVH 33154105 Human VKOR with Brodifacoum 2020-05-06 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6WVI 33154105 VKOR-like from Takifugu rubripes 2020-05-06 2020-11-11 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 7K95 33122294 Crystal structure of human CPSF30 in complex with hFip1 2020-09-28 2020-11-11 Hamilton, K.,Tong, L. Molecular mechanism for the interaction between human CPSF30 and hFip1. Genes Dev. 2020 34 1753 1761 7KDF 33591274 Structure of Stu2 Bound to dwarf Ndc80c 2020-10-08 2020-11-11 Zahm, J.A.,Stewart, M.G.,Carrier, J.S.,Harrison, S.C.,Miller, M.P. Structural basis of Stu2 recruitment to yeast kinetochores. Elife 2021 10 0 0 6WBR 33311465 Crystal structure of AceCas9 bound with guide RNA and DNA with 5'-NNNCC-3' PAM 2020-03-27 2020-11-18 Das, A.,Hand, T.H.,Smith, C.L.,Wickline, E.,Zawrotny, M.,Li, H. The molecular basis for recognition of 5'-NNNCC-3' PAM and its methylation state by Acidothermus cellulolyticus Cas9. Nat Commun 2020 11 6346 6346 6WC0 33311465 Crystal structure of AceCas9 bound with guide RNA and DNA with 5'-NNNTC-3' PAM 2020-03-28 2020-11-18 Das, A.,Hand, T.H.,Smith, C.L.,Wickline, E.,Zawrotny, M.,Li, H. The molecular basis for recognition of 5'-NNNCC-3' PAM and its methylation state by Acidothermus cellulolyticus Cas9. Nat Commun 2020 11 6346 6346 6VJJ 33608534 Crystal Structure of wild-type KRAS4b (GMPPNP-bound) in complex with RAS-binding domain (RBD) of RAF1/CRAF 2020-01-16 2020-11-25 Tran, T.H.,Chan, A.H.,Young, L.C.,Bindu, L.,Neale, C.,Messing, S.,Dharmaiah, S.,Taylor, T.,Denson, J.P.,Esposito, D.,Nissley, D.V.,Stephen, A.G.,McCormick, F.,Simanshu, D.K. KRAS interaction with RAF1 RAS-binding domain and cysteine-rich domain provides insights into RAS-mediated RAF activation. Nat Commun 2021 12 1176 1176 6VYN 33242393 N-terminal domain of mouse surfactant protein B with bound lipid, wild type 2020-02-27 2020-11-25 Sever, N.,Milicic, G.,Bodnar, N.O.,Wu, X.,Rapoport, T.A. Mechanism of Lamellar Body Formation by Lung Surfactant Protein B. Mol.Cell 2021 81 49 0 6VZ0 33242393 C-terminal domain of mouse surfactant protein B crystallized at high pH 2020-02-27 2020-11-25 Sever, N.,Milicic, G.,Bodnar, N.O.,Wu, X.,Rapoport, T.A. Mechanism of Lamellar Body Formation by Lung Surfactant Protein B. Mol.Cell 2021 81 49 0 6VZE 33242393 C-terminal domain of mouse surfactant protein B crystallized at low pH 2020-02-28 2020-11-25 Sever, N.,Milicic, G.,Bodnar, N.O.,Wu, X.,Rapoport, T.A. Mechanism of Lamellar Body Formation by Lung Surfactant Protein B. Mol.Cell 2021 81 49 0 6W1B 33242393 N-terminal domain of mouse surfactant protein B with bound lipid, Y59A/H79A mutant 2020-03-04 2020-11-25 Sever, N.,Milicic, G.,Bodnar, N.O.,Wu, X.,Rapoport, T.A. Mechanism of Lamellar Body Formation by Lung Surfactant Protein B. Mol.Cell 2021 81 49 0 6X1G 33184172 Crystal structure of a GEF domain from the Orientia tsutsugamushi protein OtDUB in complex with Rac1 2020-05-18 2020-11-25 Lim, C.,Berk, J.M.,Blaise, A.,Bircher, J.,Koleske, A.J.,Hochstrasser, M.,Xiong, Y. Crystal structure of a guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi . Proc.Natl.Acad.Sci.USA 2020 117 30380 30390 6X1H 33184172 Crystal structure of a guanine nucleotide exchange factor (GEF) domain from the Orientia tsutsugamushi protein OtDUB 2020-05-18 2020-11-25 Lim, C.,Berk, J.M.,Blaise, A.,Bircher, J.,Koleske, A.J.,Hochstrasser, M.,Xiong, Y. Crystal structure of a guanine nucleotide exchange factor encoded by the scrub typhus pathogen Orientia tsutsugamushi . Proc.Natl.Acad.Sci.USA 2020 117 30380 30390 6XB3 33191912 Structure of AcNPV poxin in post-reactive state with Gp[2'-5']Ap[3'] 2020-06-05 2020-11-25 Eaglesham, J.B.,McCarty, K.L.,Kranzusch, P.J. Structures of diverse poxin cGAMP nucleases reveal a widespread role for cGAS-STING evasion in host-pathogen conflict. Elife 2020 9 0 0 6XB6 33191912 Structure of Danaus plexippus poxin cGAMP nuclease 2020-06-05 2020-11-25 Eaglesham, J.B.,McCarty, K.L.,Kranzusch, P.J. Structures of diverse poxin cGAMP nucleases reveal a widespread role for cGAS-STING evasion in host-pathogen conflict. Elife 2020 9 0 0 6UF7 33058266 S2 symmetric peptide design number 5, Uncle Fester 2019-09-23 2020-12-02 Mulligan, V.K.,Kang, C.S.,Sawaya, M.R.,Rettie, S.,Li, X.,Antselovich, I.,Craven, T.W.,Watkins, A.M.,Labonte, J.W.,DiMaio, F.,Yeates, T.O.,Baker, D. Computational design of mixed chirality peptide macrocycles with internal symmetry. Protein Sci. 2020 29 2433 2445 6UF8 33058266 S2 symmetric peptide design number 6, London Bridge 2019-09-23 2020-12-02 Mulligan, V.K.,Kang, C.S.,Sawaya, M.R.,Rettie, S.,Li, X.,Antselovich, I.,Craven, T.W.,Watkins, A.M.,Labonte, J.W.,DiMaio, F.,Yeates, T.O.,Baker, D. Computational design of mixed chirality peptide macrocycles with internal symmetry. Protein Sci. 2020 29 2433 2445 6UFA 33058266 S4 symmetric peptide design number 1, Tim zinc-bound form 2019-09-24 2020-12-02 Mulligan, V.K.,Kang, C.S.,Sawaya, M.R.,Rettie, S.,Li, X.,Antselovich, I.,Craven, T.W.,Watkins, A.M.,Labonte, J.W.,DiMaio, F.,Yeates, T.O.,Baker, D. Computational design of mixed chirality peptide macrocycles with internal symmetry. Protein Sci. 2020 29 2433 2445 6UGB 33058266 C3 symmetric peptide design number 2, Baby Basil 2019-09-26 2020-12-02 Mulligan, V.K.,Kang, C.S.,Sawaya, M.R.,Rettie, S.,Li, X.,Antselovich, I.,Craven, T.W.,Watkins, A.M.,Labonte, J.W.,DiMaio, F.,Yeates, T.O.,Baker, D. Computational design of mixed chirality peptide macrocycles with internal symmetry. Protein Sci. 2020 29 2433 2445 6UGC 33058266 C3 symmetric peptide design number 3 2019-09-26 2020-12-02 Mulligan, V.K.,Kang, C.S.,Sawaya, M.R.,Rettie, S.,Li, X.,Antselovich, I.,Craven, T.W.,Watkins, A.M.,Labonte, J.W.,DiMaio, F.,Yeates, T.O.,Baker, D. Computational design of mixed chirality peptide macrocycles with internal symmetry. Protein Sci. 2020 29 2433 2445 6V2U Crystal structure of the insect cell-expressed WT-BRAF kinase in complex with Dabrafenib 2019-11-25 2020-12-02 Li, K.,Gonzalez Del-Pino, G.,Park, E.,Eck, M.J. Crystal structure of the insect cell-expressed WT-BRAF kinase in complex with Dabrafenib To Be Published 0 0 0 0 6V2W 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP 2019-11-25 2020-12-02 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 6V34 Crystal structure of BRAF V600E oncogenic mutant in complex with TAK-580 2019-11-25 2020-12-02 Gonzalez Del-Pino, G.,Li, K.,Eck, M.J. Crystal structure of BRAF V600E oncogenic mutant in complex with TAK-580 To Be Published 0 0 0 0 6V79 34251197 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 2 (CD2) complexed with NF2376 2019-12-08 2020-12-02 Campiani, G.,Cavella, C.,Osko, J.D.,Brindisi, M.,Relitti, N.,Brogi, S.,Saraswati, A.P.,Federico, S.,Chemi, G.,Maramai, S.,Carullo, G.,Jaeger, B.,Carleo, A.,Benedetti, R.,Sarno, F.,Lamponi, S.,Rottoli, P.,Bargagli, E.,Bertucci, C.,Tedesco, D.,Herp, D.,Senger, J.,Ruberti, G.,Saccoccia, F.,Saponara, S.,Gorelli, B.,Valoti, M.,Kennedy, B.,Sundaramurthi, H.,Butini, S.,Jung, M.,Roach, K.M.,Altucci, L.,Bradding, P.,Christianson, D.W.,Gemma, S.,Prasse, A. Harnessing the Role of HDAC6 in Idiopathic Pulmonary Fibrosis: Design, Synthesis, Structural Analysis, and Biological Evaluation of Potent Inhibitors. J.Med.Chem. 2021 64 9960 9988 6V7A 33214839 Crystal structure of Danio rerio histone deacetylase 6 catalytic domain 2 (CD2) complexed with NF2657 2019-12-08 2020-12-02 Saraswati, A.P.,Relitti, N.,Brindisi, M.,Osko, J.D.,Chemi, G.,Federico, S.,Grillo, A.,Brogi, S.,McCabe, N.H.,Turkington, R.C.,Ibrahim, O.,O'Sullivan, J.,Lamponi, S.,Ghanim, M.,Kelly, V.P.,Zisterer, D.,Amet, R.,Hannon Barroeta, P.,Vanni, F.,Ulivieri, C.,Herp, D.,Sarno, F.,Di Costanzo, A.,Saccoccia, F.,Ruberti, G.,Jung, M.,Altucci, L.,Gemma, S.,Butini, S.,Christianson, D.W.,Campiani, G. Spiroindoline-Capped Selective HDAC6 Inhibitors: Design, Synthesis, Structural Analysis, and Biological Evaluation. Acs Med.Chem.Lett. 2020 11 2268 2276 6WLG 33434574 Ints3 C-terminal Domain 2020-04-20 2020-12-02 Li, J.,Ma, X.,Banerjee, S.,Baruah, S.,Schnicker, N.J.,Roh, E.,Ma, W.,Liu, K.,Bode, A.M.,Dong, Z. Structural basis for multifunctional roles of human Ints3 C-terminal domain. J.Biol.Chem. 2020 296 100112 100112 6WMD 33058875 Human Sun2-KASH4 complex 2020-04-21 2020-12-02 Cruz, V.E.,Esra Demircioglu, F.,Schwartz, T.U. Structural Analysis of Different LINC Complexes Reveals Distinct Binding Modes. J.Mol.Biol. 2020 432 6028 6041 6WME 33058875 Human Sun2-KASH3 complex 2020-04-21 2020-12-02 Cruz, V.E.,Esra Demircioglu, F.,Schwartz, T.U. Structural Analysis of Different LINC Complexes Reveals Distinct Binding Modes. J.Mol.Biol. 2020 432 6028 6041 6WMG 33058875 Human Sun2 (500-717) 2020-04-21 2020-12-02 Cruz, V.E.,Esra Demircioglu, F.,Schwartz, T.U. Structural Analysis of Different LINC Complexes Reveals Distinct Binding Modes. J.Mol.Biol. 2020 432 6028 6041 6XC0 33214665 Crystal structure of bacteriophage T4 spackle and lysozyme in monoclinic form 2020-06-07 2020-12-02 Shi, K.,Oakland, J.T.,Kurniawan, F.,Moeller, N.H.,Banerjee, S.,Aihara, H. Structural basis of superinfection exclusion by bacteriophage T4 Spackle. Commun Biol 2020 3 691 691 6XC1 33214665 Crystal structure of bacteriophage T4 spackle and lysozyme in orthorhombic form 2020-06-07 2020-12-02 Shi, K.,Oakland, J.T.,Kurniawan, F.,Moeller, N.H.,Banerjee, S.,Aihara, H. Structural basis of superinfection exclusion by bacteriophage T4 Spackle. Commun Biol 2020 3 691 691 6XCJ 33214287 Crystal Structure of DH650 Fab from a Rhesus Macaque in Complex with HIV-1 gp120 Core 2020-06-08 2020-12-02 Roark, R.S.,Li, H.,Williams, W.B.,Chug, H.,Mason, R.D.,Gorman, J.,Wang, S.,Lee, F.H.,Rando, J.,Bonsignori, M.,Hwang, K.K.,Saunders, K.O.,Wiehe, K.,Moody, M.A.,Hraber, P.T.,Wagh, K.,Giorgi, E.E.,Russell, R.M.,Bibollet-Ruche, F.,Liu, W.,Connell, J.,Smith, A.G.,DeVoto, J.,Murphy, A.I.,Smith, J.,Ding, W.,Zhao, C.,Chohan, N.,Okumura, M.,Rosario, C.,Ding, Y.,Lindemuth, E.,Bauer, A.M.,Bar, K.J.,Ambrozak, D.,Chao, C.W.,Chuang, G.Y.,Geng, H.,Lin, B.C.,Louder, M.K.,Nguyen, R.,Zhang, B.,Lewis, M.G.,Raymond, D.D.,Doria-Rose, N.A.,Schramm, C.A.,Douek, D.C.,Roederer, M.,Kepler, T.B.,Kelsoe, G.,Mascola, J.R.,Kwong, P.D.,Korber, B.T.,Harrison, S.C.,Haynes, B.F.,Hahn, B.H.,Shaw, G.M. Recapitulation of HIV-1 Env-antibody coevolution in macaques leading to neutralization breadth. Science 2021 371 0 0 7KFX 33200128 Structural basis for a germline-biased antibody response to SARS-CoV-2 (RBD:C1A-C2 Fab) 2020-10-15 2020-12-02 Clark, S.A.,Clark, L.E.,Pan, J.,Coscia, A.,McKay, L.G.A.,Shankar, S.,Johnson, R.I.,Griffiths, A.,Abraham, J. Molecular basis for a germline-biased neutralizing antibody response to SARS-CoV-2. Biorxiv 2020 0 0 0 7KFY 33200128 Structural basis for a germline-biased antibody response to SARS-CoV-2 (RBD:C1A-F10 Fab) 2020-10-15 2020-12-02 Clark, S.A.,Clark, L.E.,Pan, J.,Coscia, A.,McKay, L.G.A.,Shankar, S.,Johnson, R.I.,Griffiths, A.,Abraham, J. Molecular basis for a germline-biased neutralizing antibody response to SARS-CoV-2. Biorxiv 2020 0 0 0 6UX9 32298120 Crystal Structure Analysis of PIP4K2A 2019-11-07 2020-12-09 Manz, T.D.,Sivakumaren, S.C.,Ferguson, F.M.,Zhang, T.,Yasgar, A.,Seo, H.S.,Ficarro, S.B.,Card, J.D.,Shim, H.,Miduturu, C.V.,Simeonov, A.,Shen, M.,Marto, J.A.,Dhe-Paganon, S.,Hall, M.D.,Cantley, L.C.,Gray, N.S. Discovery and Structure-Activity Relationship Study of ( Z )-5-Methylenethiazolidin-4-one Derivatives as Potent and Selective Pan-phosphatidylinositol 5-Phosphate 4-Kinase Inhibitors. J.Med.Chem. 2020 63 4880 4895 6V67 34272285 Apo Structure of the De Novo PD-1 Binding Miniprotein GR918.2 2019-12-04 2020-12-09 Bryan, C.M.,Rocklin, G.J.,Bick, M.J.,Ford, A.,Majri-Morrison, S.,Kroll, A.V.,Miller, C.J.,Carter, L.,Goreshnik, I.,Kang, A.,DiMaio, F.,Tarbell, K.V.,Baker, D. Computational design of a synthetic PD-1 agonist. Proc.Natl.Acad.Sci.USA 2021 118 0 0 6X02 33247142 Nup84-Nup133 (aa521-1157) from S. cerevisiae bound by VHH-SAN8 2020-05-15 2020-12-09 Nordeen, S.A.,Turman, D.L.,Schwartz, T.U. Yeast Nup84-Nup133 complex structure details flexibility and reveals conservation of the membrane anchoring ALPS motif. Nat Commun 2020 11 6060 6060 6X02 33247142 Nup84-Nup133 (aa521-1157) from S. cerevisiae bound by VHH-SAN8 2020-05-15 2020-12-09 Nordeen, S.A.,Turman, D.L.,Schwartz, T.U. Yeast Nup84-Nup133 complex structure details flexibility and reveals conservation of the membrane anchoring ALPS motif. Nat Commun 2020 11 6060 6060 6X03 33247142 Nup84-Nup133 (aa521-1157) from S. cerevisiae bound by VHH-SAN8 and VHH-SAN9 2020-05-15 2020-12-09 Nordeen, S.A.,Turman, D.L.,Schwartz, T.U. Yeast Nup84-Nup133 complex structure details flexibility and reveals conservation of the membrane anchoring ALPS motif. Nat Commun 2020 11 6060 6060 6X04 33247142 Nup133 (aa55-481) from S. cerevisiae bound by VHH-SAN5 2020-05-15 2020-12-09 Nordeen, S.A.,Turman, D.L.,Schwartz, T.U. Yeast Nup84-Nup133 complex structure details flexibility and reveals conservation of the membrane anchoring ALPS motif. Nat Commun 2020 11 6060 6060 6X05 33247142 Nup133 (aa55-481) from S. cerevisiae bound by VHH-SAN4 2020-05-15 2020-12-09 Nordeen, S.A.,Turman, D.L.,Schwartz, T.U. Yeast Nup84-Nup133 complex structure details flexibility and reveals conservation of the membrane anchoring ALPS motif. Nat Commun 2020 11 6060 6060 6X06 33268786 Nup120 (aa1-757) from S. cerevisiae bound by VHH-SAN11 2020-05-15 2020-12-09 Nordeen, S.A.,Andersen, K.R.,Knockenhauer, K.E.,Ingram, J.R.,Ploegh, H.L.,Schwartz, T.U. A nanobody suite for yeast scaffold nucleoporins provides details of the nuclear pore complex structure. Nat Commun 2020 11 6179 6179 6X08 33268786 Nup85-Seh1 from S. cerevisiae bound by VHH-SAN2 2020-05-15 2020-12-09 Nordeen, S.A.,Andersen, K.R.,Knockenhauer, K.E.,Ingram, J.R.,Ploegh, H.L.,Schwartz, T.U. A nanobody suite for yeast scaffold nucleoporins provides details of the nuclear pore complex structure. Nat Commun 2020 11 6179 6179 6V7W 33412111 Crystal structure of LasR-Aqs1 complex from Pseudomonas aeruginosa 2019-12-09 2020-12-16 Shah, M.,Taylor, V.L.,Bona, D.,Tsao, Y.,Stanley, S.Y.,Pimentel-Elardo, S.M.,McCallum, M.,Bondy-Denomy, J.,Howell, P.L.,Nodwell, J.R.,Davidson, A.R.,Moraes, T.F.,Maxwell, K.L. A phage-encoded anti-activator inhibits quorum sensing in Pseudomonas aeruginosa. Mol.Cell 2021 81 571 0 6V7X 33412111 Structure of a phage-encoded quorum sensing anti-activator, Aqs1 bound to LasR 2019-12-09 2020-12-16 Shah, M.,Taylor, V.L.,Bona, D.,Tsao, Y.,Stanley, S.Y.,Pimentel-Elardo, S.M.,McCallum, M.,Bondy-Denomy, J.,Howell, P.L.,Nodwell, J.R.,Davidson, A.R.,Moraes, T.F.,Maxwell, K.L. A phage-encoded anti-activator inhibits quorum sensing in Pseudomonas aeruginosa. Mol.Cell 2021 81 571 0 6WDZ 33410911 Porcine circovirus 2 Rep domain complexed with a single-stranded DNA 10-mer comprising the cleavage site 2020-04-01 2020-12-16 Tompkins, K.J.,Houtti, M.,Litzau, L.A.,Aird, E.J.,Everett, B.A.,Nelson, A.T.,Pornschloegl, L.,Limon-Swanson, L.K.,Evans, R.L.,Evans, K.,Shi, K.,Aihara, H.,Gordon, W.R. Molecular underpinnings of ssDNA specificity by Rep HUH-endonucleases and implications for HUH-tag multiplexing and engineering. Nucleic Acids Res. 2021 49 1046 1064 6WE0 33410911 Wheat dwarf virus Rep domain complexed with a single-stranded DNA 10-mer comprising the cleavage site 2020-04-01 2020-12-16 Tompkins, K.J.,Houtti, M.,Litzau, L.A.,Aird, E.J.,Everett, B.A.,Nelson, A.T.,Pornschloegl, L.,Limon-Swanson, L.K.,Evans, R.L.,Evans, K.,Shi, K.,Aihara, H.,Gordon, W.R. Molecular underpinnings of ssDNA specificity by Rep HUH-endonucleases and implications for HUH-tag multiplexing and engineering. Nucleic Acids Res. 2021 49 1046 1064 7KJ8 33270439 Wild-type epi-isozizaene synthase: complex with 3 Mg2+ and pamidronate 2020-10-26 2020-12-16 Ronnebaum, T.A.,Gardner, S.M.,Christianson, D.W. An Aromatic Cluster in the Active Site of epi -Isozizaene Synthase Is an Electrostatic Toggle for Divergent Terpene Cyclization Pathways. Biochemistry 2020 59 4744 4754 7KJ9 33270439 Wild-type epi-isozizaene synthase: complex with 3 Mg2+ and risedronate 2020-10-26 2020-12-16 Ronnebaum, T.A.,Gardner, S.M.,Christianson, D.W. An Aromatic Cluster in the Active Site of epi -Isozizaene Synthase Is an Electrostatic Toggle for Divergent Terpene Cyclization Pathways. Biochemistry 2020 59 4744 4754 7KJD 33270439 F96M epi-isozizaene synthase: complex with 3 Mg2+ and risedronate 2020-10-26 2020-12-16 Ronnebaum, T.A.,Gardner, S.M.,Christianson, D.W. An Aromatic Cluster in the Active Site of epi -Isozizaene Synthase Is an Electrostatic Toggle for Divergent Terpene Cyclization Pathways. Biochemistry 2020 59 4744 4754 7KJE 33270439 F96S epi-isozizaene synthase: complex with 3 Mg2+ and neridronate 2020-10-26 2020-12-16 Ronnebaum, T.A.,Gardner, S.M.,Christianson, D.W. An Aromatic Cluster in the Active Site of epi -Isozizaene Synthase Is an Electrostatic Toggle for Divergent Terpene Cyclization Pathways. Biochemistry 2020 59 4744 4754 7KQH 33274930 Antibodies that engage the hemagglutinin receptor-binding site of influenza B viruses 2020-11-16 2020-12-16 Bajic, G.,Harrison, S.C. Antibodies That Engage the Hemagglutinin Receptor-Binding Site of Influenza B Viruses. Acs Infect Dis. 2021 7 1 5 7KQI 33274930 Antibodies that engage the hemagglutinin receptor-binding site of influenza B viruses 2020-11-16 2020-12-16 Bajic, G.,Harrison, S.C. Antibodies That Engage the Hemagglutinin Receptor-Binding Site of Influenza B Viruses. Acs Infect Dis. 2021 7 1 5 6XHV 33462493 Crystal structure of the A2058-dimethylated Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A- and P-site tRNAs, and deacylated E-site tRNA at 2.40A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 6XHV 33462493 Crystal structure of the A2058-dimethylated Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A- and P-site tRNAs, and deacylated E-site tRNA at 2.40A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 6XHW 33462493 Crystal structure of the A2058-unmethylated Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A- and P-site tRNAs, and deacylated E-site tRNA at 2.50A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 6XHW 33462493 Crystal structure of the A2058-unmethylated Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A- and P-site tRNAs, and deacylated E-site tRNA at 2.50A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 6XHX 33462493 Crystal structure of the A2058-unmethylated Thermus thermophilus 70S ribosome in complex with erythromycin and protein Y (YfiA) at 2.55A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 6XHX 33462493 Crystal structure of the A2058-unmethylated Thermus thermophilus 70S ribosome in complex with erythromycin and protein Y (YfiA) at 2.55A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 6XHY 33462493 Crystal structure of the Thermus thermophilus 70S ribosome in complex with telithromycin, mRNA, aminoacylated A- and P-site tRNAs, and deacylated E-site tRNA at 2.60A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 6XHY 33462493 Crystal structure of the Thermus thermophilus 70S ribosome in complex with telithromycin, mRNA, aminoacylated A- and P-site tRNAs, and deacylated E-site tRNA at 2.60A resolution 2020-06-19 2020-12-23 Svetlov, M.S.,Syroegin, E.A.,Aleksandrova, E.V.,Atkinson, G.C.,Gregory, S.T.,Mankin, A.S.,Polikanov, Y.S. Structure of Erm-modified 70S ribosome reveals the mechanism of macrolide resistance. Nat.Chem.Biol. 2021 17 412 420 7KGV 33296665 Crystal structure of sodium-coupled neutral amino acid transporter SLC38A9 in the N-terminal plugged form 2020-10-19 2020-12-23 Lei, H.T.,Mu, X.,Hattne, J.,Gonen, T. A conformational change in the N terminus of SLC38A9 signals mTORC1 activation. Structure 2021 29 426 0 6PGW 34520737 Crystal structure of zebrafish Protocadherin-19 EC3-6 2019-06-24 2020-12-30 Hudson, J.D.,Tamilselvan, E.,Sotomayor, M.,Cooper, S.R. A complete Protocadherin-19 ectodomain model for evaluating epilepsy-causing mutations and potential protein interaction sites. Structure 2021 29 1128 0 6VAJ 33972797 Crystal Structure Analysis of human PIN1 2019-12-17 2020-12-30 Dubiella, C.,Pinch, B.J.,Koikawa, K.,Zaidman, D.,Poon, E.,Manz, T.D.,Nabet, B.,He, S.,Resnick, E.,Rogel, A.,Langer, E.M.,Daniel, C.J.,Seo, H.S.,Chen, Y.,Adelmant, G.,Sharifzadeh, S.,Ficarro, S.B.,Jamin, Y.,Martins da Costa, B.,Zimmerman, M.W.,Lian, X.,Kibe, S.,Kozono, S.,Doctor, Z.M.,Browne, C.M.,Yang, A.,Stoler-Barak, L.,Shah, R.B.,Vangos, N.E.,Geffken, E.A.,Oren, R.,Koide, E.,Sidi, S.,Shulman, Z.,Wang, C.,Marto, J.A.,Dhe-Paganon, S.,Look, T.,Zhou, X.Z.,Lu, K.P.,Sears, R.C.,Chesler, L.,Gray, N.S.,London, N. Sulfopin is a covalent inhibitor of Pin1 that blocks Myc-driven tumors in vivo. Nat.Chem.Biol. 2021 17 954 963 6WXW 33461211 crystal structure of apo Card1 2020-05-12 2020-12-30 Rostol, J.T.,Xie, W.,Kuryavyi, V.,Maguin, P.,Kao, K.,Froom, R.,Patel, D.J.,Marraffini, L.A. The Card1 nuclease provides defence during type III CRISPR immunity. Nature 2021 590 624 629 6WXX 33461211 crystal structure of cA4-activated Card1 2020-05-12 2020-12-30 Rostol, J.T.,Xie, W.,Kuryavyi, V.,Maguin, P.,Kao, K.,Froom, R.,Patel, D.J.,Marraffini, L.A. The Card1 nuclease provides defence during type III CRISPR immunity. Nature 2021 590 624 629 6XSR 32959886 Crystal structure of GluA2 AMPA receptor in complex with trans-4-butylcyclohexane carboxylic acid (4-BCCA) inhibitor 2020-07-16 2020-12-30 Yelshanskaya, M.V.,Singh, A.K.,Narangoda, C.,Williams, R.S.B.,Kurnikova, M.G.,Sobolevsky, A.I. Structural basis of AMPA receptor inhibition by trans-4-butylcyclohexane carboxylic acid. Br.J.Pharmacol. 2022 179 3628 3644 6XSR 32959886 Crystal structure of GluA2 AMPA receptor in complex with trans-4-butylcyclohexane carboxylic acid (4-BCCA) inhibitor 2020-07-16 2020-12-30 Yelshanskaya, M.V.,Singh, A.K.,Narangoda, C.,Williams, R.S.B.,Kurnikova, M.G.,Sobolevsky, A.I. Structural basis of AMPA receptor inhibition by trans-4-butylcyclohexane carboxylic acid. Br.J.Pharmacol. 2022 179 3628 3644 7KLP 33290519 Crystal structure of a three-tetrad, parallel, K+ stabilized human telomeric G-quadruplex 2020-10-30 2020-12-30 Li, K.,Yatsunyk, L.,Neidle, S. Water spines and networks in G-quadruplex structures. Nucleic Acids Res. 2021 49 519 528 7KQQ Crystal structure of human WDR55 2020-11-17 2020-12-30 Zeng, H.,Hutchinson, A.,Li, Y.,Seitova, A.,Edwards, A.M.,Arrowsmith, C.H.,Halabelian, L.,Structural Genomics Consortium (SGC) Crystal structure of human WDR55 To Be Published 0 0 0 0 6XN6 33361191 ScoE with the CABA substrate bound and His299 and Arg157 flipped out 2020-07-02 2021-01-06 Jonnalagadda, R.,Del Rio Flores, A.,Cai, W.,Mehmood, R.,Narayanamoorthy, M.,Ren, C.,Zaragoza, J.P.T.,Kulik, H.J.,Zhang, W.,Drennan, C.L. Biochemical and crystallographic investigations into isonitrile formation by a nonheme iron-dependent oxidase/decarboxylase. J.Biol.Chem. 2021 296 100231 100231 6XO3 33361191 ScoE with alpha-ketoglutarate in an off-site 2020-07-06 2021-01-06 Jonnalagadda, R.,Del Rio Flores, A.,Cai, W.,Mehmood, R.,Narayanamoorthy, M.,Ren, C.,Zaragoza, J.P.T.,Kulik, H.J.,Zhang, W.,Drennan, C.L. Biochemical and crystallographic investigations into isonitrile formation by a nonheme iron-dependent oxidase/decarboxylase. J.Biol.Chem. 2021 296 100231 100231 6XOJ 33361191 ScoE with the CABA substrate bound and alpha-ketoglutarate in an off-site 2020-07-07 2021-01-06 Jonnalagadda, R.,Del Rio Flores, A.,Cai, W.,Mehmood, R.,Narayanamoorthy, M.,Ren, C.,Zaragoza, J.P.T.,Kulik, H.J.,Zhang, W.,Drennan, C.L. Biochemical and crystallographic investigations into isonitrile formation by a nonheme iron-dependent oxidase/decarboxylase. J.Biol.Chem. 2021 296 100231 100231 6WVD 33355146 Human JAGN1 2020-05-05 2021-01-13 Liu, S.,Li, S.,Yang, Y.,Li, W. Termini restraining of small membrane proteins enables structure determination at near-atomic resolution. Sci Adv 2020 6 0 0 6WVE 33355146 Chicken SPCS1 2020-05-05 2021-01-13 Liu, S.,Li, S.,Yang, Y.,Li, W. Termini restraining of small membrane proteins enables structure determination at near-atomic resolution. Sci Adv 2020 6 0 0 6WVF 33355146 E.coli DsbB C104S with ubiquinone 2020-05-05 2021-01-13 Liu, S.,Li, S.,Yang, Y.,Li, W. Termini restraining of small membrane proteins enables structure determination at near-atomic resolution. Sci Adv 2020 6 0 0 6XGU 33608534 Crystal Structure of KRAS-Q61R (GMPPNP-bound) in complex with RAS-binding domain (RBD) and cysteine-rich domain (CRD) of RAF1/CRAF 2020-06-18 2021-01-13 Tran, T.H.,Chan, A.H.,Young, L.C.,Bindu, L.,Neale, C.,Messing, S.,Dharmaiah, S.,Taylor, T.,Denson, J.P.,Esposito, D.,Nissley, D.V.,Stephen, A.G.,McCormick, F.,Simanshu, D.K. KRAS interaction with RAF1 RAS-binding domain and cysteine-rich domain provides insights into RAS-mediated RAF activation. Nat Commun 2021 12 1176 1176 6XHA 33608534 Crystal Structure of KRAS-G12V (GMPPNP-bound) in complex with RAS-binding domain (RBD) and cysteine-rich domain (CRD) of RAF1/CRAF 2020-06-18 2021-01-13 Tran, T.H.,Chan, A.H.,Young, L.C.,Bindu, L.,Neale, C.,Messing, S.,Dharmaiah, S.,Taylor, T.,Denson, J.P.,Esposito, D.,Nissley, D.V.,Stephen, A.G.,McCormick, F.,Simanshu, D.K. KRAS interaction with RAF1 RAS-binding domain and cysteine-rich domain provides insights into RAS-mediated RAF activation. Nat Commun 2021 12 1176 1176 7L84 35916223 Hen Egg White Lysozyme by Native S-SAD at Room Temperature 2020-12-30 2021-01-13 Greisman, J.B.,Dalton, K.M.,Sheehan, C.J.,Klureza, M.A.,Kurinov, I.,Hekstra, D.R. Native SAD phasing at room temperature. Acta Crystallogr D Struct Biol 2022 78 986 996 7JNH 33414189 Crystal structure of a double-ENE RNA stability element in complex with a 28-mer poly(A) RNA 2020-08-04 2021-01-20 Torabi, S.F.,Vaidya, A.T.,Tycowski, K.T.,DeGregorio, S.J.,Wang, J.,Shu, M.D.,Steitz, T.A.,Steitz, J.A. RNA stabilization by a poly(A) tail 3'-end binding pocket and other modes of poly(A)-RNA interaction. Science 2021 371 0 0 7JW3 33199607 Crystal structure of Aedes aegypti Nibbler NTD domain 2020-08-24 2021-01-20 Xie, W.,Sowemimo, I.,Hayashi, R.,Wang, J.,Burkard, T.R.,Brennecke, J.,Ameres, S.L.,Patel, D.J. Structure-function analysis of microRNA 3'-end trimming by Nibbler. Proc.Natl.Acad.Sci.USA 2020 117 30370 30379 7JW6 33199607 Crystal structure of Drosophila Nibbler EXO domain 2020-08-24 2021-01-20 Xie, W.,Sowemimo, I.,Hayashi, R.,Wang, J.,Burkard, T.R.,Brennecke, J.,Ameres, S.L.,Patel, D.J. Structure-function analysis of microRNA 3'-end trimming by Nibbler. Proc.Natl.Acad.Sci.USA 2020 117 30370 30379 7KMY 33527832 Structure of Mtb Lpd bound to 010705 2020-11-03 2021-01-27 Ginn, J.,Jiang, X.,Sun, S.,Michino, M.,Huggins, D.J.,Mbambo, Z.,Jansen, R.,Rhee, K.Y.,Arango, N.,Lima, C.D.,Liverton, N.,Imaeda, T.,Okamoto, R.,Kuroita, T.,Aso, K.,Stamford, A.,Foley, M.,Meinke, P.T.,Nathan, C.,Bryk, R. Whole Cell Active Inhibitors of Mycobacterial Lipoamide Dehydrogenase Afford Selectivity over the Human Enzyme through Tight Binding Interactions. Acs Infect Dis. 2021 7 435 444 6XF1 33472039 Nesprin-2G(aa1425-1649)-FHOD1(aa1-339) complex, H. sapiens 2020-06-15 2021-02-03 Lim, S.M.,Cruz, V.E.,Antoku, S.,Gundersen, G.G.,Schwartz, T.U. Structures of FHOD1-Nesprin1/2 complexes reveal alternate binding modes for the FH3 domain of formins. Structure 2021 29 540 0 6XF2 33472039 Nesprin-1G (aa2070-2200)-FHOD1(aa1-339) complex, H. sapiens 2020-06-15 2021-02-03 Lim, S.M.,Cruz, V.E.,Antoku, S.,Gundersen, G.G.,Schwartz, T.U. Structures of FHOD1-Nesprin1/2 complexes reveal alternate binding modes for the FH3 domain of formins. Structure 2021 29 540 0 7KHN 33464876 NicA2 variant N462Y/W427Y in complex with (S)-nicotine 2020-10-21 2021-02-03 Tararina, M.A.,Dam, K.K.,Dhingra, M.,Janda, K.D.,Palfey, B.A.,Allen, K.N. Fast Kinetics Reveals Rate-Limiting Oxidation and the Role of the Aromatic Cage in the Mechanism of the Nicotine-Degrading Enzyme NicA2. Biochemistry 2021 60 259 273 7KUQ 33449614 Crystal Structure of Danio rerio Histone Deacetylase 10 Y307F Mutant in Complex with N8-Acetylspermidine 2020-11-25 2021-02-03 Herbst-Gervasoni, C.J.,Christianson, D.W. X-ray Crystallographic Snapshots of Substrate Binding in the Active Site of Histone Deacetylase 10. Biochemistry 2021 60 303 313 7KUR 33449614 Crystal Structure of Danio rerio Histone Deacetylase 10 Y307F Mutant in Complex with N-Acetylputrescine 2020-11-25 2021-02-03 Herbst-Gervasoni, C.J.,Christianson, D.W. X-ray Crystallographic Snapshots of Substrate Binding in the Active Site of Histone Deacetylase 10. Biochemistry 2021 60 303 313 7KUS 33449614 Crystal Structure of Danio rerio Histone Deacetylase 10 H137A Mutant in Complex with N8-Acetylspermidine (Tetrahedral Intermediate) 2020-11-25 2021-02-03 Herbst-Gervasoni, C.J.,Christianson, D.W. X-ray Crystallographic Snapshots of Substrate Binding in the Active Site of Histone Deacetylase 10. Biochemistry 2021 60 303 313 7KUT 33449614 Crystal Structure of Danio rerio Histone Deacetylase 10 H137A Mutant in Complex with N-Acetylputrescine (Tetrahedral Intermediate) 2020-11-25 2021-02-03 Herbst-Gervasoni, C.J.,Christianson, D.W. X-ray Crystallographic Snapshots of Substrate Binding in the Active Site of Histone Deacetylase 10. Biochemistry 2021 60 303 313 7KUV 33449614 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Acetate 2020-11-25 2021-02-03 Herbst-Gervasoni, C.J.,Christianson, D.W. X-ray Crystallographic Snapshots of Substrate Binding in the Active Site of Histone Deacetylase 10. Biochemistry 2021 60 303 313 7L2C 33789084 Crystallographic structure of neutralizing antibody 2-51 in complex with SARS-CoV-2 spike N-terminal domain (NTD) 2020-12-16 2021-02-10 Cerutti, G.,Guo, Y.,Zhou, T.,Gorman, J.,Lee, M.,Rapp, M.,Reddem, E.R.,Yu, J.,Bahna, F.,Bimela, J.,Huang, Y.,Katsamba, P.S.,Liu, L.,Nair, M.S.,Rawi, R.,Olia, A.S.,Wang, P.,Zhang, B.,Chuang, G.Y.,Ho, D.D.,Sheng, Z.,Kwong, P.D.,Shapiro, L. Potent SARS-CoV-2 neutralizing antibodies directed against spike N-terminal domain target a single supersite. Cell Host Microbe 2021 29 819 0 7L5B 33794145 Crystallographic structure of neutralizing antibody 2-15 in complex with SARS-CoV-2 spike receptor-binding Domain (RBD). 2020-12-21 2021-02-10 Rapp, M.,Guo, Y.,Reddem, E.R.,Yu, J.,Liu, L.,Wang, P.,Cerutti, G.,Katsamba, P.,Bimela, J.S.,Bahna, F.A.,Mannepalli, S.M.,Zhang, B.,Kwong, P.D.,Huang, Y.,Ho, D.D.,Shapiro, L.,Sheng, Z. Modular basis for potent SARS-CoV-2 neutralization by a prevalent VH1-2-derived antibody class. Cell Rep 2021 35 108950 108950 6M0Z 33850134 X-ray structure of Drosophila dopamine transporter with NET-like mutations (D121G/S426M/F471L) in L-norepinephrine bound form 2020-02-24 2021-02-17 Pidathala, S.,Mallela, A.K.,Joseph, D.,Penmatsa, A. Structural basis of norepinephrine recognition and transport inhibition in neurotransmitter transporters. Nat Commun 2021 12 2199 2199 6M3Z 33850134 X-ray structure of a Drosophila dopamine transporter with NET-like mutations (D121G/S426M/F471L) in milnacipran bound form 2020-03-04 2021-02-17 Pidathala, S.,Mallela, A.K.,Joseph, D.,Penmatsa, A. Structural basis of norepinephrine recognition and transport inhibition in neurotransmitter transporters. Nat Commun 2021 12 2199 2199 6WQX 33547416 Human PRPK-TPRKB complex 2020-04-29 2021-02-17 Li, J.,Ma, X.,Banerjee, S.,Chen, H.,Ma, W.,Bode, A.M.,Dong, Z. Crystal structure of the human PRPK-TPRKB complex. Commun Biol 2021 4 167 167 6WV9 33154105 Takifugu rubripes VKOR-like with vitamin K1 in noncatalytic state 2020-05-05 2021-02-24 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6VXU Structure of Human Vaccinia-related Kinase 1 (VRK1) bound to ACH471 2020-02-24 2021-03-03 Guimaraes, C.R.,Counago, R.M. Structure of Human Vaccinia-related Kinase 1 (VRK1) bound to ACH471 To Be Published 0 0 0 0 6WW9 33597306 Crystal structure of human REV7(R124A)-SHLD3(35-58) complex 2020-05-08 2021-03-03 Xie, W.,Wang, S.,Wang, J.,de la Cruz, M.J.,Xu, G.,Scaltriti, M.,Patel, D.J. Molecular mechanisms of assembly and TRIP13-mediated remodeling of the human Shieldin complex. Proc.Natl.Acad.Sci.USA 2021 118 0 0 6WWA 33597306 Crystal structure of human SHLD2-SHLD3-REV7 complex 2020-05-08 2021-03-03 Xie, W.,Wang, S.,Wang, J.,de la Cruz, M.J.,Xu, G.,Scaltriti, M.,Patel, D.J. Molecular mechanisms of assembly and TRIP13-mediated remodeling of the human Shieldin complex. Proc.Natl.Acad.Sci.USA 2021 118 0 0 6X1I 33683103 Two-Component D3 Assembly Constructed by Fusing Symmetric Oligomers to Coiled Coils 2020-05-18 2021-03-03 Laniado, J.,Cannon, K.A.,Miller, J.E.,Sawaya, M.R.,McNamara, D.E.,Yeates, T.O. Geometric Lessons and Design Strategies for Nanoscale Protein Cages. Acs Nano 2021 15 4277 4286 6XAR 33617900 Structure of CBL tyrosine kinase binding domain (TKBD) with C-terminal tail of Src-like kinase protein 2 (SLAP2) 2020-06-04 2021-03-03 Wybenga-Groot, L.E.,Tench, A.J.,Simpson, C.D.,Germain, J.S.,Raught, B.,Moran, M.F.,McGlade, C.J. SLAP2 Adaptor Binding Disrupts c-CBL Autoinhibition to Activate Ubiquitin Ligase Function. J.Mol.Biol. 2021 433 166880 166880 7JST 33795671 Crystal structure of SARS-CoV-2 3CL in apo form 2020-08-16 2021-03-03 Iketani, S.,Forouhar, F.,Liu, H.,Hong, S.J.,Lin, F.Y.,Nair, M.S.,Zask, A.,Huang, Y.,Xing, L.,Stockwell, B.R.,Chavez, A.,Ho, D.D. Lead compounds for the development of SARS-CoV-2 3CL protease inhibitors. Nat Commun 2021 12 2016 2016 7K3J 33574069 Crystal structure of dLC8 in complex with Panoramix TQT+TQ peptide 2020-09-11 2021-03-03 Schnabl, J.,Wang, J.,Hohmann, U.,Gehre, M.,Batki, J.,Andreev, V.I.,Purkhauser, K.,Fasching, N.,Duchek, P.,Novatchkova, M.,Mechtler, K.,Plaschka, C.,Patel, D.J.,Brennecke, J. Molecular principles of Piwi-mediated cotranscriptional silencing through the dimeric SFiNX complex. Genes Dev. 2021 35 392 409 7K3L 33574069 Crystal structure of dLC8 in complex with Panoramix TQ peptide 2020-09-11 2021-03-03 Schnabl, J.,Wang, J.,Hohmann, U.,Gehre, M.,Batki, J.,Andreev, V.I.,Purkhauser, K.,Fasching, N.,Duchek, P.,Novatchkova, M.,Mechtler, K.,Plaschka, C.,Patel, D.J.,Brennecke, J. Molecular principles of Piwi-mediated cotranscriptional silencing through the dimeric SFiNX complex. Genes Dev. 2021 35 392 409 7K9C 33619097 Crystal structure of Bacillus halodurans OapB (iodine-derivative) at 1.0 A 2020-09-29 2021-03-03 Yang, Y.,Harris, K.A.,Widner, D.L.,Breaker, R.R. Structure of a bacterial OapB protein with its OLE RNA target gives insights into the architecture of the OLE ribonucleoprotein complex. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7K9D 33619097 Crystal structure of Bacillus halodurans OapB in complex with its OLE RNA target (crystal form I) 2020-09-29 2021-03-03 Yang, Y.,Harris, K.A.,Widner, D.L.,Breaker, R.R. Structure of a bacterial OapB protein with its OLE RNA target gives insights into the architecture of the OLE ribonucleoprotein complex. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7K9E 33619097 Crystal structure of Bacillus halodurans OapB in complex with its OLE RNA target (crystal form II) 2020-09-29 2021-03-03 Yang, Y.,Harris, K.A.,Widner, D.L.,Breaker, R.R. Structure of a bacterial OapB protein with its OLE RNA target gives insights into the architecture of the OLE ribonucleoprotein complex. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7KKV 33619097 Crystal structure of Bacillus halodurans OapB in complex with its OLE RNA target (native, crystal form I) 2020-10-28 2021-03-03 Yang, Y.,Harris, K.A.,Widner, D.L.,Breaker, R.R. Structure of a bacterial OapB protein with its OLE RNA target gives insights into the architecture of the OLE ribonucleoprotein complex. Proc.Natl.Acad.Sci.USA 2021 118 0 0 6WVA 33154105 Takifugu rubripes VKOR-like with vitamin K1 epoxide at non-catalytic state 2020-05-05 2021-03-10 Liu, S.,Li, S.,Shen, G.,Sukumar, N.,Krezel, A.M.,Li, W. Structural basis of antagonizing the vitamin K catalytic cycle for anticoagulation. Science 2021 371 0 0 6X0C Tryptophan Synthase mutant beta-Q114A in complex with Cesium ion at the metal coordination site and aminoacrylate and benzimidazole at the enzyme beta site 2020-05-15 2021-03-10 Hilario, E.,Fan, L.,Dunn, M.F.,Mueller, L.J. External aldimine form of Tryptophan Synthase mutant beta-Q114A in complex with Cesium ion at the metal coordination site and benzimidazole at the enzyme beta site. To be Published 0 0 0 0 7JSU 33795671 Crystal structure of SARS-CoV-2 3CL protease in complex with GC376 2020-08-16 2021-03-10 Iketani, S.,Forouhar, F.,Liu, H.,Hong, S.J.,Lin, F.Y.,Nair, M.S.,Zask, A.,Huang, Y.,Xing, L.,Stockwell, B.R.,Chavez, A.,Ho, D.D. Lead compounds for the development of SARS-CoV-2 3CL protease inhibitors. Nat Commun 2021 12 2016 2016 7JVG 33631211 Cellular retinol-binding protein 2 (CRBP2) in complex with 1-arachidonoylglycerol 2020-08-21 2021-03-10 Silvaroli, J.A.,Plau, J.,Adams, C.H.,Banerjee, S.,Widjaja-Adhi, M.A.K.,Blaner, W.S.,Golczak, M. Molecular basis for the interaction of cellular retinol binding protein 2 (CRBP2) with nonretinoid ligands. J.Lipid Res. 2021 62 100054 100054 7JVY 33631211 Cellular retinol-binding protein 2 (CRBP2) in complex with 2-arachidonylglyceryl ether 2020-08-24 2021-03-10 Silvaroli, J.A.,Plau, J.,Adams, C.H.,Banerjee, S.,Widjaja-Adhi, M.A.K.,Blaner, W.S.,Golczak, M. Molecular basis for the interaction of cellular retinol binding protein 2 (CRBP2) with nonretinoid ligands. J.Lipid Res. 2021 62 100054 100054 7JW8 33795671 Crystal structure of SARS-CoV-2 3CL protease in complex with compound 4 in space group P1 2020-08-25 2021-03-10 Iketani, S.,Forouhar, F.,Liu, H.,Hong, S.J.,Lin, F.Y.,Nair, M.S.,Zask, A.,Huang, Y.,Xing, L.,Stockwell, B.R.,Chavez, A.,Ho, D.D. Lead compounds for the development of SARS-CoV-2 3CL protease inhibitors. Nat Commun 2021 12 2016 2016 7JWD 33631211 Cellular retinol-binding protein 2 (CRBP2) in complex with 2-linoleoylglycerol 2020-08-25 2021-03-10 Silvaroli, J.A.,Plau, J.,Adams, C.H.,Banerjee, S.,Widjaja-Adhi, M.A.K.,Blaner, W.S.,Golczak, M. Molecular basis for the interaction of cellular retinol binding protein 2 (CRBP2) with nonretinoid ligands. J.Lipid Res. 2021 62 100054 100054 7JWR 33631211 Cellular retinol-binding protein 2 (CRBP2) in complex with 2-oleoylglycerol 2020-08-26 2021-03-10 Silvaroli, J.A.,Plau, J.,Adams, C.H.,Banerjee, S.,Widjaja-Adhi, M.A.K.,Blaner, W.S.,Golczak, M. Molecular basis for the interaction of cellular retinol binding protein 2 (CRBP2) with nonretinoid ligands. J.Lipid Res. 2021 62 100054 100054 7JX2 33631211 Cellular retinol-binding protein 2 (CRBP2) in complex with 2-palmitoylglycerol 2020-08-26 2021-03-10 Silvaroli, J.A.,Plau, J.,Adams, C.H.,Banerjee, S.,Widjaja-Adhi, M.A.K.,Blaner, W.S.,Golczak, M. Molecular basis for the interaction of cellular retinol binding protein 2 (CRBP2) with nonretinoid ligands. J.Lipid Res. 2021 62 100054 100054 7JZ5 33631211 Cellular retinol-binding protein 2 (CRBP2) in complex with 1-arachodonoyl-1-thio-glycerol 2020-09-01 2021-03-10 Silvaroli, J.A.,Plau, J.,Adams, C.H.,Banerjee, S.,Widjaja-Adhi, M.A.K.,Blaner, W.S.,Golczak, M. Molecular basis for the interaction of cellular retinol binding protein 2 (CRBP2) with nonretinoid ligands. J.Lipid Res. 2021 62 100054 100054 7KG7 33636189 Structure of human PARG complexed with PARG-292 2020-10-16 2021-03-10 Brosey, C.A.,Houl, J.H.,Katsonis, P.,Balapiti-Modarage, L.P.F.,Bommagani, S.,Arvai, A.,Moiani, D.,Bacolla, A.,Link, T.,Warden, L.S.,Lichtarge, O.,Jones, D.E.,Ahmed, Z.,Tainer, J.A. Targeting SARS-CoV-2 Nsp3 macrodomain structure with insights from human poly(ADP-ribose) glycohydrolase (PARG) structures with inhibitors. Prog.Biophys.Mol.Biol. 2021 163 171 186 6M6R 34403472 Crystal structure of Caenorhabditis elegans Dicer-related helicase 3 (DRH-3) C-terminal domain with 5'-ppp 8-mer ssRNA 2020-03-16 2021-03-17 Li, K.,Zheng, J.,Wirawan, M.,Trinh, N.M.,Fedorova, O.,Griffin, P.R.,Pyle, A.M.,Luo, D. Insights into the structure and RNA-binding specificity of Caenorhabditis elegans Dicer-related helicase 3 (DRH-3). Nucleic Acids Res. 2021 49 9978 9991 6M6S 34403472 Crystal structure of Caenorhabditis elegans Dicer-related helicase 3 (DRH-3) C-terminal domain with 5'-ppp 12-mer dsRNA 2020-03-16 2021-03-17 Li, K.,Zheng, J.,Wirawan, M.,Trinh, N.M.,Fedorova, O.,Griffin, P.R.,Pyle, A.M.,Luo, D. Insights into the structure and RNA-binding specificity of Caenorhabditis elegans Dicer-related helicase 3 (DRH-3). Nucleic Acids Res. 2021 49 9978 9991 7JT7 33795671 Crystal structure of SARS-CoV-2 3CL protease in complex with compound 4 2020-08-17 2021-03-17 Iketani, S.,Forouhar, F.,Liu, H.,Hong, S.J.,Lin, F.Y.,Nair, M.S.,Zask, A.,Huang, Y.,Xing, L.,Stockwell, B.R.,Chavez, A.,Ho, D.D. Lead compounds for the development of SARS-CoV-2 3CL protease inhibitors. Nat Commun 2021 12 2016 2016 7K30 33658373 Crystal structure of Endonuclease Q complex with 27-mer duplex substrate with dU at the active site 2020-09-10 2021-03-17 Shi, K.,Moeller, N.H.,Banerjee, S.,McCann, J.L.,Carpenter, M.A.,Yin, L.,Moorthy, R.,Orellana, K.,Harki, D.A.,Harris, R.S.,Aihara, H. Structural basis for recognition of distinct deaminated DNA lesions by endonuclease Q. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7K31 33658373 Crystal structure of Endonuclease Q complex with 27-mer duplex substrate with dI at the active site 2020-09-10 2021-03-17 Shi, K.,Moeller, N.H.,Banerjee, S.,McCann, J.L.,Carpenter, M.A.,Yin, L.,Moorthy, R.,Orellana, K.,Harki, D.A.,Harris, R.S.,Aihara, H. Structural basis for recognition of distinct deaminated DNA lesions by endonuclease Q. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7K32 33658373 Crystal structure of Endonuclease Q complex with 27-mer duplex substrate with an abasic lesion at the active site 2020-09-10 2021-03-17 Shi, K.,Moeller, N.H.,Banerjee, S.,McCann, J.L.,Carpenter, M.A.,Yin, L.,Moorthy, R.,Orellana, K.,Harki, D.A.,Harris, R.S.,Aihara, H. Structural basis for recognition of distinct deaminated DNA lesions by endonuclease Q. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7K33 33658373 Crystal structure of Endonuclease Q complex with 27-mer duplex substrate with an abasic lesion at the active site 2020-09-10 2021-03-17 Shi, K.,Moeller, N.H.,Banerjee, S.,McCann, J.L.,Carpenter, M.A.,Yin, L.,Moorthy, R.,Orellana, K.,Harki, D.A.,Harris, R.S.,Aihara, H. Structural basis for recognition of distinct deaminated DNA lesions by endonuclease Q. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7LVC 35916223 E. coli DHFR by Native Mn,P,S-SAD at Room Temperature 2021-02-24 2021-03-17 Greisman, J.B.,Dalton, K.M.,Sheehan, C.J.,Klureza, M.A.,Kurinov, I.,Hekstra, D.R. Native SAD phasing at room temperature. Acta Crystallogr D Struct Biol 2022 78 986 996 6WA2 34668706 Crystal structure of EGFR(T790M/V948R) in complex with LN3753 2020-03-24 2021-03-31 Wittlinger, F.,Heppner, D.E.,To, C.,Gunther, M.,Shin, B.H.,Rana, J.K.,Schmoker, A.M.,Beyett, T.S.,Berger, L.M.,Berger, B.T.,Bauer, N.,Vasta, J.D.,Corona, C.R.,Robers, M.B.,Knapp, S.,Janne, P.A.,Eck, M.J.,Laufer, S.A. Design of a ""Two-in-One"" Mutant-Selective Epidermal Growth Factor Receptor Inhibitor That Spans the Orthosteric and Allosteric Sites. J.Med.Chem. 2022 65 1370 1383 6WAK 34668706 A crystal structure of EGFR(T790M/V948R) in complex with LN3754 2020-03-25 2021-03-31 Wittlinger, F.,Heppner, D.E.,To, C.,Gunther, M.,Shin, B.H.,Rana, J.K.,Schmoker, A.M.,Beyett, T.S.,Berger, L.M.,Berger, B.T.,Bauer, N.,Vasta, J.D.,Corona, C.R.,Robers, M.B.,Knapp, S.,Janne, P.A.,Eck, M.J.,Laufer, S.A. Design of a ""Two-in-One"" Mutant-Selective Epidermal Growth Factor Receptor Inhibitor That Spans the Orthosteric and Allosteric Sites. J.Med.Chem. 2022 65 1370 1383 6WQU 33775697 CSL (RBPJ) bound to Notch3 RAM and DNA 2020-04-29 2021-03-31 Landor, S.K.J.,Santio, N.M.,Eccleshall, W.B.,Paramonov, V.M.,Gagliani, E.K.,Hall, D.,Jin, S.B.,Dahlstrom, K.M.,Salminen, T.A.,Rivero-Muller, A.,Lendahl, U.,Kovall, R.A.,Koskinen, P.J.,Sahlgren, C. PIM-induced phosphorylation of Notch3 promotes breast cancer tumorigenicity in a CSL-independent fashion. J.Biol.Chem. 2021 296 100593 100593 7E0W Crystal Structure of BCH domain from S. pombe 2021-01-28 2021-03-31 Chichili, V.P.R.,Chew, T.W.,Er, S.Y.,Chin, C.F.,Shankar, S.,Jobichen, C.,Pan, Q.C.,Zhou, Y.T.,Yeong, F.M.,Low, B.C.,Sivaraman, J. A novel intertwined anti-parallel dimeric structure of scaffold BCH domain regulates RhoA and RhoGAP functions Proc.Natl.Acad.Sci.USA 2021 0 0 0 7LBA 33857156 E. coli Agmatinase 2021-01-07 2021-03-31 Chitrakar, I.,Ahmed, S.F.,Torelli, A.T.,French, J.B. Structure of the E. coli agmatinase, SPEB. Plos One 2021 16 0 0 6WL5 33976201 Crystal structure of EcmrR C-terminal domain 2020-04-18 2021-04-07 Yang, Y.,Liu, C.,Zhou, W.,Shi, W.,Chen, M.,Zhang, B.,Schatz, D.G.,Hu, Y.,Liu, B. Structural visualization of transcription activated by a multidrug-sensing MerR family regulator. Nat Commun 2021 12 2702 2702 7K7J 33770085 EphB6 receptor ectodomain 2020-09-22 2021-04-07 Mason, E.O.,Goldgur, Y.,Robev, D.,Freywald, A.,Nikolov, D.B.,Himanen, J.P. Structure of the EphB6 receptor ectodomain. Plos One 2021 16 0 0 7KQ4 33773110 Structure of isethionate sulfite-lyase from Bilophila wadsworthia with glycerol bound 2020-11-13 2021-04-07 Dawson, C.D.,Irwin, S.M.,Backman, L.R.F.,Le, C.,Wang, J.X.,Vennelakanti, V.,Yang, Z.,Kulik, H.J.,Drennan, C.L.,Balskus, E.P. Molecular basis of C-S bond cleavage in the glycyl radical enzyme isethionate sulfite-lyase. Cell Chem Biol 2021 28 1333 0 7LCM 33599047 Receiver Domain of RssB bound to beryllofluoride 2021-01-11 2021-04-07 Schwartz, J.,Son, J.,Brugger, C.,Deaconescu, A.M. Phospho-dependent signaling during the general stress response by the atypical response regulator and ClpXP adaptor RssB. Protein Sci. 2021 30 899 907 7MBK 33242393 N-terminal domain of mouse surfactant protein B, 6W mutant 2021-03-31 2021-04-14 Sever, N.,Milicic, G.,Bodnar, N.O.,Wu, X.,Rapoport, T.A. Mechanism of Lamellar Body Formation by Lung Surfactant Protein B. Mol.Cell 2021 81 49 0 7M0T 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP and Selumetinib 2021-03-11 2021-04-21 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7M0U 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP and Binimetinib 2021-03-11 2021-04-21 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7M0V 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP and Cobimetinib 2021-03-11 2021-04-21 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7M0W 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP and Pimasertib 2021-03-11 2021-04-21 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7M0X 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP and PD0325901 2021-03-11 2021-04-21 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7M0Y 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP and Trametinib 2021-03-11 2021-04-21 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7M0Z 34470822 Crystal structure of the BRAF:MEK1 kinases in complex with AMPPNP and CH5126766 2021-03-11 2021-04-21 Gonzalez-Del Pino, G.L.,Li, K.,Park, E.,Schmoker, A.M.,Ha, B.H.,Eck, M.J. Allosteric MEK inhibitors act on BRAF/MEK complexes to block MEK activation. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7MD7 33916420 Crystal structure of the Thermus thermophilus 70S ribosome in complex with triphenylphosphonium analog of chloramphenicol CAM-C4-TPP and protein Y (YfiA) at 2.80A resolution 2021-04-03 2021-04-21 Chen, C.W.,Pavlova, J.A.,Lukianov, D.A.,Tereshchenkov, A.G.,Makarov, G.I.,Khairullina, Z.Z.,Tashlitsky, V.N.,Paleskava, A.,Konevega, A.L.,Bogdanov, A.A.,Osterman, I.A.,Sumbatyan, N.V.,Polikanov, Y.S. Binding and Action of Triphenylphosphonium Analog of Chloramphenicol upon the Bacterial Ribosome. Antibiotics 2021 10 0 0 6WRV 33879614 Crystal structure of computationally designed protein 3DS18 in complex with the human Transferrin receptor ectodomain 2020-04-30 2021-04-28 Sahtoe, D.D.,Coscia, A.,Mustafaoglu, N.,Miller, L.M.,Olal, D.,Vulovic, I.,Yu, T.Y.,Goreshnik, I.,Lin, Y.R.,Clark, L.,Busch, F.,Stewart, L.,Wysocki, V.H.,Ingber, D.E.,Abraham, J.,Baker, D. Transferrin receptor targeting by de novo sheet extension. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7K5J 33888705 Structure of an E1-E2-ubiquitin thioester mimetic 2020-09-16 2021-04-28 Yuan, L.,Lv, Z.,Adams, M.J.,Olsen, S.K. Crystal structures of an E1-E2-ubiquitin thioester mimetic reveal molecular mechanisms of transthioesterification. Nat Commun 2021 12 2370 2370 6WTL Structure of Human pir-miRNA-19b-2 Apical Loop and One-base-pair Fused to the YdaO Riboswitch Scaffold 2020-05-03 2021-05-05 Shoffner, G.M.,Peng, Z.,Guo, F. Three-dimensional structures of pri-miRNA apical junctions and loops revealed by scaffold-directed crystallography To Be Published 0 0 0 0 7LW3 34078893 Structure of SARS-CoV-2 nsp16/nsp10 complex in presence of Cap-1 analog (m7GpppAmU) and SAH 2021-02-27 2021-05-05 Viswanathan, T.,Misra, A.,Chan, S.H.,Qi, S.,Dai, N.,Arya, S.,Martinez-Sobrido, L.,Gupta, Y.K. A metal ion orients SARS-CoV-2 mRNA to ensure accurate 2'-O methylation of its first nucleotide. Nat Commun 2021 12 3287 3287 7LW4 34078893 Structure of SARS-CoV-2 nsp16/nsp10 complex in presence of S-adenosyl-L-homocysteine (SAH) 2021-02-27 2021-05-05 Viswanathan, T.,Misra, A.,Chan, S.H.,Qi, S.,Dai, N.,Arya, S.,Martinez-Sobrido, L.,Gupta, Y.K. A metal ion orients SARS-CoV-2 mRNA to ensure accurate 2'-O methylation of its first nucleotide. Nat Commun 2021 12 3287 3287 7MC5 35165203 Crystal structure of the SARS-CoV-2 ExoN-nsp10 complex 2021-04-01 2021-05-05 Moeller, N.H.,Shi, K.,Demir, O.,Belica, C.,Banerjee, S.,Yin, L.,Durfee, C.,Amaro, R.E.,Aihara, H. Structure and dynamics of SARS-CoV-2 proofreading exoribonuclease ExoN. Proc.Natl.Acad.Sci.USA 2022 119 0 0 7MC6 35165203 Crystal structure of the SARS-CoV-2 ExoN-nsp10 complex containing Mg2+ ion 2021-04-01 2021-05-05 Moeller, N.H.,Shi, K.,Demir, O.,Belica, C.,Banerjee, S.,Yin, L.,Durfee, C.,Amaro, R.E.,Aihara, H. Structure and dynamics of SARS-CoV-2 proofreading exoribonuclease ExoN. Proc.Natl.Acad.Sci.USA 2022 119 0 0 7EDD 33929828 Crystal structure of a serine protease from Streptococcus pyogenes 2021-03-15 2021-05-12 Jobichen, C.,Ying Chong, T.,Hui Ling, T.,Sivaraman, J. The Autocatalytic Cleavage Domain Is Not Required for the Activity of ScpC, a Virulence Protease from Streptococcus pyogenes : A Structural Insight. Biochemistry 2021 60 1564 1568 7KM6 33921405 APOBEC3B antibody 5G7 Fv-clasp 2020-11-02 2021-05-12 Tang, H.,Demir, O.,Kurniawan, F.,Brown, W.L.,Shi, K.,Moeller, N.H.,Carpenter, M.A.,Belica, C.,Orellana, K.,Du, G.,LeBeau, A.M.,Amaro, R.E.,Harris, R.S.,Aihara, H. Structural Characterization of a Minimal Antibody against Human APOBEC3B. Viruses 2021 13 0 0 7KZI Intermediate state (QQQ) of near full-length DnaK alternatively fused with a substrate peptide 2020-12-10 2021-05-12 Wang, W.,Hendrickson, W.A. Intermediates in allosteric equilibria of DnaK-ATP interactions with substrate peptides Acta Crystallogr.,Sect.D 2021 77 606 617 7KZU Quasi-intermediate state (Q) of a truncated Hsp70 DnaK fused with a substrate peptide 2020-12-10 2021-05-12 Wang, W.,Hendrickson, W.A. Intermediates in allosteric equilibria of DnaK-ATP interactions with substrate peptides Acta Crystallogr.,Sect.D 2021 77 606 617 7LUO 33989513 N-terminus of Skp2 bound to Cyclin A 2021-02-22 2021-05-12 Kelso, S.,Orlicky, S.,Beenstock, J.,Ceccarelli, D.F.,Kurinov, I.,Gish, G.,Sicheri, F. Bipartite binding of the N terminus of Skp2 to cyclin A. Structure 2021 29 975 0 7MM1 35916223 PTP1B in complex with TCS401 by Native S-SAD at Room Temperature 2021-04-29 2021-05-12 Greisman, J.B.,Dalton, K.M.,Sheehan, C.J.,Klureza, M.A.,Kurinov, I.,Hekstra, D.R. Native SAD phasing at room temperature. Acta Crystallogr D Struct Biol 2022 78 986 996 6XPR 34060327 Human antibody D2 H1-1/H3-1 H3 in complex with the influenza hemagglutinin head domain of A/Texas/50/2012(H3N2) 2020-07-08 2021-05-19 McCarthy, K.R.,Lee, J.,Watanabe, A.,Kuraoka, M.,Robinson-McCarthy, L.R.,Georgiou, G.,Kelsoe, G.,Harrison, S.C. A Prevalent Focused Human Antibody Response to the Influenza Virus Hemagglutinin Head Interface. Mbio 2021 12 0 0 6XPY 34060327 Human antibody S1V2-58 in complex with the influenza hemagglutinin head domain of A/Texas/50/2012(H3N2) 2020-07-09 2021-05-19 McCarthy, K.R.,Lee, J.,Watanabe, A.,Kuraoka, M.,Robinson-McCarthy, L.R.,Georgiou, G.,Kelsoe, G.,Harrison, S.C. A Prevalent Focused Human Antibody Response to the Influenza Virus Hemagglutinin Head Interface. Mbio 2021 12 0 0 6XPZ 34060327 Human antibody S1V2-83 in complex with the influenza hemagglutinin head domain of A/Moscow/10/1999(H3N2) 2020-07-09 2021-05-19 McCarthy, K.R.,Lee, J.,Watanabe, A.,Kuraoka, M.,Robinson-McCarthy, L.R.,Georgiou, G.,Kelsoe, G.,Harrison, S.C. A Prevalent Focused Human Antibody Response to the Influenza Virus Hemagglutinin Head Interface. Mbio 2021 12 0 0 6XQ2 34060327 Human antibody S8V2-37 in complex with the influenza hemagglutinin head domain of A/Texas/50/2012(H3N2) 2020-07-09 2021-05-19 McCarthy, K.R.,Lee, J.,Watanabe, A.,Kuraoka, M.,Robinson-McCarthy, L.R.,Georgiou, G.,Kelsoe, G.,Harrison, S.C. A Prevalent Focused Human Antibody Response to the Influenza Virus Hemagglutinin Head Interface. Mbio 2021 12 0 0 6XQ4 34060327 Human antibody S8V2-47 in complex with the influenza hemagglutinin head domain of A/Beijing/262/1995(H1N1) 2020-07-09 2021-05-19 McCarthy, K.R.,Lee, J.,Watanabe, A.,Kuraoka, M.,Robinson-McCarthy, L.R.,Georgiou, G.,Kelsoe, G.,Harrison, S.C. A Prevalent Focused Human Antibody Response to the Influenza Virus Hemagglutinin Head Interface. Mbio 2021 12 0 0 7JW9 34029591 Ternary cocrystal structure of alkanesulfonate monooxygenase MsuD from Pseudomonas fluorescens 2020-08-25 2021-05-26 Liew, J.J.M.,El Saudi, I.M.,Nguyen, S.V.,Wicht, D.K.,Dowling, D.P. Structures of the alkanesulfonate monooxygenase MsuD provide insight into C-S bond cleavage, substrate scope, and an unexpected role for the tetramer. J.Biol.Chem. 2021 297 100823 100823 7JYB 34029591 Binary soak structure of alkanesulfonate monooxygenase MsuD from Pseudomonas fluorescens with FMN 2020-08-30 2021-05-26 Liew, J.J.M.,El Saudi, I.M.,Nguyen, S.V.,Wicht, D.K.,Dowling, D.P. Structures of the alkanesulfonate monooxygenase MsuD provide insight into C-S bond cleavage, substrate scope, and an unexpected role for the tetramer. J.Biol.Chem. 2021 297 100823 100823 7K14 34029591 Ternary soak structure of alkanesulfonate monooxygenase MsuD from Pseudomonas fluorescens with FMN and methanesulfonate 2020-09-07 2021-05-26 Liew, J.J.M.,El Saudi, I.M.,Nguyen, S.V.,Wicht, D.K.,Dowling, D.P. Structures of the alkanesulfonate monooxygenase MsuD provide insight into C-S bond cleavage, substrate scope, and an unexpected role for the tetramer. J.Biol.Chem. 2021 297 100823 100823 7L0Z 33376189 Spinach variant bound to DFHBI-1T 2020-12-13 2021-05-26 Jeng, S.C.Y.,Trachman III, R.J.,Weissenboeck, F.,Truong, L.,Link, K.A.,Jepsen, M.D.E.,Knutson, J.R.,Andersen, E.S.,Ferre-D'Amare, A.R.,Unrau, P.J. Fluorogenic aptamers resolve the flexibility of RNA junctions using orientation-dependent FRET. Rna 2021 27 433 444 7MKY 34845084 SARS-CoV-2 frameshifting pseudoknot RNA 2021-04-27 2021-05-26 Jones, C.P.,Ferre-D'Amare, A.R. Crystal structure of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) frameshifting pseudoknot. Rna 2022 28 239 249 7MQW Histidine triad protein 2021-05-06 2021-05-26 Ghosh, S.,Goldgur, Y.,Shuman, S. Histidine triad protein Unpublished 0 0 0 0 7LJN 34077735 Structure of the Bradyrhizobium diazoefficiens CD-NTase CdnG in complex with GTP 2021-01-29 2021-06-02 Govande, A.A.,Duncan-Lowey, B.,Eaglesham, J.B.,Whiteley, A.T.,Kranzusch, P.J. Molecular basis of CD-NTase nucleotide selection in CBASS anti-phage defense. Cell Rep 2021 35 109206 109206 7LJO 34077735 Structure of the Bacteroides fragilis CD-NTase CdnB in complex with ADP 2021-01-29 2021-06-02 Govande, A.A.,Duncan-Lowey, B.,Eaglesham, J.B.,Whiteley, A.T.,Kranzusch, P.J. Molecular basis of CD-NTase nucleotide selection in CBASS anti-phage defense. Cell Rep 2021 35 109206 109206 7LPS 34035522 Crystal structure of DDB1-CRBN-ALV1 complex bound to Helios (IKZF2 ZF2) 2021-02-12 2021-06-02 Wang, E.S.,Verano, A.L.,Nowak, R.P.,Yuan, J.C.,Donovan, K.A.,Eleuteri, N.A.,Yue, H.,Ngo, K.H.,Lizotte, P.H.,Gokhale, P.C.,Gray, N.S.,Fischer, E.S. Acute pharmacological degradation of Helios destabilizes regulatory T cells. Nat.Chem.Biol. 2021 17 711 717 6XAW Crystal Structure Analysis of SIN3-UME6 2020-06-04 2021-06-09 Seo, H.-S. Crystal Structure Analysis of SIN3-UME6 To be published 0 0 0 0 7D5P 34226658 Structure of NorC transporter in an outward-open conformation in complex with a single-chain Indian camelid antibody 2020-09-27 2021-06-09 Kumar, S.,Athreya, A.,Gulati, A.,Nair, R.M.,Mahendran, I.,Ranjan, R.,Penmatsa, A. Structural basis of inhibition of a transporter from Staphylococcus aureus, NorC, through a single-domain camelid antibody. Commun Biol 2021 4 836 836 7D5Q 34226658 Structure of NorC transporter (K398A mutant) in an outward-open conformation in complex with a single-chain Indian camelid antibody 2020-09-27 2021-06-09 Kumar, S.,Athreya, A.,Gulati, A.,Nair, R.M.,Mahendran, I.,Ranjan, R.,Penmatsa, A. Structural basis of inhibition of a transporter from Staphylococcus aureus, NorC, through a single-domain camelid antibody. Commun Biol 2021 4 836 836 7N51 35025633 Structure of a bacterial gasdermin from Vitiosangium sp. 2021-06-04 2021-06-16 Johnson, A.G.,Wein, T.,Mayer, M.L.,Duncan-Lowey, B.,Yirmiya, E.,Oppenheimer-Shaanan, Y.,Amitai, G.,Sorek, R.,Kranzusch, P.J. Bacterial gasdermins reveal an ancient mechanism of cell death. Science 2022 375 221 225 6WU5 34089643 Human Calcium and Integrin Binding Protein 3 2020-05-04 2021-06-23 Liang, X.,Qiu, X.,Dionne, G.,Cunningham, C.L.,Pucak, M.L.,Peng, G.,Kim, Y.H.,Lauer, A.,Shapiro, L.,Muller, U. CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells. Neuron 2021 109 2131 0 6WU7 34089643 Human Calcium and Integrin Binding Protein 3 E150Q K151H 2020-05-04 2021-06-23 Liang, X.,Qiu, X.,Dionne, G.,Cunningham, C.L.,Pucak, M.L.,Peng, G.,Kim, Y.H.,Lauer, A.,Shapiro, L.,Muller, U. CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells. Neuron 2021 109 2131 0 6WUD 34089643 Human Calcium and Integrin Binding Protein 3 Bound to TMC1 Residues 303-347 2020-05-04 2021-06-23 Liang, X.,Qiu, X.,Dionne, G.,Cunningham, C.L.,Pucak, M.L.,Peng, G.,Kim, Y.H.,Lauer, A.,Shapiro, L.,Muller, U. CIB2 and CIB3 are auxiliary subunits of the mechanotransduction channel of hair cells. Neuron 2021 109 2131 0 7MGR 34437808 SARS-CoV-2 main protease in complex with nsp8/9 substrate peptide 2021-04-13 2021-06-23 MacDonald, E.A.,Frey, G.,Namchuk, M.N.,Harrison, S.C.,Hinshaw, S.M.,Windsor, I.W. Recognition of Divergent Viral Substrates by the SARS-CoV-2 Main Protease. Acs Infect Dis. 2021 7 2591 2595 7MGS 34437808 SARS-CoV-2 main protease in complex with N-terminal autoprocessing substrate 2021-04-13 2021-06-23 MacDonald, E.A.,Frey, G.,Namchuk, M.N.,Harrison, S.C.,Hinshaw, S.M.,Windsor, I.W. Recognition of Divergent Viral Substrates by the SARS-CoV-2 Main Protease. Acs Infect Dis. 2021 7 2591 2595 7N50 35025633 Structure of a bacterial gasdermin from Bradyrhizobium tropiciagri 2021-06-04 2021-06-23 Johnson, A.G.,Wein, T.,Mayer, M.L.,Duncan-Lowey, B.,Yirmiya, E.,Oppenheimer-Shaanan, Y.,Amitai, G.,Sorek, R.,Kranzusch, P.J. Bacterial gasdermins reveal an ancient mechanism of cell death. Science 2022 375 221 225 7N52 35025633 Structure of a bacterial gasdermin from Runella zeae 2021-06-04 2021-06-23 Johnson, A.G.,Wein, T.,Mayer, M.L.,Duncan-Lowey, B.,Yirmiya, E.,Oppenheimer-Shaanan, Y.,Amitai, G.,Sorek, R.,Kranzusch, P.J. Bacterial gasdermins reveal an ancient mechanism of cell death. Science 2022 375 221 225 7JK1 34188055 Human PrimPol inserting correct dCTP opposite the 8-oxoguanine lesion 2020-07-27 2021-06-30 Rechkoblit, O.,Johnson, R.E.,Gupta, Y.K.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis of DNA synthesis opposite 8-oxoguanine by human PrimPol primase-polymerase. Nat Commun 2021 12 4020 4020 7JKL 34188055 Human PrimPol misinserting dATP opposite the 8-oxoguanine lesion (3'-end base of the primer strand is 2',3'-dideoxy-terminated). 2020-07-28 2021-06-30 Rechkoblit, O.,Johnson, R.E.,Gupta, Y.K.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis of DNA synthesis opposite 8-oxoguanine by human PrimPol primase-polymerase. Nat Commun 2021 12 4020 4020 7JKP 34188055 Human PrimPol misinserting dATP opposite the 8-oxoguanine lesion 2020-07-28 2021-06-30 Rechkoblit, O.,Johnson, R.E.,Gupta, Y.K.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis of DNA synthesis opposite 8-oxoguanine by human PrimPol primase-polymerase. Nat Commun 2021 12 4020 4020 7JL8 34188055 Human PrimPol extending from the correct primer base C opposite the 8-oxoguanine lesion 2020-07-29 2021-06-30 Rechkoblit, O.,Johnson, R.E.,Gupta, Y.K.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis of DNA synthesis opposite 8-oxoguanine by human PrimPol primase-polymerase. Nat Commun 2021 12 4020 4020 7JLG 34188055 Human PrimPol extending from the erroneous primer base A opposite the 8-oxoguanine lesion 2020-07-29 2021-06-30 Rechkoblit, O.,Johnson, R.E.,Gupta, Y.K.,Prakash, L.,Prakash, S.,Aggarwal, A.K. Structural basis of DNA synthesis opposite 8-oxoguanine by human PrimPol primase-polymerase. Nat Commun 2021 12 4020 4020 7LJ4 34390650 Human TRAAK K+ channel FHEIG mutant A270P in a K+ bound conductive conformation 2021-01-28 2021-06-30 Rietmeijer, R.A.,Sorum, B.,Li, B.,Brohawn, S.G. Physical basis for distinct basal and mechanically gated activity of the human K + channel TRAAK. Neuron 2021 109 2902 0 7LJA 34390650 Human TRAAK K+ channel FHEIG mutant A198E in a Tl+ bound conductive conformation 2021-01-28 2021-06-30 Rietmeijer, R.A.,Sorum, B.,Li, B.,Brohawn, S.G. Physical basis for distinct basal and mechanically gated activity of the human K + channel TRAAK. Neuron 2021 109 2902 0 7LJB 34390650 Human TRAAK K+ channel mutant G158D in a K+ bound conductive conformation 2021-01-28 2021-06-30 Rietmeijer, R.A.,Sorum, B.,Li, B.,Brohawn, S.G. Physical basis for distinct basal and mechanically gated activity of the human K + channel TRAAK. Neuron 2021 109 2902 0 7N80 34001596 Crystal Structure of PI5P4KIIBeta 2021-06-11 2021-06-30 Chen, S.,Chandra Tjin, C.,Gao, X.,Xue, Y.,Jiao, H.,Zhang, R.,Wu, M.,He, Z.,Ellman, J.,Ha, Y. Pharmacological inhibition of PI5P4K alpha / beta disrupts cell energy metabolism and selectively kills p53-null tumor cells. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7N81 34001596 Crystal Structure of PI5P4KIIBeta complex with CC260 2021-06-11 2021-06-30 Chen, S.,Chandra Tjin, C.,Gao, X.,Xue, Y.,Jiao, H.,Zhang, R.,Wu, M.,He, Z.,Ellman, J.,Ha, Y. Pharmacological inhibition of PI5P4K alpha / beta disrupts cell energy metabolism and selectively kills p53-null tumor cells. Proc.Natl.Acad.Sci.USA 2021 118 0 0 7KIH 34354069 Crystal structure of the mouse lipin-1 M-Lip domain 2020-10-23 2021-07-07 Gu, W.,Gao, S.,Wang, H.,Fleming, K.D.,Hoffmann, R.M.,Yang, J.W.,Patel, N.M.,Choi, Y.M.,Burke, J.E.,Reue, K.,Airola, M.V. The middle lipin domain adopts a membrane-binding dimeric protein fold. Nat Commun 2021 12 4718 4718 7LHR 34095667 Crystal structure of adenosine-5'-phosphosulfate reductase from Mycobacterium tuberculosis 2021-01-26 2021-07-07 Feliciano, P.R.,Carroll, K.S.,Drennan, C.L. Crystal Structure of the [4Fe-4S] Cluster-Containing Adenosine-5'-phosphosulfate Reductase from Mycobacterium tuberculosis . Acs Omega 2021 6 13756 13765 7LHS 34095667 Crystal structure of adenosine-5'-phosphosulfate reductase from Mycobacterium tuberculosis in a complex with substrate APS 2021-01-26 2021-07-07 Feliciano, P.R.,Carroll, K.S.,Drennan, C.L. Crystal Structure of the [4Fe-4S] Cluster-Containing Adenosine-5'-phosphosulfate Reductase from Mycobacterium tuberculosis . Acs Omega 2021 6 13756 13765 7LHU 34095667 Crystal structure of adenosine-5'-phosphosulfate reductase from Mycobacterium tuberculosis in a complex with product AMP 2021-01-26 2021-07-07 Feliciano, P.R.,Carroll, K.S.,Drennan, C.L. Crystal Structure of the [4Fe-4S] Cluster-Containing Adenosine-5'-phosphosulfate Reductase from Mycobacterium tuberculosis . Acs Omega 2021 6 13756 13765 7R98 34381460 Structure of the SARS-CoV-2 N protein RNA-binding domain bound to single-domain antibody B6 2021-06-28 2021-07-07 Ye, Q.,Lu, S.,Corbett, K.D. Structural Basis for SARS-CoV-2 Nucleocapsid Protein Recognition by Single-Domain Antibodies. Front Immunol 2021 12 719037 719037 6XQV 34529975 Crystal structure of the catalytic domain of PBP2 S310A from Neisseria gonorrhoeae in a pre-acylation complex with ceftriaxone 2020-07-10 2021-07-21 Fenton, B.A.,Tomberg, J.,Sciandra, C.A.,Nicholas, R.A.,Davies, C.,Zhou, P. Mutations in PBP2 from ceftriaxone-resistant Neisseria gonorrhoeae alter the dynamics of the beta 3-beta 4 loop to favor a low-affinity drug-binding state. J.Biol.Chem. 2021 297 101188 101188 6XST Recombinant Beta-2-Glycoprotein I with putative membrane insertion loop 2020-07-16 2021-07-21 Klenotic, P.A.,Yu, E.W.Y. Beta-2-Glycoprotein I and it's role in APS To Be Published 0 0 0 0 7LRN 34308084 Structure of the Siderophore Interacting Protein from Acinetbacter baumannii 2021-02-16 2021-07-21 Valentino, H.,Korasick, D.A.,Bohac, T.J.,Shapiro, J.A.,Wencewicz, T.A.,Tanner, J.J.,Sobrado, P. Structural and Biochemical Characterization of the Flavin-Dependent Siderophore-Interacting Protein from Acinetobacter baumannii . Acs Omega 2021 6 18537 18547 7LZ0 34161757 Structure of glutamate receptor-like channel GLR3.4 ligand-binding domain in complex with glutamate 2021-03-08 2021-07-28 Green, M.N.,Gangwar, S.P.,Michard, E.,Simon, A.A.,Portes, M.T.,Barbosa-Caro, J.,Wudick, M.M.,Lizzio, M.A.,Klykov, O.,Yelshanskaya, M.V.,Feijo, J.A.,Sobolevsky, A.I. Structure of the Arabidopsis thaliana glutamate receptor-like channel GLR3.4. Mol.Cell 2021 81 3216 0 7LZ1 34161757 Structure of glutamate receptor-like channel GLR3.4 ligand-binding domain in complex with serine 2021-03-08 2021-07-28 Green, M.N.,Gangwar, S.P.,Michard, E.,Simon, A.A.,Portes, M.T.,Barbosa-Caro, J.,Wudick, M.M.,Lizzio, M.A.,Klykov, O.,Yelshanskaya, M.V.,Feijo, J.A.,Sobolevsky, A.I. Structure of the Arabidopsis thaliana glutamate receptor-like channel GLR3.4. Mol.Cell 2021 81 3216 0 7LZ2 34161757 Structure of glutamate receptor-like channel GLR3.4 ligand-binding domain in complex with methionine 2021-03-08 2021-07-28 Green, M.N.,Gangwar, S.P.,Michard, E.,Simon, A.A.,Portes, M.T.,Barbosa-Caro, J.,Wudick, M.M.,Lizzio, M.A.,Klykov, O.,Yelshanskaya, M.V.,Feijo, J.A.,Sobolevsky, A.I. Structure of the Arabidopsis thaliana glutamate receptor-like channel GLR3.4. Mol.Cell 2021 81 3216 0 7M8Q 34100595 Complex structure of Methane monooxygenase hydroxylase and regulatory subunit with fluorosubstituted tryptophans 2021-03-30 2021-07-28 Jones, J.C.,Banerjee, R.,Shi, K.,Semonis, M.M.,Aihara, H.,Pomerantz, W.C.K.,Lipscomb, J.D. Soluble Methane Monooxygenase Component Interactions Monitored by 19 F NMR. Biochemistry 2021 60 1995 2010 7RIN 35916223 Apo PTP1B by Native S-SAD at Room Temperature 2021-07-20 2021-07-28 Greisman, J.B.,Dalton, K.M.,Sheehan, C.J.,Klureza, M.A.,Kurinov, I.,Hekstra, D.R. Native SAD phasing at room temperature. Acta Crystallogr D Struct Biol 2022 78 986 996 7JLZ Crystal structure of 30S ribosomal A1408 methyltransferase from an uncultured bacterium (UncKam) 2020-07-30 2021-08-04 Nosrati, M.,Witek, M.A.,Dayne, W.,Zelinskaya, N.,Dunham, C.M.,Conn, G.L. Roles of conserved tryptophans in substrate recognition and catalysis by the aminoglycoside-resistance 16S rRNA (m1A1408) rRNA methyltransferases To be published 0 0 0 0 7L4H 34078593 Crystal structure of the DRM2-CTG DNA complex 2020-12-19 2021-08-04 Fang, J.,Leichter, S.M.,Jiang, J.,Biswal, M.,Lu, J.,Zhang, Z.M.,Ren, W.,Zhai, J.,Cui, Q.,Zhong, X.,Song, J. Substrate deformation regulates DRM2-mediated DNA methylation in plants. Sci Adv 2021 7 0 0 7NAA 34382010 Crystal structure of Mycobacterium tuberculosis H37Rv PknF kinase domain 2021-06-21 2021-08-04 Cabarca, S.,Frazao de Souza, M.,Albert de Oliveira, A.,Vignoli Muniz, G.S.,Lamy, M.T.,Vinicius Dos Reis, C.,Takarada, J.,Effer, B.,Souza, L.S.,Iriarte de la Torre, L.,Counago, R.,Pinto Oliveira, C.L.,Balan, A. Structure of the Mycobacterium tuberculosis c PknF and conformational changes induced in forkhead-associated regulatory domains. Curr Res Struct Biol 2021 3 165 178 7DUF 34404204 Crystal structure of VIM1 PHD finger. 2021-01-08 2021-08-25 Abhishek, S.,Deeksha, W.,Rajakumara, E. Helical and beta-Turn Conformations in the Peptide Recognition Regions of the VIM1 PHD Finger Abrogate H3K4 Peptide Recognition. Biochemistry 2021 60 2652 2662 7JXH 35149586 HER2 in complex with JBJ-08-178-01 2020-08-27 2021-09-08 Son, J.,Jang, J.,Beyett, T.S.,Eum, Y.,Haikala, H.M.,Verano, A.,Lin, M.,Hatcher, J.M.,Kwiatkowski, N.P.,Eser, P.O.,Poitras, M.J.,Wang, S.,Xu, M.,Gokhale, P.C.,Cameron, M.D.,Eck, M.J.,Gray, N.S.,Janne, P.A. A Novel HER2-Selective Kinase Inhibitor Is Effective in HER2 Mutant and Amplified Non-Small Cell Lung Cancer. Cancer Res. 2022 82 1633 1645 7JXI EGFR kinase (T790M/V948R) in complex with PF-06747775 2020-08-27 2021-09-08 Beyett, T.S.,To, C.,Heppner, D.E.,Rana, J.K.,Schmoker, A.M.,Jang, J.,De Clercq, D.J.H.,Gomez, G.,Scott, D.A.,Gray, N.S.,Janne, P.A.,Eck, M.J. Molecular basis for cooperative binding and synergy of ATP-site and allosteric EGFR inhibitors Nat Commun 2022 13 2530 0 7JXK EGFR kinase (T790M/V948R) in complex with PF-06747775 and JBJ-04-125-02 2020-08-27 2021-09-08 Beyett, T.S.,To, C.,Heppner, D.E.,Rana, J.K.,Schmoker, A.M.,Jang, J.,De Clercq, D.J.H.,Gomez, G.,Scott, D.A.,Gray, N.S.,Janne, P.A.,Eck, M.J. Molecular basis for cooperative binding and synergy of ATP-site and allosteric EGFR inhibitors Nat Commun 2022 13 2530 0 7JXP EGFR kinase (T790M/V948R) in complex with osimertinib and JBJ-04-125-02 2020-08-27 2021-09-08 Beyett, T.S.,To, C.,Heppner, D.E.,Rana, J.K.,Schmoker, A.M.,Jang, J.,De Clercq, D.J.H.,Gomez, G.,Scott, D.A.,Gray, N.S.,Janne, P.A.,Eck, M.J. Molecular basis for cooperative binding and synergy of ATP-site and allosteric EGFR inhibitors Nat Commun 2022 13 2530 0 7MGP CmcA from Type II Cut MCP 2021-04-13 2021-09-08 Ochoa, J.M.,Mijares, O.,Acosta, A.A.,Escoto, X.,Leon-Rivera, N.,Marshall, J.D.,Sawaya, M.R.,Yeates, T.O. Structural characterization of hexameric shell proteins from two types of choline-utilization bacterial microcompartments Acta Crystallogr.,Sect.F 2021 77 275 285 7MN4 CmcB E35G mutant from Type II Cut MCP 2021-04-30 2021-09-08 Ochoa, J.M.,Mijares, O.,Acosta, A.A.,Escoto, X.,Leon-Rivera, N.,Marshall, J.D.,Sawaya, M.R.,Yeates, T.O. Structural characterization of hexameric shell proteins from two types of choline-utilization bacterial microcompartments Acta Crystallogr.,Sect.F 2021 77 275 285 7MPV CmcC from Type II Cut MCP 2021-05-05 2021-09-08 Ochoa, J.M.,Mijares, O.,Acosta, A.A.,Escoto, X.,Leon-Rivera, N.,Marshall, J.D.,Sawaya, M.R.,Yeates, T.O. Structural characterization of hexameric shell proteins from two types of choline-utilization bacterial microcompartments Acta Crystallogr.,Sect.F 2021 77 275 285 7MPX CmcC E36G mutant from Type II Cut MCP 2021-05-05 2021-09-08 Ochoa, J.M.,Mijares, O.,Acosta, A.A.,Escoto, X.,Leon-Rivera, N.,Marshall, J.D.,Sawaya, M.R.,Yeates, T.O. Structural characterization of hexameric shell proteins from two types of choline-utilization bacterial microcompartments Acta Crystallogr.,Sect.F 2021 77 275 285 7S0Y 34678063 Structures of TcdB in complex with Cdc42 2021-08-31 2021-09-08 Liu, Z.,Zhang, S.,Chen, P.,Tian, S.,Zeng, J.,Perry, K.,Dong, M.,Jin, R. Structural basis for selective modification of Rho and Ras GTPases by Clostridioides difficile toxin B. Sci Adv 2021 7 0 0 7S0Z 34678063 Structures of TcdB in complex with R-Ras 2021-08-31 2021-09-08 Liu, Z.,Zhang, S.,Chen, P.,Tian, S.,Zeng, J.,Perry, K.,Dong, M.,Jin, R. Structural basis for selective modification of Rho and Ras GTPases by Clostridioides difficile toxin B. Sci Adv 2021 7 0 0 7KO2 34453889 Restraining state of near full-length Hsp70 DnaK 2020-11-06 2021-09-15 Wang, W.,Liu, Q.,Liu, Q.,Hendrickson, W.A. Conformational equilibria in allosteric control of Hsp70 chaperones. Mol.Cell 2021 81 3919 0 7KRU 34453889 Stimulating state of a truncated Hsp70 DnaK fused with a substrate peptide 2020-11-20 2021-09-15 Wang, W.,Liu, Q.,Liu, Q.,Hendrickson, W.A. Conformational equilibria in allosteric control of Hsp70 chaperones. Mol.Cell 2021 81 3919 0 7MPP 34533457 Bartonella henselae NrnC cleaving pGG in the presence of Mg2+ 2021-05-04 2021-09-15 Lormand, J.D.,Kim, S.K.,Walters-Marrah, G.A.,Brownfield, B.A.,Fromme, J.C.,Winkler, W.C.,Goodson, J.R.,Lee, V.T.,Sondermann, H. Structural characterization of NrnC identifies unifying features of dinucleotidases. Elife 2021 10 0 0 7MPQ 34533457 Bartonella henselae NrnC cleaving pGG in the presence of Mn2+ 2021-05-04 2021-09-15 Lormand, J.D.,Kim, S.K.,Walters-Marrah, G.A.,Brownfield, B.A.,Fromme, J.C.,Winkler, W.C.,Goodson, J.R.,Lee, V.T.,Sondermann, H. Structural characterization of NrnC identifies unifying features of dinucleotidases. Elife 2021 10 0 0 7MPR 34533457 Brucella melitensis NrnC 2021-05-04 2021-09-15 Lormand, J.D.,Kim, S.K.,Walters-Marrah, G.A.,Brownfield, B.A.,Fromme, J.C.,Winkler, W.C.,Goodson, J.R.,Lee, V.T.,Sondermann, H. Structural characterization of NrnC identifies unifying features of dinucleotidases. Elife 2021 10 0 0 7MPS 34533457 Brucella melitensis NrnC with engaged loop 2021-05-04 2021-09-15 Lormand, J.D.,Kim, S.K.,Walters-Marrah, G.A.,Brownfield, B.A.,Fromme, J.C.,Winkler, W.C.,Goodson, J.R.,Lee, V.T.,Sondermann, H. Structural characterization of NrnC identifies unifying features of dinucleotidases. Elife 2021 10 0 0 7MPT 34533457 Brucella melitensis NrnC with bound Mg2+ 2021-05-04 2021-09-15 Lormand, J.D.,Kim, S.K.,Walters-Marrah, G.A.,Brownfield, B.A.,Fromme, J.C.,Winkler, W.C.,Goodson, J.R.,Lee, V.T.,Sondermann, H. Structural characterization of NrnC identifies unifying features of dinucleotidases. Elife 2021 10 0 0 7K0B The internal aldimine form of Salmonella typhimurium Tryptophan Synthase mutant beta-Q114A with cesium ion at the metal coordination site. A random beta-P270L mutation was inserted during PCR step 2020-09-04 2021-09-22 Hilario, E.,Dunn, M.F.,Mueller, L.J. The internal aldimine form of Salmonella typhimurium Tryptophan Synthase mutant beta-Q114A with cesium ion at the metal coordination site. A random beta-P270L mutation was inserted during PCR step. To be Published 0 0 0 0 7K5A The external aldimine form of Salmonella typhimurium Tryptophan Synthase mutant beta-Q114A in complex with cesium ion at the metal coordination site. 2020-09-16 2021-09-22 Hilario, E.,Dunn, M.F.,Mueller, L.J. The external aldimine form of Salmonella typhimurium Tryptophan Synthase mutant beta-Q114A in complex with cesium ion at the metal coordination site. To be Published 0 0 0 0 7K7M 34383749 Crystal Structure of a membrane protein 2020-09-23 2021-09-22 Su, C.C.,Klenotic, P.A.,Cui, M.,Lyu, M.,Morgan, C.E.,Yu, E.W. Structures of the mycobacterial membrane protein MmpL3 reveal its mechanism of lipid transport. Plos Biol. 2021 19 0 0 7MY9 34542291 Structure of proline utilization A with 1,3-dithiolane-2-carboxylate bound in the proline dehydrogenase active site 2021-05-20 2021-09-29 Campbell, A.C.,Prater, A.R.,Bogner, A.N.,Quinn, T.P.,Gates, K.S.,Becker, D.F.,Tanner, J.J. Photoinduced Covalent Irreversible Inactivation of Proline Dehydrogenase by S-Heterocycles. Acs Chem.Biol. 2021 16 2268 2279 7MYB 34542291 Structure of proline utilization A with tetrahydrothiophene-2-carboxylate bound in the proline dehydrogenase active site 2021-05-20 2021-09-29 Campbell, A.C.,Prater, A.R.,Bogner, A.N.,Quinn, T.P.,Gates, K.S.,Becker, D.F.,Tanner, J.J. Photoinduced Covalent Irreversible Inactivation of Proline Dehydrogenase by S-Heterocycles. Acs Chem.Biol. 2021 16 2268 2279 7D2K 33246965 Crystal structure of rat TRPV6 in complex with (4- phenylcyclohexyl)piperazine inhibitor Br-cis-22a 2020-09-16 2021-10-06 Bhardwaj, R.,Lindinger, S.,Neuberger, A.,Nadezhdin, K.D.,Singh, A.K.,Cunha, M.R.,Derler, I.,Gyimesi, G.,Reymond, J.L.,Hediger, M.A.,Romanin, C.,Sobolevsky, A.I. Inactivation-mimicking block of the epithelial calcium channel TRPV6. Sci Adv 2020 6 0 0 7D2K 33246965 Crystal structure of rat TRPV6 in complex with (4- phenylcyclohexyl)piperazine inhibitor Br-cis-22a 2020-09-16 2021-10-06 Bhardwaj, R.,Lindinger, S.,Neuberger, A.,Nadezhdin, K.D.,Singh, A.K.,Cunha, M.R.,Derler, I.,Gyimesi, G.,Reymond, J.L.,Hediger, M.A.,Romanin, C.,Sobolevsky, A.I. Inactivation-mimicking block of the epithelial calcium channel TRPV6. Sci Adv 2020 6 0 0 7N4I 34716452 Crystal structure of SARS-CoV-2 receptor binding domain in complex with neutralizing human antibody WRAIR-2057. 2021-06-04 2021-10-06 Dussupt, V.,Sankhala, R.S.,Mendez-Rivera, L.,Townsley, S.M.,Schmidt, F.,Wieczorek, L.,Lal, K.G.,Donofrio, G.C.,Tran, U.,Jackson, N.D.,Zaky, W.I.,Zemil, M.,Tritsch, S.R.,Chen, W.H.,Martinez, E.J.,Ahmed, A.,Choe, M.,Chang, W.C.,Hajduczki, A.,Jian, N.,Peterson, C.E.,Rees, P.A.,Rutkowska, M.,Slike, B.M.,Selverian, C.N.,Swafford, I.,Teng, I.T.,Thomas, P.V.,Zhou, T.,Smith, C.J.,Currier, J.R.,Kwong, P.D.,Rolland, M.,Davidson, E.,Doranz, B.J.,Mores, C.N.,Hatziioannou, T.,Reiley, W.W.,Bieniasz, P.D.,Paquin-Proulx, D.,Gromowski, G.D.,Polonis, V.R.,Michael, N.L.,Modjarrad, K.,Joyce, M.G.,Krebs, S.J. Low-dose in vivo protection and neutralization across SARS-CoV-2 variants by monoclonal antibody combinations. Nat.Immunol. 2021 22 1503 1514 7SB8 35234144 d(GA(CGA)5) parallel-stranded homo-duplex 2021-09-24 2021-10-06 Luteran, E.M.,Paukstelis, P.J. The parallel-stranded d(CGA) duplex is a highly predictable structural motif with two conformationally distinct strands. Acta Crystallogr D Struct Biol 2022 78 299 309 7JSM 34678158 CRYSTAL STRUCTURE OF NATIVE BOVINE ARRESTIN 1 2020-08-14 2021-10-13 Sander, C.L.,Luu, J.,Kim, K.,Furkert, D.,Jang, K.,Reichenwallner, J.,Kang, M.,Lee, H.J.,Eger, B.T.,Choe, H.W.,Fiedler, D.,Ernst, O.P.,Kim, Y.J.,Palczewski, K.,Kiser, P.D. Structural evidence for visual arrestin priming via complexation of phosphoinositols. Structure 2022 30 263 0 7JTB 34678158 CRYSTAL STRUCTURE OF NATIVE BOVINE ARRESTIN 1 IN COMPLEX WITH INOSITOL HEXAKISPHOSPHATE 2020-08-17 2021-10-13 Sander, C.L.,Luu, J.,Kim, K.,Furkert, D.,Jang, K.,Reichenwallner, J.,Kang, M.,Lee, H.J.,Eger, B.T.,Choe, H.W.,Fiedler, D.,Ernst, O.P.,Kim, Y.J.,Palczewski, K.,Kiser, P.D. Structural evidence for visual arrestin priming via complexation of phosphoinositols. Structure 2022 30 263 0 7RQ8 34707295 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with iboxamycin, mRNA, deacylated A- and E-site tRNAs, and aminoacylated P-site tRNA at 2.50A resolution 2021-08-06 2021-10-13 Mitcheltree, M.J.,Pisipati, A.,Syroegin, E.A.,Silvestre, K.J.,Klepacki, D.,Mason, J.D.,Terwilliger, D.W.,Testolin, G.,Pote, A.R.,Wu, K.J.Y.,Ladley, R.P.,Chatman, K.,Mankin, A.S.,Polikanov, Y.S.,Myers, A.G. A synthetic antibiotic class overcoming bacterial multidrug resistance. Nature 2021 599 507 512 7RQ9 34707295 Crystal structure of the A2058-dimethylated Thermus thermophilus 70S ribosome in complex with iboxamycin, mRNA, deacylated A- and E-site tRNAs, and aminoacylated P-site tRNA at 2.60A resolution 2021-08-06 2021-10-13 Mitcheltree, M.J.,Pisipati, A.,Syroegin, E.A.,Silvestre, K.J.,Klepacki, D.,Mason, J.D.,Terwilliger, D.W.,Testolin, G.,Pote, A.R.,Wu, K.J.Y.,Ladley, R.P.,Chatman, K.,Mankin, A.S.,Polikanov, Y.S.,Myers, A.G. A synthetic antibiotic class overcoming bacterial multidrug resistance. Nature 2021 599 507 512 7S0L 34609847 Crystal structure of Penicillium verruculosum copalyl diphosphate synthase (PvCPS) alpha prenyltransferase domain variant, S723F 2021-08-30 2021-10-13 Ronnebaum, T.A.,Eaton, S.A.,Brackhahn, E.A.E.,Christianson, D.W. Engineering the Prenyltransferase Domain of a Bifunctional Assembly-Line Terpene Synthase. Biochemistry 2021 60 3162 3172 7S0M 34609847 Crystal structure of Penicillium verruculosum copalyl diphosphate synthase (PvCPS) alpha prenyltransferase domain variant, S723T, bound with non-productive isopentenyl diphosphate 2021-08-30 2021-10-13 Ronnebaum, T.A.,Eaton, S.A.,Brackhahn, E.A.E.,Christianson, D.W. Engineering the Prenyltransferase Domain of a Bifunctional Assembly-Line Terpene Synthase. Biochemistry 2021 60 3162 3172 7KG4 Recombinant Beta-2-Glycoprotein I antibody recognition loop mutant 2020-10-15 2021-10-20 Klenotic, P.A.,Yu, E.W. Beta-2-Glycoprotein I and its role in APS To be published 0 0 0 0 7KH6 1.45 Angstrom resolution internal aldimine crystal structure of the beta-Q114A mutant of TryptophanSynthase in complex with N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and cesium ion at the metal coordination site 2020-10-20 2021-10-27 Hilario, E.,Dunn, M.F.,Mueller, L.J. 1.45 Angstrom resolution internal aldimine crystal structure of the beta-Q114A mutant of Tryptophan Synthase in complex with N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and cesium ion at the metal coordination site. To be Published 0 0 0 0 7KI7 The external aldimine crystal structure of the beta-K167T mutant Tryptophan Synthase at 1.75 Angstrom resolution in complex with N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and cesium ion at the metal coordination site 2020-10-23 2021-10-27 Hilario, E.,Dunn, M.F.,Mueller, L.J. The external aldimine crystal structure of the beta-K167T mutant Tryptophan Synthase at 1.75 Angstrom resolution in complex with N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and cesium ion at the metal coordination site. To be Published 0 0 0 0 7S7K 34638814 Crystal structure of the EphB2 extracellular domain 2021-09-16 2021-10-27 Xu, Y.,Robev, D.,Saha, N.,Wang, B.,Dalva, M.B.,Xu, K.,Himanen, J.P.,Nikolov, D.B. The Ephb2 Receptor Uses Homotypic, Head-to-Tail Interactions within Its Ectodomain as an Autoinhibitory Control Mechanism. Int J Mol Sci 2021 22 0 0 7KMC The internal aldimine crystal structure of the beta-K167T mutant Tryptophan Synthase at 1.50 Angstrom resolution with cesium ion at the metal coordination site 2020-11-02 2021-11-03 Hilario, E.,Dunn, M.F.,Mueller, L.J. The internal aldimine crystal structure of the beta-K167T mutant Tryptophan Synthase at 1.50 Angstrom resolution with cesium ion at the metal coordination site To be Published 0 0 0 0 7M2K 34705497 CDC34A-Ubiquitin-2ab inhibitor complex 2021-03-16 2021-11-03 St-Cyr, D.,Ceccarelli, D.F.,Orlicky, S.,van der Sloot, A.M.,Tang, X.,Kelso, S.,Moore, S.,James, C.,Posternak, G.,Coulombe-Huntington, J.,Bertomeu, T.,Marinier, A.,Sicheri, F.,Tyers, M. Identification and optimization of molecular glue compounds that inhibit a noncovalent E2 enzyme-ubiquitin complex. Sci Adv 2021 7 0 0 7K3X 35637421 SGMGCIT segment 58-64 from Keratin-8 with G62C mutation 2020-09-14 2021-11-10 Murray, K.A.,Hughes, M.P.,Hu, C.J.,Sawaya, M.R.,Salwinski, L.,Pan, H.,French, S.W.,Seidler, P.M.,Eisenberg, D.S. Identifying amyloid-related diseases by mapping mutations in low-complexity protein domains to pathologies. Nat.Struct.Mol.Biol. 2022 29 529 536 7KII 36541758 Muscovy duck circovirus Rep domain complexed with a single-stranded DNA 10-mer comprising the cleavage site and Mn2+ 2020-10-23 2021-11-17 Smiley, A.T.,Tompkins, K.J.,Pawlak, M.R.,Krueger, A.J.,Evans 3rd, R.L.,Shi, K.,Aihara, H.,Gordon, W.R. Watson-Crick Base-Pairing Requirements for ssDNA Recognition and Processing in Replication-Initiating HUH Endonucleases. Mbio 2023 14 0 0 7KIJ 36541758 Muscovy duck circovirus Rep domain complexed with a single-stranded DNA 10-mer comprising the cleavage site 2020-10-23 2021-11-17 Smiley, A.T.,Tompkins, K.J.,Pawlak, M.R.,Krueger, A.J.,Evans 3rd, R.L.,Shi, K.,Aihara, H.,Gordon, W.R. Watson-Crick Base-Pairing Requirements for ssDNA Recognition and Processing in Replication-Initiating HUH Endonucleases. Mbio 2023 14 0 0 7KIK 36541758 Wheat dwarf virus Rep domain circular permutation complexed with a single-stranded DNA 10-mer comprising the cleavage site and Mn2+ 2020-10-23 2021-11-17 Smiley, A.T.,Tompkins, K.J.,Pawlak, M.R.,Krueger, A.J.,Evans 3rd, R.L.,Shi, K.,Aihara, H.,Gordon, W.R. Watson-Crick Base-Pairing Requirements for ssDNA Recognition and Processing in Replication-Initiating HUH Endonucleases. Mbio 2023 14 0 0 7KQ9 The aminoacrylate form of the beta-Q114A mutant Tryptophan Synthase at 1.50 Angstrom resolution with cesium ion at the metal coordination site 2020-11-13 2021-11-17 Hilario, E.,Dunn, M.F.,Mueller, L.J. The aminoacrylate form of the beta-Q114A mutant Tryptophan Synthase at 1.50 Angstrom resolution with cesium ion at the metal coordination site To be Published 0 0 0 0 7N34 34784509 Structure of Yersinia aleksiciae Cap15 cyclic dinucleotide receptor, crystal form 1 2021-05-31 2021-11-17 Duncan-Lowey, B.,McNamara-Bordewick, N.K.,Tal, N.,Sorek, R.,Kranzusch, P.J. Effector-mediated membrane disruption controls cell death in CBASS antiphage defense. Mol.Cell 2021 81 5039 0 7N35 34784509 Structure of Yersinia aleksiciae Cap15 cyclic dinucleotide receptor, crystal form 2 2021-05-31 2021-11-17 Duncan-Lowey, B.,McNamara-Bordewick, N.K.,Tal, N.,Sorek, R.,Kranzusch, P.J. Effector-mediated membrane disruption controls cell death in CBASS antiphage defense. Mol.Cell 2021 81 5039 0 7LIR 34819665 Structure of the invertebrate ALK GRD 2021-01-27 2021-11-24 Li, T.,Stayrook, S.E.,Tsutsui, Y.,Zhang, J.,Wang, Y.,Li, H.,Proffitt, A.,Krimmer, S.G.,Ahmed, M.,Belliveau, O.,Walker, I.X.,Mudumbi, K.C.,Suzuki, Y.,Lax, I.,Alvarado, D.,Lemmon, M.A.,Schlessinger, J.,Klein, D.E. Structural basis for ligand reception by anaplastic lymphoma kinase. Nature 2021 600 148 152 7MK7 34819665 Augmentor domain of augmentor-beta 2021-04-21 2021-11-24 Li, T.,Stayrook, S.E.,Tsutsui, Y.,Zhang, J.,Wang, Y.,Li, H.,Proffitt, A.,Krimmer, S.G.,Ahmed, M.,Belliveau, O.,Walker, I.X.,Mudumbi, K.C.,Suzuki, Y.,Lax, I.,Alvarado, D.,Lemmon, M.A.,Schlessinger, J.,Klein, D.E. Structural basis for ligand reception by anaplastic lymphoma kinase. Nature 2021 600 148 152 7RSJ 34779204 Structure of the VPS34 kinase domain with compound 14 2021-08-11 2021-11-24 Hu, D.X.,Patel, S.,Chen, H.,Wang, S.,Staben, S.T.,Dimitrova, Y.N.,Wallweber, H.A.,Lee, J.Y.,Chan, G.K.Y.,Sneeringer, C.J.,Prangley, M.S.,Moffat, J.G.,Wu, K.C.,Schutt, L.K.,Salphati, L.,Pang, J.,McNamara, E.,Huang, H.,Chen, Y.,Wang, Y.,Zhao, W.,Lim, J.,Murthy, A.,Siu, M. Structure-Based Design of Potent, Selective, and Orally Bioavailable VPS34 Kinase Inhibitors. J.Med.Chem. 2022 65 11500 11512 6S5I Structure of the Lausanne variant of myxoma virus M062 protein 2019-07-01 2021-12-01 O'Byrne, P.,Khan, A.R. Structure of the Lausanne variant of myxoma virus M062 protein To Be Published 0 0 0 0 7D5G Crystal structure of the CsCE with ligand to have a insight into the catalytic mechanism 2020-09-25 2021-12-01 Feng, Y.,Lyu, X.,Cong, Y.,Miao, T.,Fang, B.,Zhang, C.,Shen, Q.,Matthews, M.,Fisher, A.J.,Zhang, J.Z.,Zhang, L.,Yang, R. A precise swaying map for how promiscuous cellobiose-2-epimerase operate bi-reaction Int.J.Biol.Macromol. 2023 253 127093 0 7D5G Crystal structure of the CsCE with ligand to have a insight into the catalytic mechanism 2020-09-25 2021-12-01 Feng, Y.,Lyu, X.,Cong, Y.,Miao, T.,Fang, B.,Zhang, C.,Shen, Q.,Matthews, M.,Fisher, A.J.,Zhang, J.Z.,Zhang, L.,Yang, R. A precise swaying map for how promiscuous cellobiose-2-epimerase operate bi-reaction Int.J.Biol.Macromol. 2023 253 127093 0 7STY Crystal structure of human CORO1C 2021-11-15 2021-12-01 Zeng, H.,Dong, A.,Hutchinson, A.,Seitova, A.,Loppnau, P.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Crystal structure of human CORO1C To Be Published 0 0 0 0 7SUL Crystal structure of the WD-repeat domain of human SEC31A 2021-11-17 2021-12-01 Zeng, H.,Dong, A.,Loppnau, P.,Hutchinson, A.,Seitova, A.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Crystal structure of the WD-repeat domain of human SEC31A To Be Published 0 0 0 0 7SN0 34855508 Crystal structure of spike protein receptor binding domain of escape mutant SARS-CoV-2 from immunocompromised patient (d146*) in complex with human receptor ACE2 2021-10-27 2021-12-08 Nabel, K.G.,Clark, S.A.,Shankar, S.,Pan, J.,Clark, L.E.,Yang, P.,Coscia, A.,McKay, L.G.A.,Varnum, H.H.,Brusic, V.,Tolan, N.V.,Zhou, G.,Desjardins, M.,Turbett, S.E.,Kanjilal, S.,Sherman, A.C.,Dighe, A.,LaRocque, R.C.,Ryan, E.T.,Tylek, C.,Cohen-Solal, J.F.,Darcy, A.T.,Tavella, D.,Clabbers, A.,Fan, Y.,Griffiths, A.,Correia, I.R.,Seagal, J.,Baden, L.R.,Charles, R.C.,Abraham, J. Structural basis for continued antibody evasion by the SARS-CoV-2 receptor binding domain. Science 2022 375 0 0 7SN1 34855508 Structure of human SARS-CoV-2 neutralizing antibody C1C-A3 Fab 2021-10-27 2021-12-08 Nabel, K.G.,Clark, S.A.,Shankar, S.,Pan, J.,Clark, L.E.,Yang, P.,Coscia, A.,McKay, L.G.A.,Varnum, H.H.,Brusic, V.,Tolan, N.V.,Zhou, G.,Desjardins, M.,Turbett, S.E.,Kanjilal, S.,Sherman, A.C.,Dighe, A.,LaRocque, R.C.,Ryan, E.T.,Tylek, C.,Cohen-Solal, J.F.,Darcy, A.T.,Tavella, D.,Clabbers, A.,Fan, Y.,Griffiths, A.,Correia, I.R.,Seagal, J.,Baden, L.R.,Charles, R.C.,Abraham, J. Structural basis for continued antibody evasion by the SARS-CoV-2 receptor binding domain. Science 2022 375 0 0 7KU9 The internal aldimine form of the wild-type Salmonella typhimurium Tryptophan Synthase with sodium ion at the metal coordination site, two molecules of F6F inhibitor at the enzyme alpha-site and another F6F molecule at the enzyme beta-site at 1.40 Angstrom resolution 2020-11-24 2021-12-15 Hilario, E.,Dunn, M.F.,Mueller, L.J. The internal aldimine form of the wild-type Salmonella typhimurium Tryptophan Synthase with sodium ion at the metal coordination site, two molecules of F6F inhibitor at the enzyme alpha-site and another F6F molecule at the enzyme beta-site at 1.40 Angstrom resolution. To be Published 0 0 0 0 7KUW 35286324 High-throughput design and refinement of stable proteins using sequence-only models 2020-11-25 2021-12-15 Singer, J.M.,Novotney, S.,Strickland, D.,Haddox, H.K.,Leiby, N.,Rocklin, G.J.,Chow, C.M.,Roy, A.,Bera, A.K.,Motta, F.C.,Cao, L.,Strauch, E.M.,Chidyausiku, T.M.,Ford, A.,Ho, E.,Zaitzeff, A.,Mackenzie, C.O.,Eramian, H.,DiMaio, F.,Grigoryan, G.,Vaughn, M.,Stewart, L.J.,Baker, D.,Klavins, E. Large-scale design and refinement of stable proteins using sequence-only models. Plos One 2022 17 0 0 7KWV The aminoacrylate form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and cesium ion at the metal coordination site at 1.30 Angstrom resolution 2020-12-02 2021-12-15 Hilario, E.,Dunn, M.F.,Mueller, L.J. The aminoacrylate form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and cesium ion at the metal coordination site at 1.30 Angstrom resolution. To be Published 0 0 0 0 7KXC The aminoacrylate form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site, sodium ion at the metal coordination site and benzimidazole (BZI) at the enzyme beta-site at 1.30 Angstrom resolution. One of the beta-Q114 rotamer conformations allows a hydrogen bond to form with the PLP oxygen at the position 3 in the ring 2020-12-03 2021-12-15 Hilario, E.,Dunn, M.F.,Mueller, L.J. The aminoacrylate form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site, sodium ion at the metal coordination site and benzimidazole (BZI) at the enzyme beta-site at 1.30 Angstrom resolution. One of the beta-Q114 rotamer conformations allows a hydrogen bond to form with the PLP oxygen at the position 3 in the ring. To be Published 0 0 0 0 7SSE 37350740 Crystal structure of the WDR domain of human DCAF1 in complex with CYCA-117-70 2021-11-10 2021-12-15 Kimani, S.W.,Owen, J.,Green, S.R.,Li, F.,Li, Y.,Dong, A.,Brown, P.J.,Ackloo, S.,Kuter, D.,Yang, C.,MacAskill, M.,MacKinnon, S.S.,Arrowsmith, C.H.,Schapira, M.,Shahani, V.,Halabelian, L. Discovery of a Novel DCAF1 Ligand Using a Drug-Target Interaction Prediction Model: Generalizing Machine Learning to New Drug Targets. J.Chem.Inf.Model. 2023 63 4070 4078 7K3H 34853475 Crystal structure of deep network hallucinated protein 0217 2020-09-11 2021-12-22 Anishchenko, I.,Pellock, S.J.,Chidyausiku, T.M.,Ramelot, T.A.,Ovchinnikov, S.,Hao, J.,Bafna, K.,Norn, C.,Kang, A.,Bera, A.K.,DiMaio, F.,Carter, L.,Chow, C.M.,Montelione, G.T.,Baker, D. De novo protein design by deep network hallucination. Nature 2021 600 547 552 7KYT The aminoacrylate form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site, cesium ion at the metal coordination site and benzimidazole (BZI) at the enzyme beta-site at 1.35 Angstrom resolution 2020-12-08 2021-12-22 Hilario, E.,Dunn, M.F.,Mueller, L.J. The aminoacrylate form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site, cesium ion at the metal coordination site and benzimidazole (BZI) at the enzyme beta-site at 1.35 Angstrom resolution. To be Published 0 0 0 0 7L6V 34990480 Crystal structure of BoNT/A-LC-JPU-A5-JPU-C1-JPU-H7-JPU-D12-ciA-F12 2020-12-24 2021-12-22 Lam, K.H.,Tremblay, J.M.,Perry, K.,Ichtchenko, K.,Shoemaker, C.B.,Jin, R. Probing the structure and function of the protease domain of botulinum neurotoxins using single-domain antibodies. Plos Pathog. 2022 18 0 0 7MLG 34995923 Crystal Structure of SARS-CoV-2 Main Protease (3CLpro/Mpro) Covalently Bound to Compound C63 2021-04-28 2021-12-22 Stille, J.K.,Tjutrins, J.,Wang, G.,Venegas, F.A.,Hennecker, C.,Rueda, A.M.,Sharon, I.,Blaine, N.,Miron, C.E.,Pinus, S.,Labarre, A.,Plescia, J.,Burai Patrascu, M.,Zhang, X.,Wahba, A.S.,Vlaho, D.,Huot, M.J.,Schmeing, T.M.,Mittermaier, A.K.,Moitessier, N. Design, synthesis and in vitro evaluation of novel SARS-CoV-2 3CL pro covalent inhibitors. Eur.J.Med.Chem. 2021 229 114046 114046 7RPZ 34889605 KRAS G12D in complex with MRTX-1133 2021-08-05 2021-12-22 Wang, X.,Allen, S.,Blake, J.F.,Bowcut, V.,Briere, D.M.,Calinisan, A.,Dahlke, J.R.,Fell, J.B.,Fischer, J.P.,Gunn, R.J.,Hallin, J.,Laguer, J.,Lawson, J.D.,Medwid, J.,Newhouse, B.,Nguyen, P.,O'Leary, J.M.,Olson, P.,Pajk, S.,Rahbaek, L.,Rodriguez, M.,Smith, C.R.,Tang, T.P.,Thomas, N.C.,Vanderpool, D.,Vigers, G.P.,Christensen, J.G.,Marx, M.A. Identification of MRTX1133, a Noncovalent, Potent, and Selective KRAS G12D Inhibitor. J.Med.Chem. 2022 65 3123 3133 7T71 35690147 Crystal Structure of Mevalonate 3,5-Bisphosphate Decarboxylase from Picrophilus Torridus 2021-12-14 2021-12-22 Aoki, M.,Vinokur, J.,Motoyama, K.,Ishikawa, R.,Collazo, M.,Cascio, D.,Sawaya, M.R.,Ito, T.,Bowie, J.U.,Hemmi, H. Crystal structure of mevalonate 3,5-bisphosphate decarboxylase reveals insight into the evolution of decarboxylases in the mevalonate metabolic pathways. J.Biol.Chem. 2022 298 102111 102111 7L8K Crystal structure of human GPX4-U46C 2020-12-31 2021-12-29 Liu, H.,Forouhar, F.,Seibt, T.,Saneto, R.,Wigby, K.,Friedman, J.,Xia, X.,Shchepinov, M.S.,Ramesh, S.,Conrad, M.,Stockwell, B.R. Patient-derived variant of GPX4 reveals the structural basis for its catalytic activity and degradation mechanism Nat.Chem.Biol. 2021 0 0 0 7L8M Crystal structure of human GPX4-U46C mutant K48L 2020-12-31 2021-12-29 Liu, H.,Forouhar, F.,Seibt, T.,Saneto, R.,Wigby, K.,Friedman, J.,Xia, X.,Shchepinov, M.S.,Ramesh, S.,Conrad, M.,Stockwell, B.R. Patient-derived variant of GPX4 reveals the structural basis for its catalytic activity and degradation mechanism Nat.Chem.Biol. 2021 0 0 0 7L8R Crystal structure of human GPX4-U46C mutant K48A 2020-12-31 2021-12-29 Liu, H.,Forouhar, F.,Seibt, T.,Saneto, R.,Wigby, K.,Friedman, J.,Xia, X.,Shchepinov, M.S.,Ramesh, S.,Conrad, M.,Stockwell, B.R. Patient-derived variant of GPX4 reveals the structural basis for its catalytic activity and degradation mechanism Nat.Chem.Biol. 2021 0 0 0 7M0Q 34853475 Crystal structure of deep network hallucinated protein 0738_mod 2021-03-11 2021-12-29 Anishchenko, I.,Pellock, S.J.,Chidyausiku, T.M.,Ramelot, T.A.,Ovchinnikov, S.,Hao, J.,Bafna, K.,Norn, C.,Kang, A.,Bera, A.K.,DiMaio, F.,Carter, L.,Chow, C.M.,Montelione, G.T.,Baker, D. De novo protein design by deep network hallucination. Nature 2021 600 547 552 7MPK 34864059 Crystal structure of TagA with UDP-GlcNAc 2021-05-04 2021-12-29 Martinez, O.E.,Mahoney, B.J.,Goring, A.K.,Yi, S.W.,Tran, D.P.,Cascio, D.,Phillips, M.L.,Muthana, M.M.,Chen, X.,Jung, M.E.,Loo, J.A.,Clubb, R.T. Insight into the molecular basis of substrate recognition by the wall teichoic acid glycosyltransferase TagA. J.Biol.Chem. 2021 298 101464 101464 7N41 34864059 Crystal structure of TagA with UDP-ManNAc 2021-06-03 2021-12-29 Martinez, O.E.,Mahoney, B.J.,Goring, A.K.,Yi, S.W.,Tran, D.P.,Cascio, D.,Phillips, M.L.,Muthana, M.M.,Chen, X.,Jung, M.E.,Loo, J.A.,Clubb, R.T. Insight into the molecular basis of substrate recognition by the wall teichoic acid glycosyltransferase TagA. J.Biol.Chem. 2021 298 101464 101464 7S6Q 34910460 Complex structure of Methane monooxygenase hydroxylase and regulatory subunit DBL2 2021-09-14 2021-12-29 Jones, J.C.,Banerjee, R.,Semonis, M.M.,Shi, K.,Aihara, H.,Lipscomb, J.D. X-ray Crystal Structures of Methane Monooxygenase Hydroxylase Complexes with Variants of Its Regulatory Component: Correlations with Altered Reaction Cycle Dynamics. Biochemistry 2022 61 21 33 7SPO 34916516 Crystal structure of the SARS-CoV-2 receptor binding domain in complex with VNAR 3B4 2021-11-02 2022-01-05 Ubah, O.C.,Lake, E.W.,Gunaratne, G.S.,Gallant, J.P.,Fernie, M.,Robertson, A.J.,Marchant, J.S.,Bold, T.D.,Langlois, R.A.,Matchett, W.E.,Thiede, J.M.,Shi, K.,Yin, L.,Moeller, N.H.,Banerjee, S.,Ferguson, L.,Kovaleva, M.,Porter, A.J.,Aihara, H.,LeBeau, A.M.,Barelle, C.J. Mechanisms of SARS-CoV-2 neutralization by shark variable new antigen receptors elucidated through X-ray crystallography. Nat Commun 2021 12 7325 7325 7SPP 34916516 Crystal structure of the SARS-CoV-2 receptor binding domain in complex with VNAR 2C02 2021-11-02 2022-01-05 Ubah, O.C.,Lake, E.W.,Gunaratne, G.S.,Gallant, J.P.,Fernie, M.,Robertson, A.J.,Marchant, J.S.,Bold, T.D.,Langlois, R.A.,Matchett, W.E.,Thiede, J.M.,Shi, K.,Yin, L.,Moeller, N.H.,Banerjee, S.,Ferguson, L.,Kovaleva, M.,Porter, A.J.,Aihara, H.,LeBeau, A.M.,Barelle, C.J. Mechanisms of SARS-CoV-2 neutralization by shark variable new antigen receptors elucidated through X-ray crystallography. Nat Commun 2021 12 7325 7325 7ROJ 34954854 Amyloid-related segment of alphaB-crystallin residues 90-100 with G95W mutation 2021-07-30 2022-01-12 Gray, A.L.H.,Sawaya, M.R.,Acharyya, D.,Lou, J.,Edington, E.M.,Best, M.D.,Prosser, R.A.,Eisenberg, D.S.,Do, T.D. Atomic view of an amyloid dodecamer exhibiting selective cellular toxic vulnerability in acute brain slices. Protein Sci. 2022 31 716 727 6XJZ 35058645 Crystal structure of a self-alkylating ribozyme - apo form 2020-06-24 2022-01-19 Krochmal, D.,Shao, Y.,Li, N.S.,DasGupta, S.,Shelke, S.A.,Koirala, D.,Piccirilli, J.A. Structural basis for substrate binding and catalysis by a self-alkylating ribozyme. Nat.Chem.Biol. 2022 18 376 384 7KVT 34937911 Crystal structure of Squash RNA aptamer in complex with DFHBI-1T with iridium (III) ions 2020-11-28 2022-01-19 Truong, L.,Kooshapur, H.,Dey, S.K.,Li, X.,Tjandra, N.,Jaffrey, S.R.,Ferre-D'Amare, A.R. The fluorescent aptamer Squash extensively repurposes the adenine riboswitch fold. Nat.Chem.Biol. 2022 18 191 198 7KY0 38523074 Inactive conformation of EGFR (T790M/V948R) kinase in complex with BI-4020 2020-12-06 2022-01-19 Beyett, T.S.,Rana, J.K.,Schaeffner, I.K.,Heppner, D.E.,Eck, M.J. Structural Analysis of the Macrocyclic Inhibitor BI-4020 Binding to EGFR Kinase. Chemmedchem 2024 0 0 0 7MWU 35018940 Structure of the E. coli PutA proline dehydrogenase domain (residues 86-630) complexed with cyclobutanecarboxylic acid 2021-05-17 2022-01-19 Bogner, A.N.,Tanner, J.J. Structure-affinity relationships of reversible proline analog inhibitors targeting proline dehydrogenase. Org.Biomol.Chem. 2022 20 895 905 7MWV 35018940 Structure of the E. coli PutA proline dehydrogenase domain (residues 86-630) complexed with cyclopropanecarboxylic acid 2021-05-17 2022-01-19 Bogner, A.N.,Tanner, J.J. Structure-affinity relationships of reversible proline analog inhibitors targeting proline dehydrogenase. Org.Biomol.Chem. 2022 20 895 905 7R9C 35007061 Cocrystal of BRD4(D1) with N,N-dimethyl-2-[(3R)-3-(5-{2-[2-methyl-5-(propan-2-yl)phenoxy]pyrimidin-4-yl}-4-[4-(trifluoromethyl)phenyl]-1H-imidazol-1-yl)pyrrolidin-1-yl]ethan-1-amine 2021-06-29 2022-01-19 Cui, H.,Divakaran, A.,Hoell, Z.J.,Ellingson, M.O.,Scholtz, C.R.,Zahid, H.,Johnson, J.A.,Griffith, E.C.,Gee, C.T.,Lee, A.L.,Khanal, S.,Shi, K.,Aihara, H.,Shah, V.H.,Lee, R.E.,Harki, D.A.,Pomerantz, W.C.K. A Structure-based Design Approach for Generating High Affinity BRD4 D1-Selective Chemical Probes. J.Med.Chem. 2022 65 2342 2360 7RLM 34813955 Crystal Structure of Potato Leafroll Virus (PLRV) Coat Protein 2021-07-25 2022-01-19 Adams, M.C.,Schiltz, C.J.,Heck, M.L.,Chappie, J.S. Crystal structure of the potato leafroll virus coat protein and implications for viral assembly. J.Struct.Biol. 2021 214 107811 107811 7SLZ CRYSTAL STRUCTURE OF GID4 IN COMPLEX WITH BPF023596 2021-10-25 2022-01-19 Song, X.,Dong, A.,Calabrese, M.,Wang, F.,Owen, D.,Arrowsmith, C.H.,Edwards, A.M.,Min, J.,Structural Genomics Consortium (SGC) CRYSTAL STRUCTURE OF GID4 IN COMPLEX WITH BPF023596 To Be Published 0 0 0 0 7LGX The aminoacrylate form of mutant beta-K167T Salmonella typhimurium Tryptophan Synthase in complex with with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site, benzimidazole (BZI) at the enzyme beta site and cesium ion at the metal coordination site at 1.80 Angstrom resolution 2021-01-21 2022-01-26 Hilario, E.,Dunn, M.F.,Mueller, L.J. The aminoacrylate form of mutant beta-K167T Salmonella typhimurium Tryptophan Synthase in complex with with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site, benzimidazole (BZI) at the enzyme beta site and cesium ion at the metal coordination site at 1.80 Angstrom resolution. To be Published 0 0 0 0 7RQA 35165455 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, A-site aminoacyl-tRNA analog ACC-PMN, and P-site MTI-tripeptidyl-tRNA analog ACCA-ITM at 2.40A resolution 2021-08-06 2022-01-26 Syroegin, E.A.,Flemmich, L.,Klepacki, D.,Vazquez-Laslop, N.,Micura, R.,Polikanov, Y.S. Structural basis for the context-specific action of the classic peptidyl transferase inhibitor chloramphenicol. Nat.Struct.Mol.Biol. 2022 29 152 161 7RQB 35165455 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, A-site aminoacyl-tRNA analog ACC-PMN, and P-site MAI-tripeptidyl-tRNA analog ACCA-IAM at 2.45A resolution 2021-08-06 2022-01-26 Syroegin, E.A.,Flemmich, L.,Klepacki, D.,Vazquez-Laslop, N.,Micura, R.,Polikanov, Y.S. Structural basis for the context-specific action of the classic peptidyl transferase inhibitor chloramphenicol. Nat.Struct.Mol.Biol. 2022 29 152 161 7RQC 35165455 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, A-site aminoacyl-tRNA analog ACC-PMN, and P-site MFI-tripeptidyl-tRNA analog ACCA-IFM at 2.50A resolution 2021-08-06 2022-01-26 Syroegin, E.A.,Flemmich, L.,Klepacki, D.,Vazquez-Laslop, N.,Micura, R.,Polikanov, Y.S. Structural basis for the context-specific action of the classic peptidyl transferase inhibitor chloramphenicol. Nat.Struct.Mol.Biol. 2022 29 152 161 7RQD 35165455 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, A-site deacylated tRNA analog CACCA, P-site MTI-tripeptidyl-tRNA analog ACCA-ITM, and chloramphenicol at 2.50A resolution 2021-08-06 2022-01-26 Syroegin, E.A.,Flemmich, L.,Klepacki, D.,Vazquez-Laslop, N.,Micura, R.,Polikanov, Y.S. Structural basis for the context-specific action of the classic peptidyl transferase inhibitor chloramphenicol. Nat.Struct.Mol.Biol. 2022 29 152 161 7RQE 35165455 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, A-site deacylated tRNA analog CACCA, P-site MAI-tripeptidyl-tRNA analog ACCA-IAM, and chloramphenicol at 2.40A resolution 2021-08-06 2022-01-26 Syroegin, E.A.,Flemmich, L.,Klepacki, D.,Vazquez-Laslop, N.,Micura, R.,Polikanov, Y.S. Structural basis for the context-specific action of the classic peptidyl transferase inhibitor chloramphenicol. Nat.Struct.Mol.Biol. 2022 29 152 161 7SES 35041419 PRMT5/MEP50 with compound 29 bound 2021-10-01 2022-01-26 Smith, C.R.,Aranda, R.,Bobinski, T.P.,Briere, D.M.,Burns, A.C.,Christensen, J.G.,Clarine, J.,Engstrom, L.D.,Gunn, R.J.,Ivetac, A.,Jean-Baptiste, R.,Ketcham, J.M.,Kobayashi, M.,Kuehler, J.,Kulyk, S.,Lawson, J.D.,Moya, K.,Olson, P.,Rahbaek, L.,Thomas, N.C.,Wang, X.,Waters, L.M.,Marx, M.A. Fragment-Based Discovery of MRTX1719, a Synthetic Lethal Inhibitor of the PRMT5•MTA Complex for the Treatment of MTAP -Deleted Cancers. J.Med.Chem. 2022 65 1749 1766 7LNY 35136069 Apo structure of the Histone chaperone ASF1A residues 1-155 2021-02-08 2022-02-16 Simon, B.,Lou, H.J.,Huet-Calderwood, C.,Shi, G.,Boggon, T.J.,Turk, B.E.,Calderwood, D.A. Tousled-like kinase 2 targets ASF1 histone chaperones through client mimicry. Nat Commun 2022 13 749 749 7LO0 35136069 Structure of human ASF1a in complex with a TLK2 peptide 2021-02-08 2022-02-16 Simon, B.,Lou, H.J.,Huet-Calderwood, C.,Shi, G.,Boggon, T.J.,Turk, B.E.,Calderwood, D.A. Tousled-like kinase 2 targets ASF1 histone chaperones through client mimicry. Nat Commun 2022 13 749 749 7LPF The internal aldimine form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and sodium ion at the metal coordination site at 1.10 Angstrom resolution 2021-02-11 2022-02-16 Hilario, E.,Dunn, M.F.,Mueller, L.J. The internal aldimine form of the wild-type Salmonella typhimurium Tryptophan Synthase in complex with inhibitor N-(4'-trifluoromethoxybenzenesulfonyl)-2-amino-1-ethylphosphate (F9F) at the enzyme alpha-site and sodium ion at the metal coordination site at 1.10 Angstrom resolution To be Published 0 0 0 0 7ROL 34954854 Amyloid-related segment of alphaB-crystallin residues 90-100 with G95W mutation, bromo derivative 2021-07-30 2022-02-16 Gray, A.L.H.,Sawaya, M.R.,Acharyya, D.,Lou, J.,Edington, E.M.,Best, M.D.,Prosser, R.A.,Eisenberg, D.S.,Do, T.D. Atomic view of an amyloid dodecamer exhibiting selective cellular toxic vulnerability in acute brain slices. Protein Sci. 2022 31 716 727 7TDB 35060698 Crystal structure of the E. coli thiM riboswitch in complex with thiamine bisphosphonate, manganese ions 2021-12-30 2022-02-16 Zeller, M.J.,Nuthanakanti, A.,Li, K.,Aube, J.,Serganov, A.,Weeks, K.M. Subsite Ligand Recognition and Cooperativity in the TPP Riboswitch: Implications for Fragment-Linking in RNA Ligand Discovery. Acs Chem.Biol. 2022 17 438 448 7TDC 35060698 Crystal structure of the E. coli thiM riboswitch in complex with thiamine bisphosphonate, calcium ions 2021-12-30 2022-02-16 Zeller, M.J.,Nuthanakanti, A.,Li, K.,Aube, J.,Serganov, A.,Weeks, K.M. Subsite Ligand Recognition and Cooperativity in the TPP Riboswitch: Implications for Fragment-Linking in RNA Ligand Discovery. Acs Chem.Biol. 2022 17 438 448 7TVD 36357385 Crystal structure of the kinase domain of EGFR exon-19 (del-747-749) mutant 2022-02-04 2022-02-16 van Alderwerelt van Rosenburgh, I.K.,Lu, D.M.,Grant, M.J.,Stayrook, S.E.,Phadke, M.,Walther, Z.,Goldberg, S.B.,Politi, K.,Lemmon, M.A.,Ashtekar, K.D.,Tsutsui, Y. Biochemical and structural basis for differential inhibitor sensitivity of EGFR with distinct exon 19 mutations. Nat Commun 2022 13 6791 6791 7LG8 35534503 EGFR (T79M/V948R) in complex with naquotinib and an allosteric inhibitor 2021-01-19 2022-02-23 Beyett, T.S.,To, C.,Heppner, D.E.,Rana, J.K.,Schmoker, A.M.,Jang, J.,De Clercq, D.J.H.,Gomez, G.,Scott, D.A.,Gray, N.S.,Janne, P.A.,Eck, M.J. Molecular basis for cooperative binding and synergy of ATP-site and allosteric EGFR inhibitors. Nat Commun 2022 13 2530 2530 7LTX 35378251 EGFR (T790M/V948R) in complex with quinazolinone allosteric inhibitor 2021-02-20 2022-02-23 Gero, T.W.,Heppner, D.E.,Beyett, T.S.,To, C.,Azevedo, S.C.,Jang, J.,Bunnell, T.,Feru, F.,Li, Z.,Shin, B.H.,Soroko, K.M.,Gokhale, P.C.,Gray, N.S.,Janne, P.A.,Eck, M.J.,Scott, D.A. Quinazolinones as allosteric fourth-generation EGFR inhibitors for the treatment of NSCLC. Bioorg.Med.Chem.Lett. 2022 68 128718 128718 7SJY 35194841 Crystal structure of Clostridium thermocellum RsgI9 S1C-NTF2 bi-domain 2021-10-19 2022-03-02 Mahoney, B.J.,Takayesu, A.,Zhou, A.,Cascio, D.,Clubb, R.T. The structure of the Clostridium thermocellum RsgI9 ectodomain provides insight into the mechanism of biomass sensing. Proteins 2022 90 1457 1467 7U1Z 35292538 Crystal structure of the DRBD and CROPs of TcdA 2022-02-22 2022-03-09 Chen, B.,Basak, S.,Chen, P.,Zhang, C.,Perry, K.,Tian, S.,Yu, C.,Dong, M.,Huang, L.,Bowen, M.E.,Jin, R. Structure and conformational dynamics of Clostridioides difficile toxin A. Life Sci Alliance 2022 5 0 0 7MK3 35545668 Crystal structure of NPR1 2021-04-21 2022-03-16 Kumar, S.,Zavaliev, R.,Wu, Q.,Zhou, Y.,Cheng, J.,Dillard, L.,Powers, J.,Withers, J.,Zhao, J.,Guan, Z.,Borgnia, M.J.,Bartesaghi, A.,Dong, X.,Zhou, P. Structural basis of NPR1 in activating plant immunity. Nature 2022 605 561 566 7T4D 35259335 Pore structure of pore-forming toxin Epx4 2021-12-09 2022-03-16 Xiong, X.,Tian, S.,Yang, P.,Lebreton, F.,Bao, H.,Sheng, K.,Yin, L.,Chen, P.,Zhang, J.,Qi, W.,Ruan, J.,Wu, H.,Chen, H.,Breault, D.T.,Wu, H.,Earl, A.M.,Gilmore, M.S.,Abraham, J.,Dong, M. Emerging enterococcus pore-forming toxins with MHC/HLA-I as receptors. Cell 2022 185 1157 0 7TAE 35545668 Crystal Structure of the NPR1-Interacting Domain of TGA3 2021-12-20 2022-03-16 Kumar, S.,Zavaliev, R.,Wu, Q.,Zhou, Y.,Cheng, J.,Dillard, L.,Powers, J.,Withers, J.,Zhao, J.,Guan, Z.,Borgnia, M.J.,Bartesaghi, A.,Dong, X.,Zhou, P. Structural basis of NPR1 in activating plant immunity. Nature 2022 605 561 566 7U3M 35306288 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with N-methylpiperazine Benzhydroxamic Acid 2022-02-27 2022-04-06 Zeyen, P.,Zeyn, Y.,Herp, D.,Mahmoudi, F.,Yesiloglu, T.Z.,Erdmann, F.,Schmidt, M.,Robaa, D.,Romier, C.,Ridinger, J.,Herbst-Gervasoni, C.J.,Christianson, D.W.,Oehme, I.,Jung, M.,Kramer, O.H.,Sippl, W. Identification of histone deacetylase 10 (HDAC10) inhibitors that modulate autophagy in transformed cells. Eur.J.Med.Chem. 2022 234 114272 114272 7U69 35306288 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Phenethyl Piperidine-4-acrylhydroxamic Acid Inhibitor 2022-03-03 2022-04-06 Zeyen, P.,Zeyn, Y.,Herp, D.,Mahmoudi, F.,Yesiloglu, T.Z.,Erdmann, F.,Schmidt, M.,Robaa, D.,Romier, C.,Ridinger, J.,Herbst-Gervasoni, C.J.,Christianson, D.W.,Oehme, I.,Jung, M.,Kramer, O.H.,Sippl, W. Identification of histone deacetylase 10 (HDAC10) inhibitors that modulate autophagy in transformed cells. Eur.J.Med.Chem. 2022 234 114272 114272 7U6A 35306288 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with 3-thienylmethyl Benzhydroxamic Acid Inhibitor 2022-03-03 2022-04-06 Zeyen, P.,Zeyn, Y.,Herp, D.,Mahmoudi, F.,Yesiloglu, T.Z.,Erdmann, F.,Schmidt, M.,Robaa, D.,Romier, C.,Ridinger, J.,Herbst-Gervasoni, C.J.,Christianson, D.W.,Oehme, I.,Jung, M.,Kramer, O.H.,Sippl, W. Identification of histone deacetylase 10 (HDAC10) inhibitors that modulate autophagy in transformed cells. Eur.J.Med.Chem. 2022 234 114272 114272 7U6B 35306288 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Indolethyl Piperidine-4-acrylhydroxamic Acid Inhibitor 2022-03-03 2022-04-06 Zeyen, P.,Zeyn, Y.,Herp, D.,Mahmoudi, F.,Yesiloglu, T.Z.,Erdmann, F.,Schmidt, M.,Robaa, D.,Romier, C.,Ridinger, J.,Herbst-Gervasoni, C.J.,Christianson, D.W.,Oehme, I.,Jung, M.,Kramer, O.H.,Sippl, W. Identification of histone deacetylase 10 (HDAC10) inhibitors that modulate autophagy in transformed cells. Eur.J.Med.Chem. 2022 234 114272 114272 7N2M 35467978 Crystal structure of DNA polymerase alpha catalytic core in complex with dCTP and template/primer having T-C mismatch at the post-insertion site 2021-05-29 2022-04-20 Baranovskiy, A.G.,Babayeva, N.D.,Lisova, A.E.,Morstadt, L.M.,Tahirov, T.H. Structural and functional insight into mismatch extension by human DNA polymerase alpha. Proc.Natl.Acad.Sci.USA 2022 119 0 0 7T26 35395152 Structure of phage FBB1 anti-CBASS nuclease Acb1 in apo state 2021-12-03 2022-04-20 Hobbs, S.J.,Wein, T.,Lu, A.,Morehouse, B.R.,Schnabel, J.,Leavitt, A.,Yirmiya, E.,Sorek, R.,Kranzusch, P.J. Phage anti-CBASS and anti-Pycsar nucleases subvert bacterial immunity. Nature 2022 605 522 526 7T27 35395152 Structure of phage FBB1 anti-CBASS nuclease Acb1-3'3'-cGAMP complex in post reaction state 2021-12-03 2022-04-20 Hobbs, S.J.,Wein, T.,Lu, A.,Morehouse, B.R.,Schnabel, J.,Leavitt, A.,Yirmiya, E.,Sorek, R.,Kranzusch, P.J. Phage anti-CBASS and anti-Pycsar nucleases subvert bacterial immunity. Nature 2022 605 522 526 7T28 35395152 Structure of phage Bsp38 anti-Pycsar nuclease Apyc1 in apo state 2021-12-03 2022-04-20 Hobbs, S.J.,Wein, T.,Lu, A.,Morehouse, B.R.,Schnabel, J.,Leavitt, A.,Yirmiya, E.,Sorek, R.,Kranzusch, P.J. Phage anti-CBASS and anti-Pycsar nucleases subvert bacterial immunity. Nature 2022 605 522 526 7U2R 35395152 Structure of Paenibacillus sp. J14 Apyc1 2022-02-24 2022-04-20 Hobbs, S.J.,Wein, T.,Lu, A.,Morehouse, B.R.,Schnabel, J.,Leavitt, A.,Yirmiya, E.,Sorek, R.,Kranzusch, P.J. Phage anti-CBASS and anti-Pycsar nucleases subvert bacterial immunity. Nature 2022 605 522 526 7U2S 35395152 Structure of Paenibacillus xerothermodurans Apyc1 in the apo state 2022-02-24 2022-04-20 Hobbs, S.J.,Wein, T.,Lu, A.,Morehouse, B.R.,Schnabel, J.,Leavitt, A.,Yirmiya, E.,Sorek, R.,Kranzusch, P.J. Phage anti-CBASS and anti-Pycsar nucleases subvert bacterial immunity. Nature 2022 605 522 526 7TTM 35438546 Crystal structure of potent neutralizing antibody 10-40 in complex with Sarbecovirus bat SHC014 receptor-binding domain 2022-02-01 2022-04-27 Liu, L.,Iketani, S.,Guo, Y.,Reddem, E.R.,Casner, R.G.,Nair, M.S.,Yu, J.,Chan, J.F.,Wang, M.,Cerutti, G.,Li, Z.,Morano, N.C.,Castagna, C.D.,Corredor, L.,Chu, H.,Yuan, S.,Poon, V.K.,Chan, C.C.,Chen, Z.,Luo, Y.,Cunningham, M.,Chavez, A.,Yin, M.T.,Perlin, D.S.,Tsuji, M.,Yuen, K.Y.,Kwong, P.D.,Sheng, Z.,Huang, Y.,Shapiro, L.,Ho, D.D. An antibody class with a common CDRH3 motif broadly neutralizes sarbecoviruses. Sci Transl Med 2022 14 0 0 7TGR 35471084 Structure of SARS-CoV-2 main protease in complex with GC376 2022-01-09 2022-05-04 Moghadasi, S.A.,Esler, M.A.,Otsuka, Y.,Becker, J.T.,Moraes, S.N.,Anderson, C.B.,Chamakuri, S.,Belica, C.,Wick, C.,Harki, D.A.,Young, D.W.,Scampavia, L.,Spicer, T.P.,Shi, K.,Aihara, H.,Brown, W.L.,Harris, R.S. Gain-of-Signal Assays for Probing Inhibition of SARS-CoV-2 M pro /3CL pro in Living Cells. Mbio 2022 13 0 0 7TIA 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor NK01-14 2022-01-13 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TIU 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor EB46 2022-01-14 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TIV 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor EB48 2022-01-14 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TIW 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor EB54 2022-01-14 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TIX 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor EB56 2022-01-14 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TIY 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor NK01-48 2022-01-14 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TIZ 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor NK01-63 2022-01-14 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TJ0 35393402 Crystal structure of SARS-CoV-2 3CL in complex with inhibitor SL-4-241 2022-01-14 2022-05-04 Liu, H.,Iketani, S.,Zask, A.,Khanizeman, N.,Bednarova, E.,Forouhar, F.,Fowler, B.,Hong, S.J.,Mohri, H.,Nair, M.S.,Huang, Y.,Tay, N.E.S.,Lee, S.,Karan, C.,Resnick, S.J.,Quinn, C.,Li, W.,Shion, H.,Xia, X.,Daniels, J.D.,Bartolo-Cruz, M.,Farina, M.,Rajbhandari, P.,Jurtschenko, C.,Lauber, M.A.,McDonald, T.,Stokes, M.E.,Hurst, B.L.,Rovis, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of optimized drug-like small molecule inhibitors of the SARS-CoV-2 3CL protease for treatment of COVID-19. Nat Commun 2022 13 1891 1891 7TNI 35438971 Structure of EC12 Y1392W variant of BT-R1 from Manduca sexta, a Cry1A toxin binding domain 2022-01-21 2022-05-04 Liu, L.,Wilcox, X.E.,Fisher, A.J.,Boyd, S.D.,Zhi, J.,Winkler, D.D.,Bulla Jr., L.A. Functional and Structural Analysis of the Toxin-Binding Site of the Cadherin G-Protein-Coupled Receptor, BT-R 1 , for Cry1A Toxins of Bacillus thuringiensis . Biochemistry 2022 61 752 766 7TSJ 35278753 Xenon-bound structure of carbon monoxide dehydrogenase (CODH) from Desulfovibrio vulgaris 2022-01-31 2022-05-04 Biester, A.,Dementin, S.,Drennan, C.L. Visualizing the gas channel of a monofunctional carbon monoxide dehydrogenase. J.Inorg.Biochem. 2022 230 111774 111774 7TVF 36175670 Crystal structure of the SHOC2-MRAS-PP1CA (SMP) complex to a resolution of 2.17 Angstrom 2022-02-04 2022-05-04 Bonsor, D.A.,Alexander, P.,Snead, K.,Hartig, N.,Drew, M.,Messing, S.,Finci, L.I.,Nissley, D.V.,McCormick, F.,Esposito, D.,Rodriguez-Viciana, P.,Stephen, A.G.,Simanshu, D.K. Structure of the SHOC2-MRAS-PP1C complex provides insights into RAF activation and Noonan syndrome. Nat.Struct.Mol.Biol. 2022 29 966 977 7TVG 36175670 Crystal Structure of SHOC2 to a resolution of 2.4 Angstrom 2022-02-04 2022-05-04 Bonsor, D.A.,Alexander, P.,Snead, K.,Hartig, N.,Drew, M.,Messing, S.,Finci, L.I.,Nissley, D.V.,McCormick, F.,Esposito, D.,Rodriguez-Viciana, P.,Stephen, A.G.,Simanshu, D.K. Structure of the SHOC2-MRAS-PP1C complex provides insights into RAF activation and Noonan syndrome. Nat.Struct.Mol.Biol. 2022 29 966 977 7U2P 35637242 Structure of TcdA GTD in complex with RhoA 2022-02-24 2022-05-04 Chen, B.,Liu, Z.,Perry, K.,Jin, R. Structure of the glucosyltransferase domain of TcdA in complex with RhoA provides insights into substrate recognition. Sci Rep 2022 12 9028 9028 7UFV 36948210 Crystal structure of the WDR domain of human DCAF1 in complex with OICR-6766 2022-03-23 2022-05-04 Li, A.S.M.,Kimani, S.,Wilson, B.,Noureldin, M.,Gonzalez-Alvarez, H.,Mamai, A.,Hoffer, L.,Guilinger, J.P.,Zhang, Y.,von Rechenberg, M.,Disch, J.S.,Mulhern, C.J.,Slakman, B.L.,Cuozzo, J.W.,Dong, A.,Poda, G.,Mohammed, M.,Saraon, P.,Mittal, M.,Modh, P.,Rathod, V.,Patel, B.,Ackloo, S.,Santhakumar, V.,Szewczyk, M.M.,Barsyte-Lovejoy, D.,Arrowsmith, C.H.,Marcellus, R.,Guie, M.A.,Keefe, A.D.,Brown, P.J.,Halabelian, L.,Al-Awar, R.,Vedadi, M. Discovery of Nanomolar DCAF1 Small Molecule Ligands. J.Med.Chem. 2023 66 5041 5060 7RMA 35385646 Structure of the fourth UIM (Ubiquitin Interacting Motif) of ANKRD13D in complex with a high affinity UbV (Ubiquitin Variant) 2021-07-27 2022-05-11 Veggiani, G.,Yates, B.P.,Martyn, G.D.,Manczyk, N.,Singer, A.U.,Kurinov, I.,Sicheri, F.,Sidhu, S.S. Panel of Engineered Ubiquitin Variants Targeting the Family of Human Ubiquitin Interacting Motifs. Acs Chem.Biol. 2022 17 941 956 7TZT 35561226 Crystal structure of the E. coli thiM riboswitch in complex with N1,N1-dimethyl-N2-(quinoxalin-6-ylmethyl)ethane-1,2-diamine (linked compound 37) 2022-02-16 2022-05-25 Zeller, M.J.,Favorov, O.,Li, K.,Nuthanakanti, A.,Hussein, D.,Michaud, A.,Lafontaine, D.A.,Busan, S.,Serganov, A.,Aube, J.,Weeks, K.M. SHAPE-enabled fragment-based ligand discovery for RNA. Proc.Natl.Acad.Sci.USA 2022 119 0 0 7SYY 35617431 Hendra virus G protein head domain in complex with cross-neutralizing murine antibody hAH1.3 2021-11-25 2022-06-01 Wang, Z.,Dang, H.V.,Amaya, M.,Xu, Y.,Yin, R.,Yan, L.,Hickey, A.C.,Annand, E.J.,Horsburgh, B.A.,Reid, P.A.,Smith, I.,Eden, J.S.,Xu, K.,Broder, C.C.,Veesler, D. Potent monoclonal antibody-mediated neutralization of a divergent Hendra virus variant. Proc.Natl.Acad.Sci.USA 2022 119 0 0 7T7K 35314193 Structure of SPAC806.04c protein from fission yeast bound to Co2+ 2021-12-15 2022-06-01 Sanchez, A.M.,Jacewicz, A.,Shuman, S. Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate. J.Biol.Chem. 2022 298 101851 101851 7T7N 35314193 Structure of SPCC1393.13 protein from fission yeast 2021-12-15 2022-06-01 Sanchez, A.M.,Jacewicz, A.,Shuman, S. Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate. J.Biol.Chem. 2022 298 101851 101851 7T7O 35314193 Structure of SPAC806.04c protein from fission yeast covalently bound to BeF3 2021-12-15 2022-06-01 Sanchez, A.M.,Jacewicz, A.,Shuman, S. Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate. J.Biol.Chem. 2022 298 101851 101851 7U1V 35314193 Structure of SPAC806.04c protein from fission yeast covalently bound to BeF3 2022-02-22 2022-06-01 Sanchez, A.M.,Jacewicz, A.,Shuman, S. Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate. J.Biol.Chem. 2022 298 101851 101851 7U1X 35314193 Structure of SPAC806.04c protein from fission yeast covalently bound to BeF3 2022-02-22 2022-06-01 Sanchez, A.M.,Jacewicz, A.,Shuman, S. Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate. J.Biol.Chem. 2022 298 101851 101851 7U1Y 35314193 Structure of SPAC806.04c protein from fission yeast bound to AlF4 and Co2+ 2022-02-22 2022-06-01 Sanchez, A.M.,Jacewicz, A.,Shuman, S. Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate. J.Biol.Chem. 2022 298 101851 101851 7RSZ 34795873 HIV-1 gp120 complex with CJF-II-204 2021-08-12 2022-06-08 Fritschi, C.J.,Liang, S.,Mohammadi, M.,Anang, S.,Moraca, F.,Chen, J.,Madani, N.,Sodroski, J.G.,Abrams, C.F.,Hendrickson, W.A.,Smith 3rd, A.B. Identification of gp120 Residue His105 as a Novel Target for HIV-1 Neutralization by Small-Molecule CD4-Mimics. Acs Med.Chem.Lett. 2021 12 1824 1831 7SYZ 35617431 Hendra virus G protein head domain in complex with cross-neutralizing murine antibody hAH1.3 2021-11-25 2022-06-08 Wang, Z.,Dang, H.V.,Amaya, M.,Xu, Y.,Yin, R.,Yan, L.,Hickey, A.C.,Annand, E.J.,Horsburgh, B.A.,Reid, P.A.,Smith, I.,Eden, J.S.,Xu, K.,Broder, C.C.,Veesler, D. Potent monoclonal antibody-mediated neutralization of a divergent Hendra virus variant. Proc.Natl.Acad.Sci.USA 2022 119 0 0 7UBU 35790763 Crystal structure of ZMET2 in complex with hemimethylated CAG DNA and a histone H3Kc9me2 peptide 2022-03-15 2022-06-08 Fang, J.,Jiang, J.,Leichter, S.M.,Liu, J.,Biswal, M.,Khudaverdyan, N.,Zhong, X.,Song, J. Mechanistic basis for maintenance of CHG DNA methylation in plants. Nat Commun 2022 13 3877 3877 7N9U CA-targeting nanobody is a tool for studying HIV-1 capsid lattice interactions 2021-06-18 2022-06-22 Gerber, E.E.,Digianantonio, K.M.,Tripler, T.N.,Smaga, S.S.,Summers, B.J.,Xiong, Y. CA-targeting nanobody is a tool for studying HIV-1 capsid lattice interactions To Be Published 0 0 0 0 7N9V CA-targeting nanobody is a tool for studying HIV-1 capsid lattice interactions 2021-06-18 2022-06-22 Gerber, E.E.,Digiananttonio, K.M.,Tripler, T.N.,Smaga, S.S.,Summers, B.J.,Xiong, Y. CA-targeting nanobody is a tool for studying HIV-1 capsid lattice interactions To Be Published 0 0 0 0 7N9X CA-targeting nanobody is a tool for studying HIV-1 capsid lattice interactions 2021-06-18 2022-06-22 Gerber, E.E.,Digianantonio, K.M.,Tripler, T.N.,Smaga, S.S.,Summers, B.J.,Xiong, Y. CA-targeting nanobody is a tool for studying HIV-1 capsid lattice interactions To Be Published 0 0 0 0 7V0E 35869095 Crystal structure of the macro-oligomeric form of DNMT3B methyltransferase domain. 2022-05-10 2022-06-22 Gao, L.,Guo, Y.,Biswal, M.,Lu, J.,Yin, J.,Fang, J.,Chen, X.,Shao, Z.,Huang, M.,Wang, Y.,Wang, G.G.,Song, J. Structure of DNMT3B homo-oligomer reveals vulnerability to impairment by ICF mutations. Nat Commun 2022 13 4249 4249 7T9X 35768507 Saccharomyces cerevisiae Pex12 RING domain 2021-12-20 2022-06-29 Feng, P.,Wu, X.,Erramilli, S.K.,Paulo, J.A.,Knejski, P.,Gygi, S.P.,Kossiakoff, A.A.,Rapoport, T.A. A peroxisomal ubiquitin ligase complex forms a retrotranslocation channel. Nature 2022 607 374 380 7WGD 35796008 X-ray structure of thermostabilized Drosophila dopamine transporter with GABA transporter1-like substitutions in the binding site, in substrate-free form. 2021-12-28 2022-06-29 Joseph, D.,Nayak, S.R.,Penmatsa, A. Structural insights into GABA transport inhibition using an engineered neurotransmitter transporter. Embo J. 2022 41 0 0 7WGT 35796008 X-ray structure of thermostabilized Drosophila dopamine transporter with GABA transporter1-like substitutions in the binding site, in complex with NO711. 2021-12-28 2022-06-29 Joseph, D.,Nayak, S.R.,Penmatsa, A. Structural insights into GABA transport inhibition using an engineered neurotransmitter transporter. Embo J. 2022 41 0 0 7RBP Medicago truncatula D-1-piperideine-2-carboxylic acid reductase 2021-07-06 2022-07-06 Torrens-Spence, M.P.,Weng, J.K. Pipecolic acid pathway is conserved in systemic acquired resistance between dicotyledon and monocotyledon plants To Be Published 0 0 0 0 7SZU 35759696 Crystal structure of Pepper RNA aptamer in complex with HBC ligand and Fab BL3-6 2021-11-29 2022-07-06 Rees, H.C.,Gogacz, W.,Li, N.S.,Koirala, D.,Piccirilli, J.A. Structural Basis for Fluorescence Activation by Pepper RNA. Acs Chem.Biol. 2022 17 1866 1875 7T7I 35802751 EBV nuclear egress complex 2021-12-15 2022-07-06 Thorsen, M.K.,Draganova, E.B.,Heldwein, E.E. The nuclear egress complex of Epstein-Barr virus buds membranes through an oligomerization-driven mechanism. Plos Pathog. 2022 18 0 0 7U2H 35766409 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Gly-NH-tRNAgly, aminoacylated P-site fMet-NH-tRNAmet, and deacylated E-site tRNAgly at 2.55A resolution 2022-02-24 2022-07-13 Syroegin, E.A.,Aleksandrova, E.V.,Polikanov, Y.S. Structural basis for the inability of chloramphenicol to inhibit peptide bond formation in the presence of A-site glycine. Nucleic Acids Res. 2022 50 7669 7679 7U2I 35766409 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Gly-NH-tRNAgly, aminoacylated P-site fMet-NH-tRNAmet, deacylated E-site tRNAgly, and chloramphenicol at 2.55A resolution 2022-02-24 2022-07-13 Syroegin, E.A.,Aleksandrova, E.V.,Polikanov, Y.S. Structural basis for the inability of chloramphenicol to inhibit peptide bond formation in the presence of A-site glycine. Nucleic Acids Res. 2022 50 7669 7679 7U2J 35766409 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Gly-NH-tRNAgly, peptidyl P-site fMAC-NH-tRNAmet, deacylated E-site tRNAgly, and chloramphenicol at 2.55A resolution 2022-02-24 2022-07-13 Syroegin, E.A.,Aleksandrova, E.V.,Polikanov, Y.S. Structural basis for the inability of chloramphenicol to inhibit peptide bond formation in the presence of A-site glycine. Nucleic Acids Res. 2022 50 7669 7679 7FCF 34906677 Crystal structure of T6SS Hcp protein 2021-07-14 2022-07-20 Zwe, Y.H.,Yadav, M.,Ten, M.M.Z.,Srinivasan, M.,Jobichen, C.,Sivaraman, J.,Li, D. Bacterial antagonism of Chromobacterium haemolyticum and characterization of its putative type VI secretion system. Res.Microbiol. 2022 173 103918 103918 7T2S 35762727 Structure of E. coli upec-117 Cap18 3'-5' exonuclease 2021-12-06 2022-07-20 Liang, Q.,Richey, S.T.,Ur, S.N.,Ye, Q.,Lau, R.K.,Corbett, K.D. Structure and activity of a bacterial defense-associated 3'-5' exonuclease. Protein Sci. 2022 31 0 0 7P56 36943866 Variant Surface Glycoprotein 2 (VSG2, MiTat1.2, VSG221) Bound to Calcium 2021-07-14 2022-07-27 Gkeka, A.,Aresta-Branco, F.,Triller, G.,Vlachou, E.P.,van Straaten, M.,Lilic, M.,Olinares, P.D.B.,Perez, K.,Chait, B.T.,Blatnik, R.,Ruppert, T.,Verdi, J.P.,Stebbins, C.E.,Papavasiliou, F.N. Immunodominant surface epitopes power immune evasion in the African trypanosome. Cell Rep 2023 42 112262 112262 7RE8 35840635 Class I MHC (HLA-A*02) presenting alpha fetoprotein peptide (AFP) 2021-07-12 2022-07-27 Liu, C.,Liu, H.,Dasgupta, M.,Hellman, L.M.,Zhang, X.,Qu, K.,Xue, H.,Wang, Y.,Fan, F.,Chang, Q.,Yu, D.,Ge, L.,Zhang, Y.,Cui, Z.,Zhang, P.,Heller, B.,Zhang, H.,Shi, B.,Baker, B.M.,Liu, C. Validation and promise of a TCR mimic antibody for cancer immunotherapy of hepatocellular carcinoma. Sci Rep 2022 12 12068 12068 7RE9 35840635 TCR mimic antibody (Fab fragment) 2021-07-12 2022-07-27 Liu, C.,Liu, H.,Dasgupta, M.,Hellman, L.M.,Zhang, X.,Qu, K.,Xue, H.,Wang, Y.,Fan, F.,Chang, Q.,Yu, D.,Ge, L.,Zhang, Y.,Cui, Z.,Zhang, P.,Heller, B.,Zhang, H.,Shi, B.,Baker, B.M.,Liu, C. Validation and promise of a TCR mimic antibody for cancer immunotherapy of hepatocellular carcinoma. Sci Rep 2022 12 12068 12068 8D6C 35880755 Crystal Structure of Human Myt1 Kinase domain Bounded with compound 28 2022-06-06 2022-07-27 Szychowski, J.,Papp, R.,Dietrich, E.,Liu, B.,Vallee, F.,Leclaire, M.E.,Fourtounis, J.,Martino, G.,Perryman, A.L.,Pau, V.,Yin, S.Y.,Mader, P.,Roulston, A.,Truchon, J.F.,Marshall, C.G.,Diallo, M.,Duffy, N.M.,Stocco, R.,Godbout, C.,Bonneau-Fortin, A.,Kryczka, R.,Bhaskaran, V.,Mao, D.,Orlicky, S.,Beaulieu, P.,Turcotte, P.,Kurinov, I.,Sicheri, F.,Mamane, Y.,Gallant, M.,Black, W.C. Discovery of an Orally Bioavailable and Selective PKMYT1 Inhibitor, RP-6306. J.Med.Chem. 2022 65 10251 10284 8D6D 35880755 Crystal Structure of Human Myt1 Kinase domain Bounded with compound 39 2022-06-06 2022-07-27 Szychowski, J.,Papp, R.,Dietrich, E.,Liu, B.,Vallee, F.,Leclaire, M.E.,Fourtounis, J.,Martino, G.,Perryman, A.L.,Pau, V.,Yin, S.Y.,Mader, P.,Roulston, A.,Truchon, J.F.,Marshall, C.G.,Diallo, M.,Duffy, N.M.,Stocco, R.,Godbout, C.,Bonneau-Fortin, A.,Kryczka, R.,Bhaskaran, V.,Mao, D.,Orlicky, S.,Beaulieu, P.,Turcotte, P.,Kurinov, I.,Sicheri, F.,Mamane, Y.,Gallant, M.,Black, W.C. Discovery of an Orally Bioavailable and Selective PKMYT1 Inhibitor, RP-6306. J.Med.Chem. 2022 65 10251 10284 8D6E 35880755 Crystal Structure of Human Myt1 Kinase domain Bounded with RP-6306 2022-06-06 2022-07-27 Szychowski, J.,Papp, R.,Dietrich, E.,Liu, B.,Vallee, F.,Leclaire, M.E.,Fourtounis, J.,Martino, G.,Perryman, A.L.,Pau, V.,Yin, S.Y.,Mader, P.,Roulston, A.,Truchon, J.F.,Marshall, C.G.,Diallo, M.,Duffy, N.M.,Stocco, R.,Godbout, C.,Bonneau-Fortin, A.,Kryczka, R.,Bhaskaran, V.,Mao, D.,Orlicky, S.,Beaulieu, P.,Turcotte, P.,Kurinov, I.,Sicheri, F.,Mamane, Y.,Gallant, M.,Black, W.C. Discovery of an Orally Bioavailable and Selective PKMYT1 Inhibitor, RP-6306. J.Med.Chem. 2022 65 10251 10284 8D6F 35880755 Crystal Structure of Human Myt1 Kinase domain Bounded with Eph receptor inhibitor / compound 41 2022-06-06 2022-07-27 Szychowski, J.,Papp, R.,Dietrich, E.,Liu, B.,Vallee, F.,Leclaire, M.E.,Fourtounis, J.,Martino, G.,Perryman, A.L.,Pau, V.,Yin, S.Y.,Mader, P.,Roulston, A.,Truchon, J.F.,Marshall, C.G.,Diallo, M.,Duffy, N.M.,Stocco, R.,Godbout, C.,Bonneau-Fortin, A.,Kryczka, R.,Bhaskaran, V.,Mao, D.,Orlicky, S.,Beaulieu, P.,Turcotte, P.,Kurinov, I.,Sicheri, F.,Mamane, Y.,Gallant, M.,Black, W.C. Discovery of an Orally Bioavailable and Selective PKMYT1 Inhibitor, RP-6306. J.Med.Chem. 2022 65 10251 10284 7ROM Crystal structure of Saccharomyces cerevisiae NADH-cytochrome b5 reductase 1 (Cbr1) fragment (residues 28-284) bound to FAD 2021-07-31 2022-08-10 Fenwick, M.K.,Lin, H. Crystal structure of Saccharomyces cerevisiae NADH-cytochrome b5 reductase 1 (Cbr1) fragment (residues 28-284) bound to FAD To Be Published 0 0 0 0 7UQW 35905922 PCC6803 Cyanophycinase S132DAP covalently bound to cyanophycin dimer 2022-04-20 2022-08-10 Sharon, I.,Grogg, M.,Hilvert, D.,Schmeing, T.M. The structure of cyanophycinase in complex with a cyanophycin degradation intermediate. Biochim Biophys Acta Gen Subj 2022 1866 130217 130217 7RTI 36477367 X-ray structure of RBPJ-L3MBTL3(dT62)-DNA complex 2021-08-13 2022-08-24 Hall, D.,Giaimo, B.D.,Park, S.S.,Hemmer, W.,Friedrich, T.,Ferrante, F.,Bartkuhn, M.,Yuan, Z.,Oswald, F.,Borggrefe, T.,Rual, J.F.,Kovall, R.A. The structure, binding and function of a Notch transcription complex involving RBPJ and the epigenetic reader protein L3MBTL3. Nucleic Acids Res. 2022 50 13083 13099 8DZK 36484984 Dbr1 in complex with 5-mer cleavage product 2022-08-08 2022-08-24 Clark, N.E.,Katolik, A.,Welch, A.,Schorl, C.,Holloway, S.P.,Schuermann, J.P.,Hart, P.J.,Taylor, A.B.,Damha, M.J.,Fairbrother, W.G. Crystal Structure of the RNA Lariat Debranching Enzyme Dbr1 with Hydrolyzed Phosphorothioate RNA Product. Biochemistry 2022 61 2933 2939 7TA2 36115925 Crystal structure of the human sperm-expressed surface protein SPACA6 2021-12-20 2022-08-31 Vance, T.D.R.,Yip, P.,Jimenez, E.,Li, S.,Gawol, D.,Byrnes, J.,Uson, I.,Ziyyat, A.,Lee, J.E. SPACA6 ectodomain structure reveals a conserved superfamily of gamete fusion-associated proteins. Commun Biol 2022 5 984 984 7TTL 35863431 Stable-5-LOX elongated Ha2 (4 copies ASU) 2022-02-01 2022-08-31 Gallegos, E.M.,Reed, T.D.,Mathes, F.A.,Guevara, N.V.,Neau, D.B.,Huang, W.,Newcomer, M.E.,Gilbert, N.C. Helical remodeling augments 5-lipoxygenase activity in the synthesis of proinflammatory mediators. J.Biol.Chem. 2022 298 102282 102282 7UG9 35904778 Crystal structure of RNase AM PHP domain 2022-03-24 2022-08-31 Sharma, S.,Yang, J.,Doamekpor, S.K.,Grudizen-Nogalska, E.,Tong, L.,Kiledjian, M. Identification of a novel deFADding activity in human, yeast and bacterial 5' to 3' exoribonucleases. Nucleic Acids Res. 2022 50 8807 8817 7SAL 36040252 Crystal Structure of LaM6 Nanobody bound to mCherry 2021-09-22 2022-09-14 Cong, A.T.Q.,Witter, T.L.,Schellenberg, M.J. High-efficiency recombinant protein purification using mCherry and YFP nanobody affinity matrices. Protein Sci. 2022 31 0 0 7T5V 36156805 Structure of E. coli CapH C-terminal domain I99M mutant 2021-12-13 2022-09-14 Lau, R.K.,Enustun, E.,Gu, Y.,Nguyen, J.V.,Corbett, K.D. A conserved signaling pathway activates bacterial CBASS immune signaling in response to DNA damage. Embo J. 2022 41 0 0 7UCP 36041435 computationally designed macrocycle 2022-03-17 2022-09-14 Bhardwaj, G.,O'Connor, J.,Rettie, S.,Huang, Y.H.,Ramelot, T.A.,Mulligan, V.K.,Alpkilic, G.G.,Palmer, J.,Bera, A.K.,Bick, M.J.,Di Piazza, M.,Li, X.,Hosseinzadeh, P.,Craven, T.W.,Tejero, R.,Lauko, A.,Choi, R.,Glynn, C.,Dong, L.,Griffin, R.,van Voorhis, W.C.,Rodriguez, J.,Stewart, L.,Montelione, G.T.,Craik, D.,Baker, D. Accurate de novo design of membrane-traversing macrocycles. Cell 2022 185 3520 0 8D5N 35967379 Crystal structure of Ld-HF10 2022-06-05 2022-09-14 Wang, Y.,Tsitsiklis, A.,Devoe, S.,Gao, W.,Chu, H.H.,Zhang, Y.,Li, W.,Wong, W.K.,Deane, C.M.,Neau, D.,Slansky, J.E.,Thomas, P.G.,Robey, E.A.,Dai, S. Peptide Centric V beta Specific Germline Contacts Shape a Specialist T Cell Response. Front Immunol 2022 13 847092 847092 8D5P 35967379 Mouse TCR TG6 2022-06-05 2022-09-14 Wang, Y.,Tsitsiklis, A.,Devoe, S.,Gao, W.,Chu, H.H.,Zhang, Y.,Li, W.,Wong, W.K.,Deane, C.M.,Neau, D.,Slansky, J.E.,Thomas, P.G.,Robey, E.A.,Dai, S. Peptide Centric V beta Specific Germline Contacts Shape a Specialist T Cell Response. Front Immunol 2022 13 847092 847092 7UK1 35998361 Complex Structure of Human Polypyrimidine Splicing Factor (PSF/SFPQ) with Murine Virus-like 30S Transcript-1 (VS30-1) Reveals Cooperative Binding of RNA 2022-03-31 2022-09-21 Wang, J.,Sachpatzidis, A.,Christian, T.D.,Lomakin, I.B.,Garen, A.,Konigsberg, W.H. Insight into the Tumor Suppression Mechanism from the Structure of Human Polypyrimidine Splicing Factor (PSF/SFPQ) Complexed with a 30mer RNA from Murine Virus-like 30S Transcript-1. Biochemistry 2022 61 1723 1734 7MDE 36253550 Full-length S95A ClbP 2021-04-04 2022-09-28 Velilla, J.A.,Volpe, M.R.,Kenney, G.E.,Walsh Jr., R.M.,Balskus, E.P.,Gaudet, R. Structural basis of colibactin activation by the ClbP peptidase. Nat.Chem.Biol. 2023 19 151 158 7MDF 36253550 Full-length S95A ClbP bound to N-acyl-D-asparagine analog 2021-04-04 2022-09-28 Velilla, J.A.,Volpe, M.R.,Kenney, G.E.,Walsh Jr., R.M.,Balskus, E.P.,Gaudet, R. Structural basis of colibactin activation by the ClbP peptidase. Nat.Chem.Biol. 2023 19 151 158 7S7G 35760926 Crystal Structure Analysis of Human VLCAD 2021-09-15 2022-09-28 Prew, M.S.,Camara, C.M.,Botzanowski, T.,Moroco, J.A.,Bloch, N.B.,Levy, H.R.,Seo, H.S.,Dhe-Paganon, S.,Bird, G.H.,Herce, H.D.,Gygi, M.A.,Escudero, S.,Wales, T.E.,Engen, J.R.,Walensky, L.D. Structural basis for defective membrane targeting of mutant enzyme in human VLCAD deficiency. Nat Commun 2022 13 3669 3669 8D03 36108048 Hallucinated C2 protein assembly HALC2_068 2022-05-25 2022-09-28 Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Ragotte, R.J.,Dauparas, J.,Kinfu, E.,Tipps, S.,Kibler, R.D.,Baek, M.,DiMaio, F.,Li, X.,Carter, L.,Kang, A.,Nguyen, H.,Bera, A.K.,Baker, D. Hallucinating symmetric protein assemblies. Science 2022 378 56 61 8D04 36108048 Hallucinated C2 protein assembly HALC2_062 2022-05-25 2022-09-28 Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Ragotte, R.J.,Dauparas, J.,Kinfu, E.,Tipps, S.,Kibler, R.D.,Baek, M.,DiMaio, F.,Li, X.,Carter, L.,Kang, A.,Nguyen, H.,Bera, A.K.,Baker, D. Hallucinating symmetric protein assemblies. Science 2022 378 56 61 8D05 36108048 Hallucinated C2 protein assembly HALC2_065 2022-05-25 2022-09-28 Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Ragotte, R.J.,Dauparas, J.,Kinfu, E.,Tipps, S.,Kibler, R.D.,Baek, M.,DiMaio, F.,Li, X.,Carter, L.,Kang, A.,Nguyen, H.,Bera, A.K.,Baker, D. Hallucinating symmetric protein assemblies. Science 2022 378 56 61 8D06 36108048 Hallucinated C3 protein assembly HALC3_104 2022-05-25 2022-09-28 Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Ragotte, R.J.,Dauparas, J.,Kinfu, E.,Tipps, S.,Kibler, R.D.,Baek, M.,DiMaio, F.,Li, X.,Carter, L.,Kang, A.,Nguyen, H.,Bera, A.K.,Baker, D. Hallucinating symmetric protein assemblies. Science 2022 378 56 61 8D07 36108048 Hallucinated C3 protein assembly HALC3_109 2022-05-25 2022-09-28 Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Ragotte, R.J.,Dauparas, J.,Kinfu, E.,Tipps, S.,Kibler, R.D.,Baek, M.,DiMaio, F.,Li, X.,Carter, L.,Kang, A.,Nguyen, H.,Bera, A.K.,Baker, D. Hallucinating symmetric protein assemblies. Science 2022 378 56 61 8D08 36108048 Hallucinated C4 protein assembly HALC4_135 2022-05-25 2022-09-28 Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Ragotte, R.J.,Dauparas, J.,Kinfu, E.,Tipps, S.,Kibler, R.D.,Baek, M.,DiMaio, F.,Li, X.,Carter, L.,Kang, A.,Nguyen, H.,Bera, A.K.,Baker, D. Hallucinating symmetric protein assemblies. Science 2022 378 56 61 8D09 36108048 Hallucinated C4 protein assembly HALC4_136 2022-05-25 2022-09-28 Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Ragotte, R.J.,Dauparas, J.,Kinfu, E.,Tipps, S.,Kibler, R.D.,Baek, M.,DiMaio, F.,Li, X.,Carter, L.,Kang, A.,Nguyen, H.,Bera, A.K.,Baker, D. Hallucinating symmetric protein assemblies. Science 2022 378 56 61 8DAY 36084241 Crystal Structure of DMATS1 prenyltransferase in complex with L-Tyr and DMSPP 2022-06-14 2022-09-28 Eaton, S.A.,Ronnebaum, T.A.,Roose, B.W.,Christianson, D.W. Structural Basis of Substrate Promiscuity and Catalysis by the Reverse Prenyltransferase N -Dimethylallyl-l-tryptophan Synthase from Fusarium fujikuroi . Biochemistry 2022 61 2025 2035 8DAZ 36084241 Crystal structure of DMATS1 prenyltransferase in complex with L-Trp and GSPP 2022-06-14 2022-09-28 Eaton, S.A.,Ronnebaum, T.A.,Roose, B.W.,Christianson, D.W. Structural Basis of Substrate Promiscuity and Catalysis by the Reverse Prenyltransferase N -Dimethylallyl-l-tryptophan Synthase from Fusarium fujikuroi . Biochemistry 2022 61 2025 2035 8DB0 36084241 Crystal structure of DMATS1 prenyltransferase in complex with L-Trp and DMSPP 2022-06-14 2022-09-28 Eaton, S.A.,Ronnebaum, T.A.,Roose, B.W.,Christianson, D.W. Structural Basis of Substrate Promiscuity and Catalysis by the Reverse Prenyltransferase N -Dimethylallyl-l-tryptophan Synthase from Fusarium fujikuroi . Biochemistry 2022 61 2025 2035 8DB1 36084241 Crystal structure of native DMATS1 prenyltransferase 2022-06-14 2022-09-28 Eaton, S.A.,Ronnebaum, T.A.,Roose, B.W.,Christianson, D.W. Structural Basis of Substrate Promiscuity and Catalysis by the Reverse Prenyltransferase N -Dimethylallyl-l-tryptophan Synthase from Fusarium fujikuroi . Biochemistry 2022 61 2025 2035 7SCM 36911992 Crystal Structure of Ancestral Amniote Cadherin-23 EC1-2 2021-09-28 2022-10-05 Nisler, C.R.,Narui, Y.,Scheib, E.,Choudhary, D.,Bowman, J.D.,Mandayam Bharathi, H.,Lynch, V.J.,Sotomayor, M. Interpreting the Evolutionary Echoes of a Protein Complex Essential for Inner-Ear Mechanosensation. Mol.Biol.Evol. 2023 40 0 0 7SGG 36200994 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with SAHA 2021-10-05 2022-10-05 Steimbach, R.R.,Herbst-Gervasoni, C.J.,Lechner, S.,Stewart, T.M.,Klinke, G.,Ridinger, J.,Geraldy, M.N.E.,Tihanyi, G.,Foley, J.R.,Uhrig, U.,Kuster, B.,Poschet, G.,Casero Jr., R.A.,Medard, G.,Oehme, I.,Christianson, D.W.,Gunkel, N.,Miller, A.K. Aza-SAHA Derivatives Are Selective Histone Deacetylase 10 Chemical Probes That Inhibit Polyamine Deacetylation and Phenocopy HDAC10 Knockout. J.Am.Chem.Soc. 2022 144 18861 18875 7SGI 36200994 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Inhibitor 14 2021-10-05 2022-10-05 Steimbach, R.R.,Herbst-Gervasoni, C.J.,Lechner, S.,Stewart, T.M.,Klinke, G.,Ridinger, J.,Geraldy, M.N.E.,Tihanyi, G.,Foley, J.R.,Uhrig, U.,Kuster, B.,Poschet, G.,Casero Jr., R.A.,Medard, G.,Oehme, I.,Christianson, D.W.,Gunkel, N.,Miller, A.K. Aza-SAHA Derivatives Are Selective Histone Deacetylase 10 Chemical Probes That Inhibit Polyamine Deacetylation and Phenocopy HDAC10 Knockout. J.Am.Chem.Soc. 2022 144 18861 18875 7SGJ 36200994 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with DKFZ-711 2021-10-05 2022-10-05 Steimbach, R.R.,Herbst-Gervasoni, C.J.,Lechner, S.,Stewart, T.M.,Klinke, G.,Ridinger, J.,Geraldy, M.N.E.,Tihanyi, G.,Foley, J.R.,Uhrig, U.,Kuster, B.,Poschet, G.,Casero Jr., R.A.,Medard, G.,Oehme, I.,Christianson, D.W.,Gunkel, N.,Miller, A.K. Aza-SAHA Derivatives Are Selective Histone Deacetylase 10 Chemical Probes That Inhibit Polyamine Deacetylation and Phenocopy HDAC10 Knockout. J.Am.Chem.Soc. 2022 144 18861 18875 7SGK 36200994 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with DKFZ-728 2021-10-05 2022-10-05 Steimbach, R.R.,Herbst-Gervasoni, C.J.,Lechner, S.,Stewart, T.M.,Klinke, G.,Ridinger, J.,Geraldy, M.N.E.,Tihanyi, G.,Foley, J.R.,Uhrig, U.,Kuster, B.,Poschet, G.,Casero Jr., R.A.,Medard, G.,Oehme, I.,Christianson, D.W.,Gunkel, N.,Miller, A.K. Aza-SAHA Derivatives Are Selective Histone Deacetylase 10 Chemical Probes That Inhibit Polyamine Deacetylation and Phenocopy HDAC10 Knockout. J.Am.Chem.Soc. 2022 144 18861 18875 7U3F 36117290 GID4 in complex with compound 4 2022-02-27 2022-10-05 Chana, C.K.,Maisonneuve, P.,Posternak, G.,Grinberg, N.G.A.,Poirson, J.,Ona, S.M.,Ceccarelli, D.F.,Mader, P.,St-Cyr, D.J.,Pau, V.,Kurinov, I.,Tang, X.,Deng, D.,Cui, W.,Su, W.,Kuai, L.,Soll, R.,Tyers, M.,Rost, H.L.,Batey, R.A.,Taipale, M.,Gingras, A.C.,Sicheri, F. Discovery and Structural Characterization of Small Molecule Binders of the Human CTLH E3 Ligase Subunit GID4. J.Med.Chem. 2022 65 12725 12746 7U3G 36117290 GID4 in complex with compound 67 2022-02-27 2022-10-05 Chana, C.K.,Maisonneuve, P.,Posternak, G.,Grinberg, N.G.A.,Poirson, J.,Ona, S.M.,Ceccarelli, D.F.,Mader, P.,St-Cyr, D.J.,Pau, V.,Kurinov, I.,Tang, X.,Deng, D.,Cui, W.,Su, W.,Kuai, L.,Soll, R.,Tyers, M.,Rost, H.L.,Batey, R.A.,Taipale, M.,Gingras, A.C.,Sicheri, F. Discovery and Structural Characterization of Small Molecule Binders of the Human CTLH E3 Ligase Subunit GID4. J.Med.Chem. 2022 65 12725 12746 7U3H 36117290 GID4 in complex with compound 7 2022-02-27 2022-10-05 Chana, C.K.,Maisonneuve, P.,Posternak, G.,Grinberg, N.G.A.,Poirson, J.,Ona, S.M.,Ceccarelli, D.F.,Mader, P.,St-Cyr, D.J.,Pau, V.,Kurinov, I.,Tang, X.,Deng, D.,Cui, W.,Su, W.,Kuai, L.,Soll, R.,Tyers, M.,Rost, H.L.,Batey, R.A.,Taipale, M.,Gingras, A.C.,Sicheri, F. Discovery and Structural Characterization of Small Molecule Binders of the Human CTLH E3 Ligase Subunit GID4. J.Med.Chem. 2022 65 12725 12746 7U3J 36117290 GID4 in complex with compound 88 2022-02-27 2022-10-05 Chana, C.K.,Maisonneuve, P.,Posternak, G.,Grinberg, N.G.A.,Poirson, J.,Ona, S.M.,Ceccarelli, D.F.,Mader, P.,St-Cyr, D.J.,Pau, V.,Kurinov, I.,Tang, X.,Deng, D.,Cui, W.,Su, W.,Kuai, L.,Soll, R.,Tyers, M.,Rost, H.L.,Batey, R.A.,Taipale, M.,Gingras, A.C.,Sicheri, F. Discovery and Structural Characterization of Small Molecule Binders of the Human CTLH E3 Ligase Subunit GID4. J.Med.Chem. 2022 65 12725 12746 7U3K 36117290 GID4 in complex with compound 89 2022-02-27 2022-10-05 Chana, C.K.,Maisonneuve, P.,Posternak, G.,Grinberg, N.G.A.,Poirson, J.,Ona, S.M.,Ceccarelli, D.F.,Mader, P.,St-Cyr, D.J.,Pau, V.,Kurinov, I.,Tang, X.,Deng, D.,Cui, W.,Su, W.,Kuai, L.,Soll, R.,Tyers, M.,Rost, H.L.,Batey, R.A.,Taipale, M.,Gingras, A.C.,Sicheri, F. Discovery and Structural Characterization of Small Molecule Binders of the Human CTLH E3 Ligase Subunit GID4. J.Med.Chem. 2022 65 12725 12746 7U3L 36117290 GID4 in complex with compound 91 2022-02-27 2022-10-05 Chana, C.K.,Maisonneuve, P.,Posternak, G.,Grinberg, N.G.A.,Poirson, J.,Ona, S.M.,Ceccarelli, D.F.,Mader, P.,St-Cyr, D.J.,Pau, V.,Kurinov, I.,Tang, X.,Deng, D.,Cui, W.,Su, W.,Kuai, L.,Soll, R.,Tyers, M.,Rost, H.L.,Batey, R.A.,Taipale, M.,Gingras, A.C.,Sicheri, F. Discovery and Structural Characterization of Small Molecule Binders of the Human CTLH E3 Ligase Subunit GID4. J.Med.Chem. 2022 65 12725 12746 7UAV 36174646 Structure of Clostridium botulinum prophage Tad1 in apo state 2022-03-14 2022-10-05 Leavitt, A.,Yirmiya, E.,Amitai, G.,Lu, A.,Garb, J.,Herbst, E.,Morehouse, B.R.,Hobbs, S.J.,Antine, S.P.,Sun, Z.J.,Kranzusch, P.J.,Sorek, R. Viruses inhibit TIR gcADPR signalling to overcome bacterial defence. Nature 2022 611 326 331 7UAW 36174646 Structure of Clostridium botulinum prophage Tad1 in complex with 1''-2' gcADPR 2022-03-14 2022-10-05 Leavitt, A.,Yirmiya, E.,Amitai, G.,Lu, A.,Garb, J.,Herbst, E.,Morehouse, B.R.,Hobbs, S.J.,Antine, S.P.,Sun, Z.J.,Kranzusch, P.J.,Sorek, R. Viruses inhibit TIR gcADPR signalling to overcome bacterial defence. Nature 2022 611 326 331 7SHO 37536341 Crystal structure of hSTING in complex with c[2',3'-(ara-2'-G, ribo-3'-A)-MP] (RJ242) 2021-10-10 2022-10-12 Xie, W.,Lama, L.,Yang, X.,Kuryavyi, V.,Bhattacharya, S.,Nudelman, I.,Yang, G.,Ouerfelli, O.,Glickman, J.F.,Jones, R.A.,Tuschl, T.,Patel, D.J. Arabinose- and xylose-modified analogs of 2',3'-cGAMP act as STING agonists. Cell Chem Biol 2023 0 0 0 7T99 36147680 Crystal structure of engineered CYS-CYS fab dimer CL-205 (LC25) 2021-12-18 2022-10-12 Yin, Y.,Romei, M.G.,Sankar, K.,Pal, L.R.,Hoi, K.H.,Yang, Y.,Leonard, B.,De Leon Boenig, G.,Kumar, N.,Matsumoto, M.,Payandeh, J.,Harris, S.F.,Moult, J.,Lazar, G.A. Antibody interfaces revealed through structural mining. Comput Struct Biotechnol J 2022 20 4952 4968 7TGI 35182523 Single-domain VHH intrabodies neutralize ricin toxin 2022-01-07 2022-10-12 Czajka, T.F.,Vance, D.J.,Davis, S.,Rudolph, M.J.,Mantis, N.J. Single-domain antibodies neutralize ricin toxin intracellularly by blocking access to ribosomal P-stalk proteins. J.Biol.Chem. 2022 298 101742 101742 8D3A 36225920 Crystal Structure of DH475 Fab in complex with Man9 2022-06-01 2022-10-12 Finkelstein, M.T.,Parker Miller, E.,Erdman, M.C.,Fera, D. Analysis of two cooperating antibodies unveils immune pressure imposed on HIV Env to elicit a V3-glycan supersite broadly neutralizing antibody lineage. Front Immunol 2022 13 962939 962939 8DCA 36130078 RNA ligase RtcB from Pyrococcus horikoshii in complex with Co2+ and GTP 2022-06-16 2022-10-12 Jacewicz, A.,Dantuluri, S.,Shuman, S. Structures of RNA ligase RtcB in complexes with divalent cations and GTP. Rna 2022 28 1509 1518 8DCB 36130078 RNA ligase RtcB from Pyrococcus horikoshii in complex with Ni2+ and GTP 2022-06-16 2022-10-12 Jacewicz, A.,Dantuluri, S.,Shuman, S. Structures of RNA ligase RtcB in complexes with divalent cations and GTP. Rna 2022 28 1509 1518 8DCD 36130078 RNA ligase RtcB from Pyrococcus horikoshii in complex with Zn2+ and GTP 2022-06-16 2022-10-12 Jacewicz, A.,Dantuluri, S.,Shuman, S. Structures of RNA ligase RtcB in complexes with divalent cations and GTP. Rna 2022 28 1509 1518 8DCG 36130078 Structure of guanylylated RNA ligase RtcB from Pyrococcus horikoshii 2022-06-16 2022-10-12 Jacewicz, A.,Dantuluri, S.,Shuman, S. Structures of RNA ligase RtcB in complexes with divalent cations and GTP. Rna 2022 28 1509 1518 8EDV 36282247 Mitoguardin homolog (MIGA) delta TM residues 106-496 from Caenorhabditis elegans bound to modelled lipid phosphatidylethanolamine 2022-09-06 2022-10-12 Hong, Z.,Adlakha, J.,Wan, N.,Guinn, E.,Giska, F.,Gupta, K.,Melia, T.J.,Reinisch, K.M. Mitoguardin-2-mediated lipid transfer preserves mitochondrial morphology and lipid droplet formation. J.Cell Biol. 2022 221 0 0 7SHP 37536341 Crystal structure of hSTING in complex with c[2',3'-(ribo-2'-G, xylo-3'-A)-MP](RJ244) 2021-10-11 2022-10-19 Xie, W.,Lama, L.,Yang, X.,Kuryavyi, V.,Bhattacharya, S.,Nudelman, I.,Yang, G.,Ouerfelli, O.,Glickman, J.F.,Jones, R.A.,Tuschl, T.,Patel, D.J. Arabinose- and xylose-modified analogs of 2',3'-cGAMP act as STING agonists. Cell Chem Biol 2023 0 0 0 8CVJ 36316410 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Phe-NH-tRNAphe, peptidyl P-site fMSEAC-NH-tRNAmet, and deacylated E-site tRNAphe at 2.40A resolution 2022-05-18 2022-10-19 Syroegin, E.A.,Aleksandrova, E.V.,Polikanov, Y.S. Insights into the ribosome function from the structures of non-arrested ribosome-nascent chain complexes. Nat.Chem. 2023 15 143 153 8CVK 36316410 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Phe-NH-tRNAphe, peptidyl P-site fMRC-NH-tRNAmet, and deacylated E-site tRNAphe at 2.50A resolution 2022-05-18 2022-10-19 Syroegin, E.A.,Aleksandrova, E.V.,Polikanov, Y.S. Insights into the ribosome function from the structures of non-arrested ribosome-nascent chain complexes. Nat.Chem. 2023 15 143 153 8CVL 36316410 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Phe-NH-tRNAphe, peptidyl P-site fMTHSMRC-NH-tRNAmet, and deacylated E-site tRNAphe at 2.30A resolution 2022-05-18 2022-10-19 Syroegin, E.A.,Aleksandrova, E.V.,Polikanov, Y.S. Insights into the ribosome function from the structures of non-arrested ribosome-nascent chain complexes. Nat.Chem. 2023 15 143 153 7SGX 36911992 Crystal Structure of Turtle Cadherin-23 EC1-2 2021-10-07 2022-10-26 Nisler, C.R.,Narui, Y.,Scheib, E.,Choudhary, D.,Bowman, J.D.,Mandayam Bharathi, H.,Lynch, V.J.,Sotomayor, M. Interpreting the Evolutionary Echoes of a Protein Complex Essential for Inner-Ear Mechanosensation. Mol.Biol.Evol. 2023 40 0 0 7SKH Crystal Structure of Mouse Cadherin-23 EC16-17 2021-10-20 2022-10-26 Sudar, J.C.,Sandhu, J.S.,Sotomayor, M. Crystal Structure of Mouse Cadherin-23 EC16-17 to be published 0 0 0 0 7UKZ 36327972 CDK11 in complex with small molecule inhibitor OTS964 2022-04-03 2022-10-26 Kelso, S.,O'Brien, S.,Kurinov, I.,Angers, S.,Sicheri, F. Crystal structure of the CDK11 kinase domain bound to the small-molecule inhibitor OTS964. Structure 2022 30 1615 0 8E4X 36243986 Human Adenosine Deaminase Acting on dsRNA (ADAR2-R2D) bound to dsRNA containing a G:3-deaza dA pair adjacent to the target site 2022-08-19 2022-10-26 Doherty, E.E.,Karki, A.,Wilcox, X.E.,Mendoza, H.G.,Manjunath, A.,Matos, V.J.,Fisher, A.J.,Beal, P.A. ADAR activation by inducing a syn conformation at guanosine adjacent to an editing site. Nucleic Acids Res. 2022 50 10857 10868 7ULN Turnip yellows virus N-terminal readthrough domain 2022-04-05 2022-11-02 Schiltz, C.J.,Wilson, J.R.,Hosford, C.J.,Adams, M.C.,Preising, S.E.,DeBlasio, S.L.,MacLeod, H.J.,Van Eck, J.,Heck, M.L.,Chappie, J.S. Polerovirus N-terminal readthrough domain structures reveal molecular strategies for mitigating virus transmission by aphids Nat Commun 2022 13 6368 0 8DGQ 36417908 Crystal structure of p120RasGAP SH2-SH3-SH2 in complex with p190RhoGAP doubly phosphorylated peptide 2022-06-24 2022-11-02 Stiegler, A.L.,Vish, K.J.,Boggon, T.J. Tandem engagement of phosphotyrosines by the dual SH2 domains of p120RasGAP. Structure 2022 30 1603 0 7S07 36306784 Crystal structure of Epstein-Barr virus glycoprotein gH/gL/gp42-peptide in complex with human neutralizing antibodies 769B10 and 769C2 2021-08-30 2022-11-09 Chen, W.H.,Kim, J.,Bu, W.,Board, N.L.,Tsybovsky, Y.,Wang, Y.,Hostal, A.,Andrews, S.F.,Gillespie, R.A.,Choe, M.,Stephens, T.,Yang, E.S.,Pegu, A.,Peterson, C.E.,Fisher, B.E.,Mascola, J.R.,Pittaluga, S.,McDermott, A.B.,Kanekiyo, M.,Joyce, M.G.,Cohen, J.I. Epstein-Barr virus gH/gL has multiple sites of vulnerability for virus neutralization and fusion inhibition. Immunity 2022 55 2135 0 7S08 36306784 Crystal structure of Epstein-Barr virus gH/gL targeting antibody 770F7 2021-08-30 2022-11-09 Chen, W.H.,Kim, J.,Bu, W.,Board, N.L.,Tsybovsky, Y.,Wang, Y.,Hostal, A.,Andrews, S.F.,Gillespie, R.A.,Choe, M.,Stephens, T.,Yang, E.S.,Pegu, A.,Peterson, C.E.,Fisher, B.E.,Mascola, J.R.,Pittaluga, S.,McDermott, A.B.,Kanekiyo, M.,Joyce, M.G.,Cohen, J.I. Epstein-Barr virus gH/gL has multiple sites of vulnerability for virus neutralization and fusion inhibition. Immunity 2022 55 2135 0 7S0J 36306784 Crystal structure of Epstein-Barr virus gH/gL targeting antibody 769B10 2021-08-30 2022-11-09 Chen, W.H.,Kim, J.,Bu, W.,Board, N.L.,Tsybovsky, Y.,Wang, Y.,Hostal, A.,Andrews, S.F.,Gillespie, R.A.,Choe, M.,Stephens, T.,Yang, E.S.,Pegu, A.,Peterson, C.E.,Fisher, B.E.,Mascola, J.R.,Pittaluga, S.,McDermott, A.B.,Kanekiyo, M.,Joyce, M.G.,Cohen, J.I. Epstein-Barr virus gH/gL has multiple sites of vulnerability for virus neutralization and fusion inhibition. Immunity 2022 55 2135 0 7S1B 36306784 Crystal structure of Epstein-Barr virus glycoproteins gH/gL/gp42-peptide in complex with human neutralizing antibodies 769C2 and 770F7 2021-09-02 2022-11-09 Chen, W.H.,Kim, J.,Bu, W.,Board, N.L.,Tsybovsky, Y.,Wang, Y.,Hostal, A.,Andrews, S.F.,Gillespie, R.A.,Choe, M.,Stephens, T.,Yang, E.S.,Pegu, A.,Peterson, C.E.,Fisher, B.E.,Mascola, J.R.,Pittaluga, S.,McDermott, A.B.,Kanekiyo, M.,Joyce, M.G.,Cohen, J.I. Epstein-Barr virus gH/gL has multiple sites of vulnerability for virus neutralization and fusion inhibition. Immunity 2022 55 2135 0 7STC AQP5 T41H with Ni2+ 2021-11-12 2022-11-16 Kowatz, T.,Lodowski, D.,Vahedi-Faridi, A. AQP5 T41H with Ni2+ To Be Published 0 0 0 0 7TJC 36153664 VHH Chl-B2 in complex with Chloramphenicol 2022-01-16 2022-11-23 Swofford, C.A.,Nordeen, S.A.,Chen, L.,Desai, M.M.,Chen, J.,Springs, S.L.,Schwartz, T.U.,Sinskey, A.J. Structure and specificity of an anti-chloramphenicol single domain antibody for detection of amphenicol residues. Protein Sci. 2022 31 0 0 7U98 36384036 EGFR(T790M/V948R) in complex with a macrocyclic inhibitor 2022-03-10 2022-11-23 Amrhein, J.A.,Beyett, T.S.,Feng, W.W.,Kramer, A.,Weckesser, J.,Schaeffner, I.K.,Rana, J.K.,Janne, P.A.,Eck, M.J.,Knapp, S.,Hanke, T. Macrocyclization of Quinazoline-Based EGFR Inhibitors Leads to Exclusive Mutant Selectivity for EGFR L858R and Del19. J.Med.Chem. 2022 65 15679 15697 7U99 36384036 EGFR kinase in complex with a macrocyclic inhibitor 2022-03-10 2022-11-23 Amrhein, J.A.,Beyett, T.S.,Feng, W.W.,Kramer, A.,Weckesser, J.,Schaeffner, I.K.,Rana, J.K.,Janne, P.A.,Eck, M.J.,Knapp, S.,Hanke, T. Macrocyclization of Quinazoline-Based EGFR Inhibitors Leads to Exclusive Mutant Selectivity for EGFR L858R and Del19. J.Med.Chem. 2022 65 15679 15697 7U9A 36384036 EGFR in complex with a macrocyclic inhibitor 2022-03-10 2022-11-23 Amrhein, J.A.,Beyett, T.S.,Feng, W.W.,Kramer, A.,Weckesser, J.,Schaeffner, I.K.,Rana, J.K.,Janne, P.A.,Eck, M.J.,Knapp, S.,Hanke, T. Macrocyclization of Quinazoline-Based EGFR Inhibitors Leads to Exclusive Mutant Selectivity for EGFR L858R and Del19. J.Med.Chem. 2022 65 15679 15697 7UKV 36518696 Wild type EGFR in complex with Lazertinib (YH25448) 2022-04-02 2022-11-23 Heppner, D.E.,Wittlinger, F.,Beyett, T.S.,Shaurova, T.,Urul, D.A.,Buckley, B.,Pham, C.D.,Schaeffner, I.K.,Yang, B.,Ogboo, B.C.,May, E.W.,Schaefer, E.M.,Eck, M.J.,Laufer, S.A.,Hershberger, P.A. Structural Basis for Inhibition of Mutant EGFR with Lazertinib (YH25448). Acs Med.Chem.Lett. 2022 13 1856 1863 8E1I 36468882 Asp1 kinase in complex with ATP Mg 5-IP7 2022-08-10 2022-11-30 Benjamin, B.,Goldgur, Y.,Jork, N.,Jessen, H.J.,Schwer, B.,Shuman, S. Structures of Fission Yeast Inositol Pyrophosphate Kinase Asp1 in Ligand-Free, Substrate-Bound, and Product-Bound States. Mbio 2022 13 0 0 8E1J 36468882 Asp1 kinase in complex with 1,5-IP8 2022-08-10 2022-11-30 Benjamin, B.,Goldgur, Y.,Jork, N.,Jessen, H.J.,Schwer, B.,Shuman, S. Structures of Fission Yeast Inositol Pyrophosphate Kinase Asp1 in Ligand-Free, Substrate-Bound, and Product-Bound States. Mbio 2022 13 0 0 8EUO 40864147 Hydroxynitrile Lyase from Hevea brasiliensis with Seven Mutations 2022-10-19 2022-11-30 Pierce, C.T.,Greenberg, L.R.,Walsh, M.E.,Shi, K.,Magee, D.J.,Aihara, H.,Gordon, W.,Evans 3rd, R.L.,Kazlauskas, R.J. Crystal structure of a seven-substitution mutant of hydroxynitrile lyase from rubber tree. Acta Crystallogr.,Sect.F 2025 81 398 405 8EXL 36455032 Crystal structure of PI3K-alpha in complex with taselisib 2022-10-25 2022-11-30 Hanan, E.J.,Braun, M.G.,Heald, R.A.,MacLeod, C.,Chan, C.,Clausen, S.,Edgar, K.A.,Eigenbrot, C.,Elliott, R.,Endres, N.,Friedman, L.S.,Gogol, E.,Gu, X.H.,Thibodeau, R.H.,Jackson, P.S.,Kiefer, J.R.,Knight, J.D.,Nannini, M.,Narukulla, R.,Pace, A.,Pang, J.,Purkey, H.E.,Salphati, L.,Sampath, D.,Schmidt, S.,Sideris, S.,Song, K.,Sujatha-Bhaskar, S.,Ultsch, M.,Wallweber, H.,Xin, J.,Yeap, S.,Young, A.,Zhong, Y.,Staben, S.T. Discovery of GDC-0077 (Inavolisib), a Highly Selective Inhibitor and Degrader of Mutant PI3K alpha. J.Med.Chem. 2022 65 16589 16621 7U20 36599985 Crystal structure of human METTL1 and WDR4 complex 2022-02-22 2022-12-07 Li, J.,Wang, L.,Hahn, Q.,Nowak, R.P.,Viennet, T.,Orellana, E.A.,Roy Burman, S.S.,Yue, H.,Hunkeler, M.,Fontana, P.,Wu, H.,Arthanari, H.,Fischer, E.S.,Gregory, R.I. Structural basis of regulated m 7 G tRNA modification by METTL1-WDR4. Nature 2023 613 391 397 7U4I 36423641 Crystal structure of human GPX4-U46C-R152H in complex with CDS9 2022-02-28 2022-12-07 Liu, H.,Forouhar, F.,Lin, A.J.,Wang, Q.,Polychronidou, V.,Soni, R.K.,Xia, X.,Stockwell, B.R. Small-molecule allosteric inhibitors of GPX4. Cell Chem Biol 2022 29 1680 0 7U4J 36423641 Crystal structure of human GPX4-U46C-R152H in complex with TMT10 2022-02-28 2022-12-07 Liu, H.,Forouhar, F.,Lin, A.J.,Wang, Q.,Polychronidou, V.,Soni, R.K.,Xia, X.,Stockwell, B.R. Small-molecule allosteric inhibitors of GPX4. Cell Chem Biol 2022 29 1680 0 7U4K 36423641 Crystal structure of human GPX4-U46C-R152H in complex with ML162 2022-02-28 2022-12-07 Liu, H.,Forouhar, F.,Lin, A.J.,Wang, Q.,Polychronidou, V.,Soni, R.K.,Xia, X.,Stockwell, B.R. Small-molecule allosteric inhibitors of GPX4. Cell Chem Biol 2022 29 1680 0 7U4L 36423641 Crystal structure of human GPX4-U46C in complex with MAC-5576 2022-02-28 2022-12-07 Liu, H.,Forouhar, F.,Lin, A.J.,Wang, Q.,Polychronidou, V.,Soni, R.K.,Xia, X.,Stockwell, B.R. Small-molecule allosteric inhibitors of GPX4. Cell Chem Biol 2022 29 1680 0 7U4M 36423641 Crystal structure of human GPX4-U46C in complex with LOC1886 2022-02-28 2022-12-07 Liu, H.,Forouhar, F.,Lin, A.J.,Wang, Q.,Polychronidou, V.,Soni, R.K.,Xia, X.,Stockwell, B.R. Small-molecule allosteric inhibitors of GPX4. Cell Chem Biol 2022 29 1680 0 8DHY 36435815 N-terminal fragment of MsbA fused to GFP in complex with copper(II) 2022-06-28 2022-12-07 Lyu, J.,Liu, C.,Zhang, T.,Schrecke, S.,Elam, N.P.,Packianathan, C.,Hochberg, G.K.A.,Russell, D.,Zhao, M.,Laganowsky, A. Structural basis for lipid and copper regulation of the ABC transporter MsbA. Nat Commun 2022 13 7291 7291 8DW9 36354024 Crystal structure of neutralizing antibody D29 Fab in complex with SARS-CoV-2 spike receptor binding domain (RBD) 2022-08-01 2022-12-07 Luo, M.,Zhou, B.,Reddem, E.R.,Tang, B.,Chen, B.,Zhou, R.,Liu, H.,Liu, L.,Katsamba, P.S.,Au, K.K.,Man, H.O.,To, K.K.,Yuen, K.Y.,Shapiro, L.,Dang, S.,Ho, D.D.,Chen, Z. Structural insights into broadly neutralizing antibodies elicited by hybrid immunity against SARS-CoV-2. Emerg Microbes Infect 2023 12 2146538 2146538 8DWA 36354024 Crystal structure of neutralizing antibody P1D9 Fab in complex with SARS-CoV-2 spike receptor binding domain (RBD) 2022-08-01 2022-12-07 Luo, M.,Zhou, B.,Reddem, E.R.,Tang, B.,Chen, B.,Zhou, R.,Liu, H.,Liu, L.,Katsamba, P.S.,Au, K.K.,Man, H.O.,To, K.K.,Yuen, K.Y.,Shapiro, L.,Dang, S.,Ho, D.D.,Chen, Z. Structural insights into broadly neutralizing antibodies elicited by hybrid immunity against SARS-CoV-2. Emerg Microbes Infect 2023 12 2146538 2146538 7SZ8 Crystal structure of human CELSR1 EC4-7 2021-11-26 2022-12-14 Tamilselvan, E.,Sotomayor, M. Crystal structure of human CELSR1 EC4-7 to be published 0 0 0 0 7SZD Crystal Structure Analysis of human PRPK complex with a compound 2021-11-27 2022-12-14 Seo, H.-S.,Mizutani, T.,Hideshima, T.,Vangos, N.E.,Zhang, T.,Anderson, K.C.,Gray, N.S.,Dhe-Paganon, S. Development of PRPK Directed Phthalimides Biorxiv 2021 0 0 0 8DKO 36448708 Minimal PutA proline dehydrogenase domain (design #1) complexed with S-(-)-tetrahydro-2-furoic acid 2022-07-05 2022-12-14 Bogner, A.N.,Ji, J.,Tanner, J.J. Structure-based engineering of minimal proline dehydrogenase domains for inhibitor discovery. Protein Eng.Des.Sel. 2022 35 0 0 8GXL 36459648 HUMAN SUGP1 433-577 2022-09-20 2022-12-14 Zhang, J.,Huang, J.,Xu, K.,Xing, P.,Huang, Y.,Liu, Z.,Tong, L.,Manley, J.L. DHX15 is involved in SUGP1-mediated RNA missplicing by mutant SF3B1 in cancer. Proc.Natl.Acad.Sci.USA 2022 119 0 0 7T80 Crystal Structure of Mouse Cadherin-23 EC18-19 2021-12-15 2022-12-21 Harrison-Rawn, T.,Sotomayor, M. Crystal Structure of Mouse Cadherin-23 EC18-19 to be published 0 0 0 0 8EKB 36546783 Crystal structure of the Thermus thermophilus 70S ribosome in complex with mRNA, deacylated P-site tRNAmet, and thermorubin at 2.70A resolution 2022-09-20 2022-12-21 Paranjpe, M.N.,Marina, V.I.,Grachev, A.A.,Maviza, T.P.,Tolicheva, O.A.,Paleskava, A.,Osterman, I.A.,Sergiev, P.V.,Konevega, A.L.,Polikanov, Y.S.,Gagnon, M.G. Insights into the molecular mechanism of translation inhibition by the ribosome-targeting antibiotic thermorubin. Nucleic Acids Res. 2023 51 449 462 8GWR 36259273 Near full length Kidney type Glutaminase in complex with 2,2-Dimethyl-2,3-Dihydrobenzo[a] Phenanthridin-4(1H)-one (DDP) 2022-09-17 2022-12-21 Shankar, S.,Ramachandran, S.,Tulsian, N.,Radhakrishnan, S.,Jobichen, C.,Sivaraman, J. A novel allosteric site employs a conserved inhibition mechanism in human kidney-type glutaminase. Febs J. 2023 290 2437 2448 8EBO 36508994 Homopurine parallel G-quadruplex from human chromosome 7 stabilized by K+ ions 2022-08-31 2022-12-28 Ye, M.,Chen, E.V.,Pfeil, S.H.,Martin, K.N.,Atrafi, T.,Yun, S.,Martinez, Z.,Yatsunyk, L.A. Homopurine guanine-rich sequences in complex with N-methyl mesoporphyrin IX form parallel G-quadruplex dimers and display a unique symmetry tetrad. Bioorg.Med.Chem. 2022 77 117112 117112 8EDP 36508994 Crystal structure of a three-tetrad, parallel, and K+ stabilized homopurine G-quadruplex from human chromosome 7 2022-09-05 2022-12-28 Ye, M.,Chen, E.V.,Pfeil, S.H.,Martin, K.N.,Atrafi, T.,Yun, S.,Martinez, Z.,Yatsunyk, L.A. Homopurine guanine-rich sequences in complex with N-methyl mesoporphyrin IX form parallel G-quadruplex dimers and display a unique symmetry tetrad. Bioorg.Med.Chem. 2022 77 117112 117112 7TSX 36755092 Structure of Enterobacter cloacae Cap2 bound to CdnD02 C-terminus, Apo state 2022-01-31 2023-01-11 Ledvina, H.E.,Ye, Q.,Gu, Y.,Sullivan, A.E.,Quan, Y.,Lau, R.K.,Zhou, H.,Corbett, K.D.,Whiteley, A.T. An E1-E2 fusion protein primes antiviral immune signalling in bacteria. Nature 2023 616 319 325 7U59 35608330 Crystal Structure of Danio rerio Histone Deacetylase 10 in Complex with Piperidine-4-hydroxamic acid Inhibitor 2022-03-01 2023-01-11 Herp, D.,Ridinger, J.,Robaa, D.,Shinsky, S.A.,Schmidtkunz, K.,Yesiloglu, T.Z.,Bayer, T.,Steimbach, R.R.,Herbst-Gervasoni, C.J.,Merz, A.,Romier, C.,Sehr, P.,Gunkel, N.,Miller, A.K.,Christianson, D.W.,Oehme, I.,Sippl, W.,Jung, M. First Fluorescent Acetylspermidine Deacetylation Assay for HDAC10 Identifies Selective Inhibitors with Cellular Target Engagement. Chembiochem 2022 23 0 0 8CZF 36706751 Human BAK in complex with the dF2 peptide 2022-05-24 2023-01-11 Aguilar, F.,Yu, S.,Grant, R.A.,Swanson, S.,Ghose, D.,Su, B.G.,Sarosiek, K.A.,Keating, A.E. Peptides from human BNIP5 and PXT1 and non-native binders of pro-apoptotic BAK can directly activate or inhibit BAK-mediated membrane permeabilization. Structure 2023 31 265 0 8CZG 36706751 Human BAK in complex with the dF3 peptide 2022-05-24 2023-01-11 Aguilar, F.,Yu, S.,Grant, R.A.,Swanson, S.,Ghose, D.,Su, B.G.,Sarosiek, K.A.,Keating, A.E. Peptides from human BNIP5 and PXT1 and non-native binders of pro-apoptotic BAK can directly activate or inhibit BAK-mediated membrane permeabilization. Structure 2023 31 265 0 8CZH 36706751 Human BAK in complex with the dM2 peptide 2022-05-24 2023-01-11 Aguilar, F.,Yu, S.,Grant, R.A.,Swanson, S.,Ghose, D.,Su, B.G.,Sarosiek, K.A.,Keating, A.E. Peptides from human BNIP5 and PXT1 and non-native binders of pro-apoptotic BAK can directly activate or inhibit BAK-mediated membrane permeabilization. Structure 2023 31 265 0 8DQO 36737607 Crystal structure of Arabidopsis thaliana COSY 2022-07-19 2023-01-11 Kim, C.Y.,Mitchell, A.J.,Kastner, D.W.,Albright, C.E.,Gutierrez, M.A.,Glinkerman, C.M.,Kulik, H.J.,Weng, J.K. Emergence of a proton exchange-based isomerization and lactonization mechanism in the plant coumarin synthase COSY. Nat Commun 2023 14 597 597 8DQP 36737607 Crystal structure of Arabidopsis thaliana COSY in complex with scopoletin 2022-07-19 2023-01-11 Kim, C.Y.,Mitchell, A.J.,Kastner, D.W.,Albright, C.E.,Gutierrez, M.A.,Glinkerman, C.M.,Kulik, H.J.,Weng, J.K. Emergence of a proton exchange-based isomerization and lactonization mechanism in the plant coumarin synthase COSY. Nat Commun 2023 14 597 597 8DQQ 36737607 Crystal structure of Arabidopsis thaliana COSY in complex with scopoletin 2022-07-19 2023-01-11 Kim, C.Y.,Mitchell, A.J.,Kastner, D.W.,Albright, C.E.,Gutierrez, M.A.,Glinkerman, C.M.,Kulik, H.J.,Weng, J.K. Emergence of a proton exchange-based isomerization and lactonization mechanism in the plant coumarin synthase COSY. Nat Commun 2023 14 597 597 7TJO HIV-1 gp120 complex with CJF-II-197-S 2022-01-16 2023-01-25 Chaplain, C.,Fritschi, C.J.,Anang, S.,Gong, Z.,Richard, J.,Bourassa, C.,Liang, S.,Mohammadi, M.,Park, J.,Finzi, A.,Madani, N.,Sodroski, J.G.,Abrams, C.F.,Hendrickson, W.A.,Smith, A.B. Structural and Functional Characterization of Indane-Core CD4-Mimetic Compounds Substituted with Heterocyclic Amines ACS Medicinal Chemistry Letter 2023 14 51 58 8DOV 36693107 Crystal structure of the Shr Hemoglobin Interacting Domain 2 (HID2) in complex with Hemoglobin 2022-07-14 2023-01-25 Macdonald, R.,Mahoney, B.J.,Soule, J.,Goring, A.K.,Ford, J.,Loo, J.A.,Cascio, D.,Clubb, R.T. The Shr receptor from Streptococcus pyogenes uses a cap and release mechanism to acquire heme-iron from human hemoglobin. Proc.Natl.Acad.Sci.USA 2023 120 0 0 7TTK Stable-5-LOX 2022-02-01 2023-02-15 Gilbert, N.C. Stable-5-LOX ""closed"" To Be Published 0 0 0 0 7TUN Crystal structure analysis of human CKB complex with a covalent compound 2022-02-03 2023-02-15 Seo, H.-S.,Dhe-Paganon, S. Crystal Structure Analysis of human CKB complex with a covalent compound To Be Published 0 0 0 0 7TUO Crystal structure analysis of human USP28 complex with a compound 2022-02-03 2023-02-15 Seo, H.-S.,Dhe-Paganon, S. Crystal Structure Analysis of human USP28 complex with a compound To Be Published 0 0 0 0 7TVJ 36806475 Crystal Structure of Monobody Mb(SHP2PTP_13)/SHP2 PTP Domain Complex 2022-02-05 2023-02-15 Sha, F.,Kurosawa, K.,Glasser, E.,Ketavarapu, G.,Albazzaz, S.,Koide, A.,Koide, S. Monobody Inhibitor Selective to the Phosphatase Domain of SHP2 and its Use as a Probe for Quantifying SHP2 Allosteric Regulation. J.Mol.Biol. 2023 435 168010 168010 7U0V Structure of myxoma virus M062 protein variant Lau 2022-02-19 2023-02-22 O'Byrne, P.,Khan, A.R. Structure of myxoma virus M062 protein variant MAV To Be Published 0 0 0 0 7U0W Structure of myxoma virus M062 protein variant MAV 2022-02-19 2023-02-22 O'Byrne, P.,Khan, A.R. Structure of myxoma virus M062 protein variant MAV To Be Published 0 0 0 0 8EBN 36805027 Structure of KLHDC2-EloB/C tetrameric assembly 2022-08-31 2023-02-22 Scott, D.C.,King, M.T.,Baek, K.,Gee, C.T.,Kalathur, R.,Li, J.,Purser, N.,Nourse, A.,Chai, S.C.,Vaithiyalingam, S.,Chen, T.,Lee, R.E.,Elledge, S.J.,Kleiger, G.,Schulman, B.A. E3 ligase autoinhibition by C-degron mimicry maintains C-degron substrate fidelity. Mol.Cell 2023 83 770 0 8F8E Crystal structure of the WDR domain of human DCAF1 in complex with OICR-8268 compound 2022-11-21 2023-03-01 Kimani, S.,Li, A.,Dong, A.,Li, Y.,Hutchinson, A.,Seitova, A.,Wilson, B.,Al-Awar, R.,Vedadi, M.,Brown, P.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L. Crystal structure of the WDR domain of human DCAF1 in complex with OICR-8268 compound To be published 0 0 0 0 8EIN 36800389 Crystal structure of WT cyanophycin dipeptide hydrolase CphZ from Acinetobacter baylyi DSM587 2022-09-15 2023-03-08 Sharon, I.,McKay, G.A.,Nguyen, D.,Schmeing, T.M. Discovery of cyanophycin dipeptide hydrolase enzymes suggests widespread utility of the natural biopolymer cyanophycin. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8F3K 36736884 Anti-CRISPR protein AcrIIC5 inhibits CRISPR-Cas9 by acting as a DNA mimic 2022-11-10 2023-03-08 Hwang, S.,Shah, M.,Garcia, B.,Hashem, N.,Davidson, A.R.,Moraes, T.F.,Maxwell, K.L. Anti-CRISPR Protein AcrIIC5 Inhibits CRISPR-Cas9 by Occupying the Target DNA Binding Pocket. J.Mol.Biol. 2023 435 167991 167991 8GBE 36909515 Structure of a viral gasdermin protein A47 from Eptesipox virus 2023-02-25 2023-03-15 Boys, I.N.,Johnson, A.G.,Quinlan, M.,Kranzusch, P.J.,Elde, N.C. Structural homology screens reveal poxvirus-encoded proteins impacting inflammasome-mediated defenses. Biorxiv 2023 0 0 0 7UR7 36897987 17_bp_sh3, a small beta-barrel de novo designed protein 2022-04-21 2023-03-22 Kim, D.E.,Jensen, D.R.,Feldman, D.,Tischer, D.,Saleem, A.,Chow, C.M.,Li, X.,Carter, L.,Milles, L.,Nguyen, H.,Kang, A.,Bera, A.K.,Peterson, F.C.,Volkman, B.F.,Ovchinnikov, S.,Baker, D. De novo design of small beta barrel proteins. Proc.Natl.Acad.Sci.USA 2023 120 0 0 7UR8 36897987 170_h_ob, a small beta-barrel de novo designed protein 2022-04-21 2023-03-22 Kim, D.E.,Jensen, D.R.,Feldman, D.,Tischer, D.,Saleem, A.,Chow, C.M.,Li, X.,Carter, L.,Milles, L.,Nguyen, H.,Kang, A.,Bera, A.K.,Peterson, F.C.,Volkman, B.F.,Ovchinnikov, S.,Baker, D. De novo design of small beta barrel proteins. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8DWZ 36764524 CA domain of VanSA histidine kinase, 7 keV data 2022-08-02 2023-03-22 Grasty, K.C.,Guzik, C.,D'Lauro, E.J.,Padrick, S.B.,Beld, J.,Loll, P.J. Structure of VanS from vancomycin-resistant enterococci: A sensor kinase with weak ATP binding. J.Biol.Chem. 2023 299 103001 103001 8E51 36911992 Crystal Structure of Iridescent Shark Catfish Cadherin-23 EC1-2 and Protocadherin-15 EC1-2 2022-08-19 2023-03-22 Nisler, C.R.,Narui, Y.,Scheib, E.,Choudhary, D.,Bowman, J.D.,Mandayam Bharathi, H.,Lynch, V.J.,Sotomayor, M. Interpreting the Evolutionary Echoes of a Protein Complex Essential for Inner-Ear Mechanosensation. Mol.Biol.Evol. 2023 40 0 0 8F23 37035699 The crystal structure of a rationally designed zinc sensor based on maltose binding protein - Apo conformation 2022-11-06 2023-03-22 Zhao, Z.,Zhou, M.,Zemerov, S.D.,Marmorstein, R.,Dmochowski, I.J. Rational design of a genetically encoded NMR zinc sensor. Chem Sci 2023 14 3809 3815 8FBI 36888664 Improving the secretion of designed protein assemblies through negative design of cryptic transmembrane domains 2022-11-29 2023-03-22 Wang, J.Y.J.,Khmelinskaia, A.,Sheffler, W.,Miranda, M.C.,Antanasijevic, A.,Borst, A.J.,Torres, S.V.,Shu, C.,Hsia, Y.,Nattermann, U.,Ellis, D.,Walkey, C.,Ahlrichs, M.,Chan, S.,Kang, A.,Nguyen, H.,Sydeman, C.,Sankaran, B.,Wu, M.,Bera, A.K.,Carter, L.,Fiala, B.,Murphy, M.,Baker, D.,Ward, A.B.,King, N.P. Improving the secretion of designed protein assemblies through negative design of cryptic transmembrane domains. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8FBJ 36888664 Improving the secretion of designed protein assemblies through negative design of cryptic transmembrane domains 2022-11-29 2023-03-22 Wang, J.Y.J.,Khmelinskaia, A.,Sheffler, W.,Miranda, M.C.,Antanasijevic, A.,Borst, A.J.,Torres, S.V.,Shu, C.,Hsia, Y.,Nattermann, U.,Ellis, D.,Walkey, C.,Ahlrichs, M.,Chan, S.,Kang, A.,Nguyen, H.,Sydeman, C.,Sankaran, B.,Wu, M.,Bera, A.K.,Carter, L.,Fiala, B.,Murphy, M.,Baker, D.,Ward, A.B.,King, N.P. Improving the secretion of designed protein assemblies through negative design of cryptic transmembrane domains. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8CXR 36539416 Crystal structure of MraY bound to a sphaerimicin analogue 2022-05-22 2023-03-29 Nakaya, T.,Yabe, M.,Mashalidis, E.H.,Sato, T.,Yamamoto, K.,Hikiji, Y.,Katsuyama, A.,Shinohara, M.,Minato, Y.,Takahashi, S.,Horiuchi, M.,Yokota, S.I.,Lee, S.Y.,Ichikawa, S. Synthesis of macrocyclic nucleoside antibacterials and their interactions with MraY. Nat Commun 2022 13 7575 7575 8FOM 36924943 Crystal structure of tRNA^Lys(SUU) bound to UAA codon in the ribosomal P site 2023-01-02 2023-03-29 Nguyen, H.A.,Hoffer, E.D.,Fagan, C.E.,Maehigashi, T.,Dunham, C.M. Structural basis for reduced ribosomal A-site fidelity in response to P-site codon-anticodon mismatches. J.Biol.Chem. 2023 299 104608 104608 8FON 36924943 Crystal structure of tRNA^Lys(SUU) bound to AUA codon in the ribosomal P site 2023-01-02 2023-03-29 Nguyen, H.A.,Hoffer, E.D.,Fagan, C.E.,Maehigashi, T.,Dunham, C.M. Structural basis for reduced ribosomal A-site fidelity in response to P-site codon-anticodon mismatches. J.Biol.Chem. 2023 299 104608 104608 8G0P 36883282 Crystal structure of the human Ndc80:Nuf2 loop region 2023-02-01 2023-03-29 Zahm, J.A.,Jenni, S.,Harrison, S.C. Structure of the Ndc80 complex and its interactions at the yeast kinetochore-microtubule interface. Open Biology 2023 13 220378 220378 8FLY 36961924 HIV-1 gp120 complex with BNM-III-170 2022-12-22 2023-04-05 Fritschi, C.J.,Anang, S.,Gong, Z.,Mohammadi, M.,Richard, J.,Bourassa, C.,Severino, K.T.,Richter, H.,Yang, D.,Chen, H.C.,Chiu, T.J.,Seaman, M.S.,Madani, N.,Abrams, C.,Finzi, A.,Hendrickson, W.A.,Sodroski, J.G.,Smith III, A.B. Indoline CD4-mimetic compounds mediate potent and broad HIV-1 inhibition and sensitization to antibody-dependent cellular cytotoxicity. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8FM0 36961924 HIV-1 gp120 complex with CJF-III-214 2022-12-22 2023-04-05 Fritschi, C.J.,Anang, S.,Gong, Z.,Mohammadi, M.,Richard, J.,Bourassa, C.,Severino, K.T.,Richter, H.,Yang, D.,Chen, H.C.,Chiu, T.J.,Seaman, M.S.,Madani, N.,Abrams, C.,Finzi, A.,Hendrickson, W.A.,Sodroski, J.G.,Smith III, A.B. Indoline CD4-mimetic compounds mediate potent and broad HIV-1 inhibition and sensitization to antibody-dependent cellular cytotoxicity. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8FM4 36961924 HIV-1 gp120 complex with CJF-IV-047 2022-12-22 2023-04-05 Fritschi, C.J.,Anang, S.,Gong, Z.,Mohammadi, M.,Richard, J.,Bourassa, C.,Severino, K.T.,Richter, H.,Yang, D.,Chen, H.C.,Chiu, T.J.,Seaman, M.S.,Madani, N.,Abrams, C.,Finzi, A.,Hendrickson, W.A.,Sodroski, J.G.,Smith III, A.B. Indoline CD4-mimetic compounds mediate potent and broad HIV-1 inhibition and sensitization to antibody-dependent cellular cytotoxicity. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8FM7 36961924 HIV-1 gp120 complex with CJF-III-192 2022-12-22 2023-04-05 Fritschi, C.J.,Anang, S.,Gong, Z.,Mohammadi, M.,Richard, J.,Bourassa, C.,Severino, K.T.,Richter, H.,Yang, D.,Chen, H.C.,Chiu, T.J.,Seaman, M.S.,Madani, N.,Abrams, C.,Finzi, A.,Hendrickson, W.A.,Sodroski, J.G.,Smith III, A.B. Indoline CD4-mimetic compounds mediate potent and broad HIV-1 inhibition and sensitization to antibody-dependent cellular cytotoxicity. Proc.Natl.Acad.Sci.USA 2023 120 0 0 7SS6 37014664 Structure of Klebsiella LpxH in complex with JH-LPH-45 2021-11-09 2023-04-12 Kwak, S.H.,Skyler Cochrane, C.,Cho, J.,Dome, P.A.,Ennis, A.F.,Kim, J.H.,Zhou, P.,Hong, J. Development of LpxH Inhibitors Chelating the Active Site Dimanganese Metal Cluster of LpxH. Chemmedchem 2023 18 0 0 7SS7 37014664 Crystal structure of Klebsiella LpxH in complex with JH-LPH-50 2021-11-09 2023-04-12 Kwak, S.H.,Skyler Cochrane, C.,Cho, J.,Dome, P.A.,Ennis, A.F.,Kim, J.H.,Zhou, P.,Hong, J. Development of LpxH Inhibitors Chelating the Active Site Dimanganese Metal Cluster of LpxH. Chemmedchem 2023 18 0 0 8F7O 36963492 BRAF kinase in complex with TAK580 (tovorafenib) 2022-11-20 2023-04-12 Tkacik, E.,Li, K.,Gonzalez-Del Pino, G.,Ha, B.H.,Vinals, J.,Park, E.,Beyett, T.S.,Eck, M.J. Structure and RAF family kinase isoform selectivity of type II RAF inhibitors tovorafenib and naporafenib. J.Biol.Chem. 2023 299 104634 104634 8FGY 36995121 Crystal structure of mutant Androgen Receptor ligand binding domain L702H/H875Y/F877L/T878A with DHT 2022-12-13 2023-04-12 Doamekpor, S.K.,Peng, P.,Xu, R.,Ma, L.,Tong, Y.,Tong, L. A partially open conformation of an androgen receptor ligand-binding domain with drug-resistance mutations. Acta Crystallogr.,Sect.F 2023 79 95 104 8FH0 36995121 Crystal structure of mutant Androgen Receptor ligand binding domain H875Y/F877L/T878A with DHT 2022-12-13 2023-04-12 Doamekpor, S.K.,Peng, P.,Xu, R.,Ma, L.,Tong, Y.,Tong, L. A partially open conformation of an androgen receptor ligand-binding domain with drug-resistance mutations. Acta Crystallogr.,Sect.F 2023 79 95 104 8FH1 36995121 Crystal structure of mutant Androgen Receptor ligand binding domain F877L/T878A with DHT 2022-12-13 2023-04-12 Doamekpor, S.K.,Peng, P.,Xu, R.,Ma, L.,Tong, Y.,Tong, L. A partially open conformation of an androgen receptor ligand-binding domain with drug-resistance mutations. Acta Crystallogr.,Sect.F 2023 79 95 104 8FH2 36995121 Crystal structure of mutant Androgen Receptor ligand binding domain L702H/H875Y with DHT 2022-12-13 2023-04-12 Doamekpor, S.K.,Peng, P.,Xu, R.,Ma, L.,Tong, Y.,Tong, L. A partially open conformation of an androgen receptor ligand-binding domain with drug-resistance mutations. Acta Crystallogr.,Sect.F 2023 79 95 104 8DP3 37029118 Crystal structure of coxsackievirus B3 cloverleaf RNA replication element 2022-07-14 2023-04-19 Das, N.K.,Hollmann, N.M.,Vogt, J.,Sevdalis, S.E.,Banna, H.A.,Ojha, M.,Koirala, D. Crystal structure of a highly conserved enteroviral 5' cloverleaf RNA replication element. Nat Commun 2023 14 1955 1955 8EQ5 37149146 Crystal structure of the N-terminal kinase domain of RSK2 in complex with SPRED2 (131-160) 2022-10-07 2023-04-26 Lopez, J.,Bonsor, D.A.,Sale, M.J.,Urisman, A.,Mehalko, J.L.,Cabanski-Dunning, M.,Castel, P.,Simanshu, D.K.,McCormick, F. The ribosomal S6 kinase 2 (RSK2)-SPRED2 complex regulates the phosphorylation of RSK substrates and MAPK signaling. J.Biol.Chem. 2023 299 104789 104789 7UQU Crystal Structure of Mouse Cadherin-23 EC9 2022-04-20 2023-05-03 Sandhu, J.S.,De La Torre, P.,Sotomayor, M. Crystal Structure of Mouse Cadherin-23 EC9 To be published 0 0 0 0 8E5S 37039477 X-ray structure of the Deinococcus radiodurans Nramp/MntH divalent transition metal transporter WT in an occluded state 2022-08-22 2023-05-03 Ray, S.,Berry, S.P.,Wilson, E.A.,Zhang, C.H.,Shekhar, M.,Singharoy, A.,Gaudet, R. High-resolution structures with bound Mn 2+ and Cd 2+ map the metal import pathway in an Nramp transporter. Elife 2023 12 0 0 8E6H 37039477 X-ray structure of the Deinococcus radiodurans Nramp/MntH divalent transition metal transporter A47W mutant in an occluded, manganese-bound state 2022-08-22 2023-05-03 Ray, S.,Berry, S.P.,Wilson, E.A.,Zhang, C.H.,Shekhar, M.,Singharoy, A.,Gaudet, R. High-resolution structures with bound Mn 2+ and Cd 2+ map the metal import pathway in an Nramp transporter. Elife 2023 12 0 0 8E6M 37039477 X-ray structure of the Deinococcus radiodurans Nramp/MntH divalent transition metal transporter WT in an inward-open, cadmium-bound state 2022-08-22 2023-05-03 Ray, S.,Berry, S.P.,Wilson, E.A.,Zhang, C.H.,Shekhar, M.,Singharoy, A.,Gaudet, R. High-resolution structures with bound Mn 2+ and Cd 2+ map the metal import pathway in an Nramp transporter. Elife 2023 12 0 0 8E6N 37039477 X-ray structure of the Deinococcus radiodurans Nramp/MntH divalent transition metal transporter G223W mutant in an outward-open, manganese-bound state 2022-08-22 2023-05-03 Ray, S.,Berry, S.P.,Wilson, E.A.,Zhang, C.H.,Shekhar, M.,Singharoy, A.,Gaudet, R. High-resolution structures with bound Mn 2+ and Cd 2+ map the metal import pathway in an Nramp transporter. Elife 2023 12 0 0 7SPQ 40047534 Crystal structure of Burkholderia glumae toxoflavin biosynthesis protein ToxD 2021-11-03 2023-05-10 Justen, S.F.,Fenwick, M.K.,Axt, K.K.,Cherry, J.A.,Ealick, S.E.,Philmus, B. Crystal Structure, Modeling, and Identification of Key Residues Provide Insights into the Mechanism of the Key Toxoflavin Biosynthesis Protein ToxD. Biochemistry 2025 64 1199 1211 7UYX 37667030 Structure of bacteriophage PA1c gp2 2022-05-07 2023-05-10 Enustun, E.,Deep, A.,Gu, Y.,Nguyen, K.T.,Chaikeeratisak, V.,Armbruster, E.,Ghassemian, M.,Villa, E.,Pogliano, J.,Corbett, K.D. Identification of the bacteriophage nucleus protein interaction network. Nat.Struct.Mol.Biol. 2023 30 1653 1662 8CXF 36995904 Crystal structure of an i-motif from the HRAS promoter region 2022-05-20 2023-05-10 Li, K.S.,Jordan, D.,Lin, L.Y.,McCarthy, S.E.,Schneekloth Jr., J.S.,Yatsunyk, L.A. Crystal Structure of an i-Motif from the HRAS Oncogene Promoter. Angew.Chem.Int.Ed.Engl. 2023 62 0 0 8DHC 36995904 Crystal structure of an i-motif from the HRAS promoter region 2022-06-27 2023-05-10 Li, K.S.,Jordan, D.,Lin, L.Y.,McCarthy, S.E.,Schneekloth Jr., J.S.,Yatsunyk, L.A. Crystal Structure of an i-Motif from the HRAS Oncogene Promoter. Angew.Chem.Int.Ed.Engl. 2023 62 0 0 8FHV 37344591 Structure of Lettuce aptamer bound to DFHBI-1T with thallium I ions 2022-12-15 2023-05-10 Passalacqua, L.F.M.,Banco, M.T.,Moon, J.D.,Li, X.,Jaffrey, S.R.,Ferre-D'Amare, A.R. Intricate 3D architecture of a DNA mimic of GFP. Nature 2023 618 1078 1084 8FI1 37344591 Structure of Lettuce C20G bound to DFHO 2022-12-15 2023-05-10 Passalacqua, L.F.M.,Banco, M.T.,Moon, J.D.,Li, X.,Jaffrey, S.R.,Ferre-D'Amare, A.R. Intricate 3D architecture of a DNA mimic of GFP. Nature 2023 618 1078 1084 8FI2 37344591 Structure of Lettuce C20T bound to DFHBI-1T 2022-12-15 2023-05-10 Passalacqua, L.F.M.,Banco, M.T.,Moon, J.D.,Li, X.,Jaffrey, S.R.,Ferre-D'Amare, A.R. Intricate 3D architecture of a DNA mimic of GFP. Nature 2023 618 1078 1084 8FI7 37344591 Structure of Lettuce C20T bound to DFHO 2022-12-15 2023-05-10 Passalacqua, L.F.M.,Banco, M.T.,Moon, J.D.,Li, X.,Jaffrey, S.R.,Ferre-D'Amare, A.R. Intricate 3D architecture of a DNA mimic of GFP. Nature 2023 618 1078 1084 8FI8 37344591 Structure of Lettuce C20T bound to DFAME 2022-12-15 2023-05-10 Passalacqua, L.F.M.,Banco, M.T.,Moon, J.D.,Li, X.,Jaffrey, S.R.,Ferre-D'Amare, A.R. Intricate 3D architecture of a DNA mimic of GFP. Nature 2023 618 1078 1084 8G2F 38045046 Crystal Structure of PRMT3 with Compound II710 2023-02-03 2023-05-10 Deng, Y.,Song, X.,Iyamu, I.D.,Dong, A.,Min, J.,Huang, R. A unique binding pocket induced by a noncanonical SAH mimic to develop potent and selective PRMT inhibitors. Acta Pharm Sin B 2023 13 4893 4905 8CUC Crystal structure analysis of SALL4 zinc finger domain in complex with DNA 2022-05-17 2023-05-24 Seo, H.S.,Dhe-Paganon, S. Crystal Structure Analysis of SALL4 Zinc Finger domain in complex with DNA To Be Published 0 0 0 0 8E5D 37460895 Crystal structure of double-stranded DNA deaminase toxin DddA in complex with DNA with the target cytosine parked in the major groove 2022-08-21 2023-05-24 Yin, L.,Shi, K.,Aihara, H. Structural basis of sequence-specific cytosine deamination by double-stranded DNA deaminase toxin DddA. Nat.Struct.Mol.Biol. 2023 30 1153 1159 8E5E 37460895 Crystal structure of double-stranded DNA deaminase toxin DddA in complex with DNA with the target cytosine flipped into the active site 2022-08-21 2023-05-24 Yin, L.,Shi, K.,Aihara, H. Structural basis of sequence-specific cytosine deamination by double-stranded DNA deaminase toxin DddA. Nat.Struct.Mol.Biol. 2023 30 1153 1159 8FSI 37156396 The structure of a crystallizable variant of E. coli pyruvate formate-lyase activating enzyme bound to SAM 2023-01-10 2023-05-24 Moody, J.D.,Hill, S.,Lundahl, M.N.,Saxton, A.J.,Galambas, A.,Broderick, W.E.,Lawrence, C.M.,Broderick, J.B. Computational engineering of previously crystallized pyruvate formate-lyase activating enzyme reveals insights into SAM binding and reductive cleavage. J.Biol.Chem. 2023 299 104791 104791 8DU5 37205763 Murine sialidase-1 (NEU1) 2022-07-26 2023-05-31 Gorelik, A.,Illes, K.,Mazhab-Jafari, M.T.,Nagar, B. Structure of the immunoregulatory sialidase NEU1. Sci Adv 2023 9 0 0 8EYV 37221204 Structure of Beetroot dimer bound to DFHO 2022-10-28 2023-05-31 Passalacqua, L.F.M.,Starich, M.R.,Link, K.A.,Wu, J.,Knutson, J.R.,Tjandra, N.,Jaffrey, S.R.,Ferre-D'Amare, A.R. Co-crystal structures of the fluorogenic aptamer Beetroot show that close homology may not predict similar RNA architecture. Nat Commun 2023 14 2969 2969 8G1N 37096962 Structure of Campylobacter concisus PglC I57M/Q175M Variant with modeled C-terminus 2023-02-02 2023-05-31 Anderson, A.J.,Dodge, G.J.,Allen, K.N.,Imperiali, B. Co-conserved sequence motifs are predictive of substrate specificity in a family of monotopic phosphoglycosyl transferases. Protein Sci. 2023 32 0 0 8SRZ 37398489 Structure of a bacterial death-like domain from Lysobacter enzymogenes 2023-05-08 2023-06-07 Wein, T.,Johnson, A.G.,Millman, A.,Lange, K.,Yirmiya, E.,Hadary, R.,Garb, J.,Steinruecke, F.,Hill, A.B.,Kranzusch, P.J.,Sorek, R. CARD-like domains mediate anti-phage defense in bacterial gasdermin systems. Biorxiv 2023 0 0 0 8SS1 37398489 Structure of a bacterial death-like domain from Azospirillum sp. 2023-05-08 2023-06-07 Wein, T.,Johnson, A.G.,Millman, A.,Lange, K.,Yirmiya, E.,Hadary, R.,Garb, J.,Steinruecke, F.,Hill, A.B.,Kranzusch, P.J.,Sorek, R. CARD-like domains mediate anti-phage defense in bacterial gasdermin systems. Biorxiv 2023 0 0 0 8CTU Crystal structure of a K+ selective NaK mutant (NaK2K) at Room temperature 2022-05-16 2023-06-14 Lee, B.,White, K.I.,Socolich, M.A.,Klureza, M.A.,Henning, R.,Srajer, V.,Ranganathan, R.,Hekstra, D. Direct visualization of electric field-stimulated ion conduction in a potassium channel To Be Published 0 0 0 0 8CTV Crystal structure of a K+ selective NaK mutant (NaK2K) -Tl+ complex 2022-05-16 2023-06-14 Lee, B.,White, K.I.,Socolich, M.A.,Klureza, M.A.,Henning, R.,Srajer, V.,Ranganathan, R.,Hekstra, D. Direct visualization of electric field-stimulated ion conduction in a potassium channel To Be Published 0 0 0 0 8FZB 37209825 Crystal structure of human FAM86A 2023-01-28 2023-06-21 Francis, J.W.,Shao, Z.,Narkhede, P.,Trinh, A.T.,Lu, J.,Song, J.,Gozani, O. The FAM86 domain of FAM86A confers substrate specificity to promote EEF2-Lys525 methylation. J.Biol.Chem. 2023 299 104842 104842 8FHL Structure of pyruvate dehydrogenase phosphatase regulatory subunit neoepitope presented by H2-Dd 2022-12-14 2023-06-28 Custodio, J.M.F.,Baker, B.M. Structure of Pyruvate dehydrogenase phosphatase regulatory subunit neoepitope presented by H2-Dd To Be Published 0 0 0 0 8FHU Structure of Pyruvate dehydrogenase phosphatase regulatory subunit epitope presented by H2-Dd 2022-12-15 2023-06-28 Custodio, J.M.F.,Baker, B.M. Structure of Pyruvate dehydrogenase phosphatase regulatory subunit neoepitope presented by H2-Dd To Be Published 0 0 0 0 7N46 34453889 ADP-binding state of the nucleotide-binding domain of Hsp70 DnaK 2021-06-03 2023-07-05 Wang, W.,Liu, Q.,Liu, Q.,Hendrickson, W.A. Conformational equilibria in allosteric control of Hsp70 chaperones. Mol.Cell 2021 81 3919 0 7RAX 34453889 ATP-binding state of the nucleotide-binding domain of Hsp70 DnaK mutant T199A 2021-07-04 2023-07-05 Wang, W.,Liu, Q.,Liu, Q.,Hendrickson, W.A. Conformational equilibria in allosteric control of Hsp70 chaperones. Mol.Cell 2021 81 3919 0 7T8P 40147775 CRYSTAL STRUCTURE OF T151V CAO1 2021-12-16 2023-07-05 DeWeese, D.E.,Everett, M.P.,Babicz Jr., J.T.,Daruwalla, A.,Solomon, E.I.,Kiser, P.D. Spectroscopy and crystallography define carotenoid oxygenases as a new subclass of mononuclear non-heme Fe II enzymes. J.Biol.Chem. 2025 0 108444 108444 8D78 Crystal structure of a Ba stabilized four-tetrad, parallel Tetrahymena thermophila telomeric G-quadruplex in complex with N-methyl mesoporphyrin IX 2022-06-07 2023-07-05 Beseiso, D.,Chen, E.V.,Yatsunyk, L.A. Biophysical and structural characterization of telomeric G-quadruplexes from Tetrahymena thermophila in complex with N-Methyl Mesoporphyrin IX To Be Published 0 0 0 0 8D79 Crystal structure of a four-tetrad, parallel, and Na+ stabilized Tetrahymena thermophila telomeric G-quadruplex in complex with N-methyl mesoporphyrin IX 2022-06-07 2023-07-05 Beseiso, D.,Chen, E.V.,Yatsunyk, L.A. Biophysical and structural characterization of telomeric G-quadruplexes from Tetrahymena thermophila in complex with N-Methyl Mesoporphyrin IX To Be Published 0 0 0 0 8EFM 37379839 Structure of coral STING receptor from Stylophora pistillata in complex with 2',3'-cGAMP 2022-09-08 2023-07-05 Li, Y.,Slavik, K.M.,Toyoda, H.C.,Morehouse, B.R.,de Oliveira Mann, C.C.,Elek, A.,Levy, S.,Wang, Z.,Mears, K.S.,Liu, J.,Kashin, D.,Guo, X.,Mass, T.,Sebe-Pedros, A.,Schwede, F.,Kranzusch, P.J. cGLRs are a diverse family of pattern recognition receptors in innate immunity. Cell 2023 186 3261 0 8EFN 37379839 Structure of Sp-STING3 from Stylophora pistillata coral in complex with 3',3'-cGAMP 2022-09-08 2023-07-05 Li, Y.,Slavik, K.M.,Toyoda, H.C.,Morehouse, B.R.,de Oliveira Mann, C.C.,Elek, A.,Levy, S.,Wang, Z.,Mears, K.S.,Liu, J.,Kashin, D.,Guo, X.,Mass, T.,Sebe-Pedros, A.,Schwede, F.,Kranzusch, P.J. cGLRs are a diverse family of pattern recognition receptors in innate immunity. Cell 2023 186 3261 0 8GJW 37379839 Structure of a cGAS-like receptor Cv-cGLR1 from C. virginica 2023-03-16 2023-07-05 Li, Y.,Slavik, K.M.,Toyoda, H.C.,Morehouse, B.R.,de Oliveira Mann, C.C.,Elek, A.,Levy, S.,Wang, Z.,Mears, K.S.,Liu, J.,Kashin, D.,Guo, X.,Mass, T.,Sebe-Pedros, A.,Schwede, F.,Kranzusch, P.J. cGLRs are a diverse family of pattern recognition receptors in innate immunity. Cell 2023 186 3261 0 8GJZ 37379839 Structure of a STING receptor from S. pistillata Sp-STING1 bound to 2'3'-cUA 2023-03-16 2023-07-05 Li, Y.,Slavik, K.M.,Toyoda, H.C.,Morehouse, B.R.,de Oliveira Mann, C.C.,Elek, A.,Levy, S.,Wang, Z.,Mears, K.S.,Liu, J.,Kashin, D.,Guo, X.,Mass, T.,Sebe-Pedros, A.,Schwede, F.,Kranzusch, P.J. cGLRs are a diverse family of pattern recognition receptors in innate immunity. Cell 2023 186 3261 0 8EK4 37364125 De novo designed ice-binding proteins from twist-constrained helices 2022-09-19 2023-07-12 de Haas, R.J.,Tas, R.P.,van den Broek, D.,Zheng, C.,Nguyen, H.,Kang, A.,Bera, A.K.,King, N.P.,Voets, I.K.,de Vries, R. De novo designed ice-binding proteins from twist-constrained helices. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8FC1 37452045 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, hygromycin A, and erythromycin at 2.50A resolution 2022-12-01 2023-07-12 Chen, C.W.,Leimer, N.,Syroegin, E.A.,Dunand, C.,Bulman, Z.P.,Lewis, K.,Polikanov, Y.S.,Svetlov, M.S. Structural insights into the mechanism of overcoming Erm-mediated resistance by macrolides acting together with hygromycin-A. Nat Commun 2023 14 4196 4196 8FC2 37452045 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, hygromycin A, and azithromycin at 2.50A resolution 2022-12-01 2023-07-12 Chen, C.W.,Leimer, N.,Syroegin, E.A.,Dunand, C.,Bulman, Z.P.,Lewis, K.,Polikanov, Y.S.,Svetlov, M.S. Structural insights into the mechanism of overcoming Erm-mediated resistance by macrolides acting together with hygromycin-A. Nat Commun 2023 14 4196 4196 8FC3 37452045 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, hygromycin A, and telithromycin at 2.60A resolution 2022-12-01 2023-07-12 Chen, C.W.,Leimer, N.,Syroegin, E.A.,Dunand, C.,Bulman, Z.P.,Lewis, K.,Polikanov, Y.S.,Svetlov, M.S. Structural insights into the mechanism of overcoming Erm-mediated resistance by macrolides acting together with hygromycin-A. Nat Commun 2023 14 4196 4196 7UQA 37438348 Crystal structure of the small Ultra-Red Fluorescent Protein (smURFP) 2022-04-19 2023-07-19 Maiti, A.,Buffalo, C.Z.,Saurabh, S.,Montecinos-Franjola, F.,Hachey, J.S.,Conlon, W.J.,Tran, G.N.,Hassan, B.,Walters, K.J.,Drobizhev, M.,Moerner, W.E.,Ghosh, P.,Matsuo, H.,Tsien, R.Y.,Lin, J.Y.,Rodriguez, E.A. Structural and photophysical characterization of the small ultra-red fluorescent protein. Nat Commun 2023 14 4155 4155 8GAJ 37416832 Crystal Structure of E. coli LptA in complex with Podisus maculiventris Thanatin 2023-02-23 2023-07-19 Huynh, K.,Kibrom, A.,Donald, B.R.,Zhou, P. Discovery, characterization, and redesign of potent antimicrobial thanatin orthologs from Chinavia ubica and Murgantia histrionica targeting E. coli LptA. J Struct Biol X 2023 8 100091 100091 8T8B 37433044 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, A-site aminoacyl-tRNA analog ACC-PMN, and P-site formyl-MAI-tripeptidyl-tRNA analog ACCA-IAMf at 2.65A resolution 2023-06-22 2023-07-19 Thaler, J.,Syroegin, E.A.,Breuker, K.,Polikanov, Y.S.,Micura, R. Practical Synthesis of N -Formylmethionylated Peptidyl-tRNA Mimics. Acs Chem.Biol. 2023 18 2233 2239 8T8C 37433044 Crystal structure of the Thermus thermophilus 70S ribosome in complex with protein Y, A-site aminoacyl-tRNA analog ACC-PMN, and P-site formyl-MFI-tripeptidyl-tRNA analog ACCA-IFMf at 2.60A resolution 2023-06-22 2023-07-19 Thaler, J.,Syroegin, E.A.,Breuker, K.,Polikanov, Y.S.,Micura, R. Practical Synthesis of N -Formylmethionylated Peptidyl-tRNA Mimics. Acs Chem.Biol. 2023 18 2233 2239 8FC4 37452045 Crystal structure of the A2058-N6-dimethylated Thermus thermophilus 70S ribosome in complex with protein Y, hygromycin A, and erythromycin at 2.45A resolution 2022-12-01 2023-07-26 Chen, C.W.,Leimer, N.,Syroegin, E.A.,Dunand, C.,Bulman, Z.P.,Lewis, K.,Polikanov, Y.S.,Svetlov, M.S. Structural insights into the mechanism of overcoming Erm-mediated resistance by macrolides acting together with hygromycin-A. Nat Commun 2023 14 4196 4196 8FC5 37452045 Crystal structure of the A2058-N6-dimethylated Thermus thermophilus 70S ribosome in complex with protein Y, hygromycin A, and azithromycin at 2.65A resolution 2022-12-01 2023-07-26 Chen, C.W.,Leimer, N.,Syroegin, E.A.,Dunand, C.,Bulman, Z.P.,Lewis, K.,Polikanov, Y.S.,Svetlov, M.S. Structural insights into the mechanism of overcoming Erm-mediated resistance by macrolides acting together with hygromycin-A. Nat Commun 2023 14 4196 4196 8FC6 37452045 Crystal structure of the A2058-N6-dimethylated Thermus thermophilus 70S ribosome in complex with protein Y, hygromycin A, and telithromycin at 2.35A resolution 2022-12-01 2023-07-26 Chen, C.W.,Leimer, N.,Syroegin, E.A.,Dunand, C.,Bulman, Z.P.,Lewis, K.,Polikanov, Y.S.,Svetlov, M.S. Structural insights into the mechanism of overcoming Erm-mediated resistance by macrolides acting together with hygromycin-A. Nat Commun 2023 14 4196 4196 8SU3 37449555 F95S epi-Isozizaene Synthase: complex with 3 Mg2+, inorganic pyrophosphate, and benzyl triethyl ammonium cation 2023-05-11 2023-07-26 Eaton, S.A.,Christianson, D.W. Reprogramming the Cyclization Cascade of epi -Isozizaene Synthase to Generate Alternative Terpene Products. Biochemistry 2023 62 2301 2313 8SU4 37449555 F198S epi-Isozizaene Synthase: complex with 3 Mg2+, inorganic pyrophosphate, and benzyl triethyl ammonium cation 2023-05-11 2023-07-26 Eaton, S.A.,Christianson, D.W. Reprogramming the Cyclization Cascade of epi -Isozizaene Synthase to Generate Alternative Terpene Products. Biochemistry 2023 62 2301 2313 8TBX Crystal structure of human DDX1 helicase in complex with ADP 2023-06-29 2023-07-26 Zeng, H.,Dong, A.,Li, Y.,Yen, H.,Hejazi, Z.,Seitova, A.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L. Crystal structure of human DDX1 helicase in complex with ADP To be published 0 0 0 0 7TRH 38127922 Human antibody K03.28 in complex with the influenza hemagglutinin head domain of A/California/07/2009(H1N1)(X-181) 2022-01-28 2023-08-02 Simmons, H.C.,Watanabe, A.,Oguin Iii, T.H.,Van Itallie, E.S.,Wiehe, K.J.,Sempowski, G.D.,Kuraoka, M.,Kelsoe, G.,McCarthy, K.R. A new class of antibodies that overcomes a steric barrier to cross-group neutralization of influenza viruses. Plos Biol. 2023 21 0 0 7TRI 38127922 Human antibody S8V1-172 in complex with the influenza hemagglutinin head domain of A/Sydney/05/1997(H3N2) 2022-01-28 2023-08-02 Simmons, H.C.,Watanabe, A.,Oguin Iii, T.H.,Van Itallie, E.S.,Wiehe, K.J.,Sempowski, G.D.,Kuraoka, M.,Kelsoe, G.,McCarthy, K.R. A new class of antibodies that overcomes a steric barrier to cross-group neutralization of influenza viruses. Plos Biol. 2023 21 0 0 8SPH 37578233 Crystal structure of chimeric omicron RBD (strain XBB.1) complexed with human ACE2 2023-05-03 2023-08-02 Zhang, W.,Shi, K.,Geng, Q.,Herbst, M.,Wang, M.,Huang, L.,Bu, F.,Liu, B.,Aihara, H.,Li, F. Structural evolution of SARS-CoV-2 omicron in human receptor recognition. J.Virol. 2023 97 0 0 8EV6 37537169 Crystal structure of the Thermus thermophilus 70S ribosome in complex with amikacin, mRNA, and A-, P-, and E-site tRNAs 2022-10-19 2023-08-09 Seely, S.M.,Parajuli, N.P.,De Tarafder, A.,Ge, X.,Sanyal, S.,Gagnon, M.G. Molecular basis of the pleiotropic effects by the antibiotic amikacin on the ribosome. Nat Commun 2023 14 4666 4666 8EV7 37537169 Crystal structure of the Thermus thermophilus 70S ribosome in complex with kanamycin, mRNA, and A-, P-, and E-site tRNAs 2022-10-19 2023-08-09 Seely, S.M.,Parajuli, N.P.,De Tarafder, A.,Ge, X.,Sanyal, S.,Gagnon, M.G. Molecular basis of the pleiotropic effects by the antibiotic amikacin on the ribosome. Nat Commun 2023 14 4666 4666 8T5I Crystal structure of human WDR5 in complex with MR4397 2023-06-13 2023-08-09 Kimani, S.,Dong, A.,Li, F.,Loppnau, P.,Ackloo, S.,Vedadi, M.,Brown, P.J.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Crystal structure of human WDR5 in complex with MR4397 To be published 0 0 0 0 8E1E 36627259 Scaffolding protein functional sites using deep learning 2022-08-10 2023-08-16 Gerben, S.R.,Borst, A.J.,Hicks, D.R.,Moczygemba, I.,Feldman, D.,Coventry, B.,Yang, W.,Bera, A.K.,Miranda, M.,Kang, A.,Nguyen, H.,Baker, D. Design of Diverse Asymmetric Pockets in De Novo Homo-oligomeric Proteins. Biochemistry 2023 62 358 368 8EOX 37667012 Precisely patterned nanofibers made from extendable protein multiplexes 2022-10-04 2023-08-16 Bethel, N.P.,Borst, A.J.,Parmeggiani, F.,Bick, M.J.,Brunette, T.J.,Nguyen, H.,Kang, A.,Bera, A.K.,Carter, L.,Miranda, M.C.,Kibler, R.D.,Lamb, M.,Li, X.,Sankaran, B.,Baker, D. Precisely patterned nanofibres made from extendable protein multiplexes. Nat.Chem. 2023 15 1664 1671 8EOZ 37667012 Precisely patterned nanofibers made from extendable protein multiplexes 2022-10-04 2023-08-16 Bethel, N.P.,Borst, A.J.,Parmeggiani, F.,Bick, M.J.,Brunette, T.J.,Nguyen, H.,Kang, A.,Bera, A.K.,Carter, L.,Miranda, M.C.,Kibler, R.D.,Lamb, M.,Li, X.,Sankaran, B.,Baker, D. Precisely patterned nanofibres made from extendable protein multiplexes. Nat.Chem. 2023 15 1664 1671 8TFS Crystal structure of the Rhodanese-like domain of Vretifemale_1082 from Volvox reticuliferus 2023-07-11 2023-08-16 Arbing, M.A.,Jonikas, M.,Yeates, T.O. Crystal structure of the Rhodanese-like domain of Vretifemale_1082 from Volvox reticuliferus To Be Published 0 0 0 0 8GH4 36917886 Complex of Adam 10 disentegrin cysteine rich domains with human monoclonal antibody 2023-03-09 2023-08-30 Saha, N.,Baek, D.S.,Mendoza, R.P.,Robev, D.,Xu, Y.,Goldgur, Y.,De La Cruz, M.J.,de Stanchina, E.,Janes, P.W.,Xu, K.,Dimitrov, D.S.,Nikolov, D.B. Fully human monoclonal antibody targeting activated ADAM10 on colorectal cancer cells. Biomed Pharmacother 2023 161 114494 114494 8EFX 37877948 Structure of OtDUB DUB Domain disulfide crosslinked with Ubiquitin 2022-09-09 2023-09-20 Negron Teron, K.I.,Das, C. Cocrystallization of ubiquitin-deubiquitinase complexes through disulfide linkage. Acta Crystallogr D Struct Biol 2023 79 1044 1055 8EJP 37744032 Crystal structure of the homeodomain of Platypus sDUX in complex with DNA containing 5-Bromouracil 2022-09-18 2023-09-20 Bosnakovski, D.,Toso, E.A.,Ener, E.T.,Gearhart, M.D.,Yin, L.,Luttmann, F.F.,Magli, A.,Shi, K.,Kim, J.,Aihara, H.,Kyba, M. Antagonism among DUX family members evolved from an ancestral toxic single homeodomain protein. Iscience 2023 26 107823 107823 8T9N 37756332 Bacillus subtilis RsgI GGG mutant 2023-06-24 2023-09-20 Brogan, A.P.,Habib, C.,Hobbs, S.J.,Kranzusch, P.J.,Rudner, D.Z. Bacterial SEAL domains undergo autoproteolysis and function in regulated intramembrane proteolysis. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8FJE 37770718 The five-repeat design E8 2022-12-19 2023-09-27 An, L.,Hicks, D.R.,Zorine, D.,Dauparas, J.,Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Bera, A.K.,Nguyen, H.,Kang, A.,Carter, L.,Baker, D. Hallucination of closed repeat proteins containing central pockets. Nat.Struct.Mol.Biol. 2023 30 1755 1760 8FJF 37770718 The three-repeat design H10 2022-12-19 2023-09-27 An, L.,Hicks, D.R.,Zorine, D.,Dauparas, J.,Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Bera, A.K.,Nguyen, H.,Kang, A.,Carter, L.,Baker, D. Hallucination of closed repeat proteins containing central pockets. Nat.Struct.Mol.Biol. 2023 30 1755 1760 8FJG 37770718 The two-repeat design H12 2022-12-19 2023-09-27 An, L.,Hicks, D.R.,Zorine, D.,Dauparas, J.,Wicky, B.I.M.,Milles, L.F.,Courbet, A.,Bera, A.K.,Nguyen, H.,Kang, A.,Carter, L.,Baker, D. Hallucination of closed repeat proteins containing central pockets. Nat.Struct.Mol.Biol. 2023 30 1755 1760 8SMU 37729854 Integral fusion of the HtaA CR2 domain from Corynebacterium diphtheriae within EGFP 2023-04-26 2023-09-27 Mahoney, B.J.,Goring, A.K.,Wang, Y.,Dasika, P.,Zhou, A.,Grossbard, E.,Cascio, D.,Loo, J.A.,Clubb, R.T. Development and atomic structure of a new fluorescence-based sensor to probe heme transfer in bacterial pathogens. J.Inorg.Biochem. 2023 249 112368 112368 8FQ7 37801475 Nanobody with WIW inserted in CDR3 loop to Inhibit Growth of Alzheimer's Tau fibrils 2023-01-05 2023-10-04 Abskharon, R.,Pan, H.,Sawaya, M.R.,Seidler, P.M.,Olivares, E.J.,Chen, Y.,Murray, K.A.,Zhang, J.,Lantz, C.,Bentzel, M.,Boyer, D.R.,Cascio, D.,Nguyen, B.A.,Hou, K.,Cheng, X.,Pardon, E.,Williams, C.K.,Nana, A.L.,Vinters, H.V.,Spina, S.,Grinberg, L.T.,Seeley, W.W.,Steyaert, J.,Glabe, C.G.,Ogorzalek Loo, R.R.,Loo, J.A.,Eisenberg, D.S. Structure-based design of nanobodies that inhibit seeding of Alzheimer's patient-extracted tau fibrils. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8GD2 37713257 Crystal structure of human cellular retinol binding protein 1 in complex with N-methyl-1-{3-[1-(4-methylphenyl)cyclopentyl]-1,2,4-oxadiazol-5-yl}-N-(2-thienylmethyl)methanamine 2023-03-03 2023-10-04 Plau, J.,Morgan, C.E.,Fedorov, Y.,Banerjee, S.,Adams, D.J.,Blaner, W.S.,Yu, E.W.,Golczak, M. Discovery of Nonretinoid Inhibitors of CRBP1: Structural and Dynamic Insights for Ligand-Binding Mechanisms. Acs Chem.Biol. 2023 18 2309 2323 8GEM 37713257 Crystal structure of human cellular retinol binding protein 1 in complex with N-ethyl-N-({3-[1-(4-methylphenyl)cyclopentyl]-1,2,4-oxadiazol-5-yl}methyl)-2-(1H-pyrazol-1-yl)ethanamine 2023-03-07 2023-10-04 Plau, J.,Morgan, C.E.,Fedorov, Y.,Banerjee, S.,Adams, D.J.,Blaner, W.S.,Yu, E.W.,Golczak, M. Discovery of Nonretinoid Inhibitors of CRBP1: Structural and Dynamic Insights for Ligand-Binding Mechanisms. Acs Chem.Biol. 2023 18 2309 2323 8GEV 37713257 Crystal structure of human cellular retinol binding protein 1 in complex with 1-{[3-(diphenylmethyl)-1,2,4-oxadiazol-5-yl]methyl}-4-(methoxymethyl)piperidine 2023-03-07 2023-10-04 Plau, J.,Morgan, C.E.,Fedorov, Y.,Banerjee, S.,Adams, D.J.,Blaner, W.S.,Yu, E.W.,Golczak, M. Discovery of Nonretinoid Inhibitors of CRBP1: Structural and Dynamic Insights for Ligand-Binding Mechanisms. Acs Chem.Biol. 2023 18 2309 2323 8GEY 37713257 Crystal structure of human cellular retinol binding protein 1 in complex with 4-(hydroxymethyl)-1-[(4-methoxy-5,6,7,8-tetrahydronaphthalen-1-yl)sulfonyl]piperidin-4-ol 2023-03-07 2023-10-04 Plau, J.,Morgan, C.E.,Fedorov, Y.,Banerjee, S.,Adams, D.J.,Blaner, W.S.,Yu, E.W.,Golczak, M. Discovery of Nonretinoid Inhibitors of CRBP1: Structural and Dynamic Insights for Ligand-Binding Mechanisms. Acs Chem.Biol. 2023 18 2309 2323 8DSK 37811683 Structure of the N358Y variant of serine hydroxymethyltransferase 8 in complex with PLP, glycine, and formyl tetrahydrofolate 2022-07-22 2023-10-18 Korasick, D.A.,Owuocha, L.F.,Kandoth, P.K.,Tanner, J.J.,Mitchum, M.G.,Beamer, L.J. Structural and functional analysis of two SHMT8 variants associated with soybean cyst nematode resistance. Febs J. 2024 291 323 337 8ET0 Crystal Complex of murine Cyclooxygenase-2 with alpaca nanobody F9 2022-10-15 2023-10-18 Xu, S.,Uddin, M.J. Crystal complex of murine cycloxygenase-2 with alpaca nanobody F9 To Be Published 0 0 0 0 8TKL 37759710 Murine NF-kappaB p50 Rel Homology Region homodimer in complex with a Test 16-mer kappaB-like DNA 2023-07-25 2023-10-18 Zhu, N.,Mealka, M.,Mitchel, S.,Milani, C.,Acuna, L.M.,Rogers, E.,Lahana, A.N.,Huxford, T. X-ray Crystallographic Study of Preferred Spacing by the NF-kappa B p50 Homodimer on kappa B DNA. Biomolecules 2023 13 0 0 8ERJ 38308582 Crystal structure of Fub7 in complex with E-2-aminocrotonate 2022-10-12 2023-10-25 Liu, S.,Yeh, C.,Reavill, C.,Jones, B.,Zou, Y.,Hai, Y. Molecular and Structural Basis for C gamma-C Bond Formation by PLP-Dependent Enzyme Fub7. Angew.Chem.Int.Ed.Engl. 2024 63 0 0 8CUS 37845322 Accurate computational design of genetically encoded 3D protein crystals 2022-05-17 2023-11-01 Li, Z.,Wang, S.,Nattermann, U.,Bera, A.K.,Borst, A.J.,Yaman, M.Y.,Bick, M.J.,Yang, E.C.,Sheffler, W.,Lee, B.,Seifert, S.,Hura, G.L.,Nguyen, H.,Kang, A.,Dalal, R.,Lubner, J.M.,Hsia, Y.,Haddox, H.,Courbet, A.,Dowling, Q.,Miranda, M.,Favor, A.,Etemadi, A.,Edman, N.I.,Yang, W.,Weidle, C.,Sankaran, B.,Negahdari, B.,Ross, M.B.,Ginger, D.S.,Baker, D. Accurate computational design of three-dimensional protein crystals. Nat Mater 2023 22 1556 1563 8CUT 37845322 Accurate computational design of genetically encoded 3D protein crystals 2022-05-17 2023-11-01 Li, Z.,Wang, S.,Nattermann, U.,Bera, A.K.,Borst, A.J.,Yaman, M.Y.,Bick, M.J.,Yang, E.C.,Sheffler, W.,Lee, B.,Seifert, S.,Hura, G.L.,Nguyen, H.,Kang, A.,Dalal, R.,Lubner, J.M.,Hsia, Y.,Haddox, H.,Courbet, A.,Dowling, Q.,Miranda, M.,Favor, A.,Etemadi, A.,Edman, N.I.,Yang, W.,Weidle, C.,Sankaran, B.,Negahdari, B.,Ross, M.B.,Ginger, D.S.,Baker, D. Accurate computational design of three-dimensional protein crystals. Nat Mater 2023 22 1556 1563 8CUU 37845322 Accurate computational design of genetically encoded 3D protein crystals 2022-05-17 2023-11-01 Li, Z.,Wang, S.,Nattermann, U.,Bera, A.K.,Borst, A.J.,Yaman, M.Y.,Bick, M.J.,Yang, E.C.,Sheffler, W.,Lee, B.,Seifert, S.,Hura, G.L.,Nguyen, H.,Kang, A.,Dalal, R.,Lubner, J.M.,Hsia, Y.,Haddox, H.,Courbet, A.,Dowling, Q.,Miranda, M.,Favor, A.,Etemadi, A.,Edman, N.I.,Yang, W.,Weidle, C.,Sankaran, B.,Negahdari, B.,Ross, M.B.,Ginger, D.S.,Baker, D. Accurate computational design of three-dimensional protein crystals. Nat Mater 2023 22 1556 1563 8CUV 37845322 Accurate computational design of genetically encoded 3D protein crystals 2022-05-17 2023-11-01 Li, Z.,Wang, S.,Nattermann, U.,Bera, A.K.,Borst, A.J.,Yaman, M.Y.,Bick, M.J.,Yang, E.C.,Sheffler, W.,Lee, B.,Seifert, S.,Hura, G.L.,Nguyen, H.,Kang, A.,Dalal, R.,Lubner, J.M.,Hsia, Y.,Haddox, H.,Courbet, A.,Dowling, Q.,Miranda, M.,Favor, A.,Etemadi, A.,Edman, N.I.,Yang, W.,Weidle, C.,Sankaran, B.,Negahdari, B.,Ross, M.B.,Ginger, D.S.,Baker, D. Accurate computational design of three-dimensional protein crystals. Nat Mater 2023 22 1556 1563 8CUW 37845322 Accurate computational design of genetically encoded 3D protein crystals 2022-05-17 2023-11-01 Li, Z.,Wang, S.,Nattermann, U.,Bera, A.K.,Borst, A.J.,Yaman, M.Y.,Bick, M.J.,Yang, E.C.,Sheffler, W.,Lee, B.,Seifert, S.,Hura, G.L.,Nguyen, H.,Kang, A.,Dalal, R.,Lubner, J.M.,Hsia, Y.,Haddox, H.,Courbet, A.,Dowling, Q.,Miranda, M.,Favor, A.,Etemadi, A.,Edman, N.I.,Yang, W.,Weidle, C.,Sankaran, B.,Negahdari, B.,Ross, M.B.,Ginger, D.S.,Baker, D. Accurate computational design of three-dimensional protein crystals. Nat Mater 2023 22 1556 1563 8CWZ 37845322 Accurate computational design of genetically encoded 3D protein crystals 2022-05-19 2023-11-01 Li, Z.,Wang, S.,Nattermann, U.,Bera, A.K.,Borst, A.J.,Yaman, M.Y.,Bick, M.J.,Yang, E.C.,Sheffler, W.,Lee, B.,Seifert, S.,Hura, G.L.,Nguyen, H.,Kang, A.,Dalal, R.,Lubner, J.M.,Hsia, Y.,Haddox, H.,Courbet, A.,Dowling, Q.,Miranda, M.,Favor, A.,Etemadi, A.,Edman, N.I.,Yang, W.,Weidle, C.,Sankaran, B.,Negahdari, B.,Ross, M.B.,Ginger, D.S.,Baker, D. Accurate computational design of three-dimensional protein crystals. Nat Mater 2023 22 1556 1563 8FAR 37845322 Accurate computational design of genetically encoded 3D protein crystals 2022-11-28 2023-11-01 Li, Z.,Wang, S.,Nattermann, U.,Bera, A.K.,Borst, A.J.,Yaman, M.Y.,Bick, M.J.,Yang, E.C.,Sheffler, W.,Lee, B.,Seifert, S.,Hura, G.L.,Nguyen, H.,Kang, A.,Dalal, R.,Lubner, J.M.,Hsia, Y.,Haddox, H.,Courbet, A.,Dowling, Q.,Miranda, M.,Favor, A.,Etemadi, A.,Edman, N.I.,Yang, W.,Weidle, C.,Sankaran, B.,Negahdari, B.,Ross, M.B.,Ginger, D.S.,Baker, D. Accurate computational design of three-dimensional protein crystals. Nat Mater 2023 22 1556 1563 8F1W 39471218 EGFR(T790M/V948R) kinase in complex with poziotinib 2022-11-06 2023-11-08 Zhao, H.,Beyett, T.S.,Jiang, J.,Rana, J.K.,Schaeffner, I.K.,Santana, J.,Janne, P.A.,Eck, M.J. Biochemical analysis of EGFR exon20 insertion variants insASV and insSVD and their inhibitor sensitivity. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8F1Y 39471218 EGFR kinase in complex with poziotinib 2022-11-06 2023-11-08 Zhao, H.,Beyett, T.S.,Jiang, J.,Rana, J.K.,Schaeffner, I.K.,Santana, J.,Janne, P.A.,Eck, M.J. Biochemical analysis of EGFR exon20 insertion variants insASV and insSVD and their inhibitor sensitivity. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8SBM 37905955 Crystal structure of the wild-type Catalytic ATP-binding domain of Mtb DosS 2023-04-03 2023-11-08 Larson, G.W.,Windsor, P.K.,Smithwick, E.,Shi, K.,Aihara, H.,Rama Damodaran, A.,Bhagi-Damodaran, A. Understanding ATP Binding to DosS Catalytic Domain with a Short ATP-Lid. Biochemistry 2023 62 3283 3292 8TFZ 37883434 tRNA 2'-phosphotransferase (Tpt1) from Pyrococcus horikoshii in complex with NAD 2023-07-12 2023-11-08 Jacewicz, A.,Dantuluri, S.,Shuman, S. Structural basis for Tpt1-catalyzed 2'-PO 4 transfer from RNA and NADP(H) to NAD. Proc.Natl.Acad.Sci.USA 2023 120 0 0 8U6A 37883896 Crystal Structure of HIV-1 Reverse Transcriptase in Complex with (JLJ729), a non-nucleoside inhibitor 2023-09-13 2023-11-08 Prucha, G.R.,Henry, S.,Hollander, K.,Carter, Z.J.,Spasov, K.A.,Jorgensen, W.L.,Anderson, K.S. Covalent and noncovalent strategies for targeting Lys102 in HIV-1 reverse transcriptase. Eur.J.Med.Chem. 2023 262 115894 115894 8SM3 37992757 Structure of Bacillus cereus VD045 Gabija GajA-GajB Complex 2023-04-25 2023-11-22 Antine, S.P.,Johnson, A.G.,Mooney, S.E.,Leavitt, A.,Mayer, M.L.,Yirmiya, E.,Amitai, G.,Sorek, R.,Kranzusch, P.J. Structural basis of Gabija anti-phage defence and viral immune evasion. Nature 2024 625 360 365 8SMD 37992756 Structure of Clostridium botulinum prophage Tad1 in complex with 1''-3' gcADPR 2023-04-26 2023-11-22 Yirmiya, E.,Leavitt, A.,Lu, A.,Ragucci, A.E.,Avraham, C.,Osterman, I.,Garb, J.,Antine, S.P.,Mooney, S.E.,Hobbs, S.J.,Kranzusch, P.J.,Amitai, G.,Sorek, R. Phages overcome bacterial immunity via diverse anti-defence proteins. Nature 2024 625 352 359 8SME 37992756 Structure of SPO1 phage Tad2 in apo state 2023-04-26 2023-11-22 Yirmiya, E.,Leavitt, A.,Lu, A.,Ragucci, A.E.,Avraham, C.,Osterman, I.,Garb, J.,Antine, S.P.,Mooney, S.E.,Hobbs, S.J.,Kranzusch, P.J.,Amitai, G.,Sorek, R. Phages overcome bacterial immunity via diverse anti-defence proteins. Nature 2024 625 352 359 8SMF 37992756 Structure of SPO1 phage Tad2 in complex with 1''-3' gcADPR 2023-04-26 2023-11-22 Yirmiya, E.,Leavitt, A.,Lu, A.,Ragucci, A.E.,Avraham, C.,Osterman, I.,Garb, J.,Antine, S.P.,Mooney, S.E.,Hobbs, S.J.,Kranzusch, P.J.,Amitai, G.,Sorek, R. Phages overcome bacterial immunity via diverse anti-defence proteins. Nature 2024 625 352 359 8SMG 37992756 Structure of SPO1 phage Tad2 in complex with 1''-2' gcADPR 2023-04-26 2023-11-22 Yirmiya, E.,Leavitt, A.,Lu, A.,Ragucci, A.E.,Avraham, C.,Osterman, I.,Garb, J.,Antine, S.P.,Mooney, S.E.,Hobbs, S.J.,Kranzusch, P.J.,Amitai, G.,Sorek, R. Phages overcome bacterial immunity via diverse anti-defence proteins. Nature 2024 625 352 359 8OQH 41314214 Structure of the cytosolic domain of lysosome-associated TMEM55B 2023-04-12 2023-11-29 Waschbusch, D.,Pal, P.,Nirujogi, R.S.,Cavin, M.,Singh, J.,Alessi, D.R.,Khan, A.R. Structural basis for binding of RILPL1 to TMEM55B reveals a lysosomal platform for adaptor assembly through a conserved peptide motif. Structure 2026 34 296 0 8ESU 38042860 Myoglobin variant Mb-imi complex 2022-10-14 2023-12-06 Nam, D.,Bacik, J.P.,Khade, R.L.,Aguilera, M.C.,Wei, Y.,Villada, J.D.,Neidig, M.L.,Zhang, Y.,Ando, N.,Fasan, R. Mechanistic manifold in a hemoprotein-catalyzed cyclopropanation reaction with diazoketone. Nat Commun 2023 14 7985 7985 8FAH 38157856 Crystal structure of SARS-CoV-2 receptor binding domain in complex with SARS-CoV-2 reactive human antibody CR3022 2022-11-26 2023-12-13 Sankhala, R.S.,Dussupt, V.,Chen, W.H.,Bai, H.,Martinez, E.J.,Jensen, J.L.,Rees, P.A.,Hajduczki, A.,Chang, W.C.,Choe, M.,Yan, L.,Sterling, S.L.,Swafford, I.,Kuklis, C.,Soman, S.,King, J.,Corbitt, C.,Zemil, M.,Peterson, C.E.,Mendez-Rivera, L.,Townsley, S.M.,Donofrio, G.C.,Lal, K.G.,Tran, U.,Green, E.C.,Smith, C.,de Val, N.,Laing, E.D.,Broder, C.C.,Currier, J.R.,Gromowski, G.D.,Wieczorek, L.,Rolland, M.,Paquin-Proulx, D.,van Dyk, D.,Britton, Z.,Rajan, S.,Loo, Y.M.,McTamney, P.M.,Esser, M.T.,Polonis, V.R.,Michael, N.L.,Krebs, S.J.,Modjarrad, K.,Joyce, M.G. Antibody targeting of conserved sites of vulnerability on the SARS-CoV-2 spike receptor-binding domain. Structure 2024 32 131 0 8G1Z 37902787 Crystal Structure of Danio rerio histone deacetylase 6 catalytic domain 2 complexed with inhibitor Mz317 2023-02-03 2023-12-13 Sinatra, L.,Vogelmann, A.,Friedrich, F.,Tararina, M.A.,Neuwirt, E.,Colcerasa, A.,Konig, P.,Toy, L.,Yesiloglu, T.Z.,Hilscher, S.,Gaitzsch, L.,Papenkordt, N.,Zhai, S.,Zhang, L.,Romier, C.,Einsle, O.,Sippl, W.,Schutkowski, M.,Gross, O.,Bendas, G.,Christianson, D.W.,Hansen, F.K.,Jung, M.,Schiedel, M. Development of First-in-Class Dual Sirt2/HDAC6 Inhibitors as Molecular Tools for Dual Inhibition of Tubulin Deacetylation. J.Med.Chem. 2023 66 14787 14814 8G2H 38045046 Crystal Structure of PRMT4 with Compound YD1113 2023-02-03 2023-12-13 Deng, Y.,Song, X.,Iyamu, I.D.,Dong, A.,Min, J.,Huang, R. A unique binding pocket induced by a noncanonical SAH mimic to develop potent and selective PRMT inhibitors. Acta Pharm Sin B 2023 13 4893 4905 8SGU 38157856 Crystal structure of the SARS-CoV-2 receptor binding domain 2023-04-13 2023-12-13 Sankhala, R.S.,Dussupt, V.,Chen, W.H.,Bai, H.,Martinez, E.J.,Jensen, J.L.,Rees, P.A.,Hajduczki, A.,Chang, W.C.,Choe, M.,Yan, L.,Sterling, S.L.,Swafford, I.,Kuklis, C.,Soman, S.,King, J.,Corbitt, C.,Zemil, M.,Peterson, C.E.,Mendez-Rivera, L.,Townsley, S.M.,Donofrio, G.C.,Lal, K.G.,Tran, U.,Green, E.C.,Smith, C.,de Val, N.,Laing, E.D.,Broder, C.C.,Currier, J.R.,Gromowski, G.D.,Wieczorek, L.,Rolland, M.,Paquin-Proulx, D.,van Dyk, D.,Britton, Z.,Rajan, S.,Loo, Y.M.,McTamney, P.M.,Esser, M.T.,Polonis, V.R.,Michael, N.L.,Krebs, S.J.,Modjarrad, K.,Joyce, M.G. Antibody targeting of conserved sites of vulnerability on the SARS-CoV-2 spike receptor-binding domain. Structure 2024 32 131 0 8FR5 38051309 Crystal structure of the Human Smacovirus 1 Rep domain 2023-01-06 2023-12-27 Limon, L.K.,Shi, K.,Dao, A.,Rugloski, J.,Tompkins, K.J.,Aihara, H.,Gordon, W.R.,Evans 3rd, R.L. The crystal structure of the human smacovirus 1 Rep domain. Acta Crystallogr.,Sect.F 2023 79 295 300 8G29 38238495 Crystal structure of the A2503-C2,C8-dimethylated Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Phe-tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.55A resolution 2023-02-03 2023-12-27 Aleksandrova, E.V.,Wu, K.J.Y.,Tresco, B.I.C.,Syroegin, E.A.,Killeavy, E.E.,Balasanyants, S.M.,Svetlov, M.S.,Gregory, S.T.,Atkinson, G.C.,Myers, A.G.,Polikanov, Y.S. Structural basis of Cfr-mediated antimicrobial resistance and mechanisms to evade it. Nat.Chem.Biol. 2024 20 867 876 8G2A 38238495 Crystal structure of the A2503-C2,C8-dimethylated Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Phe-tRNAphe, peptidyl P-site fMTHSMRC-tRNAmet, and deacylated E-site tRNAphe at 2.45A resolution 2023-02-03 2023-12-27 Aleksandrova, E.V.,Wu, K.J.Y.,Tresco, B.I.C.,Syroegin, E.A.,Killeavy, E.E.,Balasanyants, S.M.,Svetlov, M.S.,Gregory, S.T.,Atkinson, G.C.,Myers, A.G.,Polikanov, Y.S. Structural basis of Cfr-mediated antimicrobial resistance and mechanisms to evade it. Nat.Chem.Biol. 2024 20 867 876 8G2B 38238495 Crystal structure of the A2503-C2,C8-dimethylated Thermus thermophilus 70S ribosome in complex with iboxamycin, mRNA, deacylated A- and E-site tRNAphe, and aminoacylated P-site fMet-tRNAmet at 2.55A resolution 2023-02-03 2023-12-27 Aleksandrova, E.V.,Wu, K.J.Y.,Tresco, B.I.C.,Syroegin, E.A.,Killeavy, E.E.,Balasanyants, S.M.,Svetlov, M.S.,Gregory, S.T.,Atkinson, G.C.,Myers, A.G.,Polikanov, Y.S. Structural basis of Cfr-mediated antimicrobial resistance and mechanisms to evade it. Nat.Chem.Biol. 2024 20 867 876 8G2C 38238495 Crystal structure of the A2503-C2,C8-dimethylated Thermus thermophilus 70S ribosome in complex with tylosin, mRNA, aminoacylated A-site Phe-tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.65A resolution 2023-02-03 2023-12-27 Aleksandrova, E.V.,Wu, K.J.Y.,Tresco, B.I.C.,Syroegin, E.A.,Killeavy, E.E.,Balasanyants, S.M.,Svetlov, M.S.,Gregory, S.T.,Atkinson, G.C.,Myers, A.G.,Polikanov, Y.S. Structural basis of Cfr-mediated antimicrobial resistance and mechanisms to evade it. Nat.Chem.Biol. 2024 20 867 876 8G2D 38238495 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with tylosin, mRNA, deacylated A- and E-site tRNAphe, and deacylated P-site tRNAmet at 2.70A resolution 2023-02-03 2023-12-27 Aleksandrova, E.V.,Wu, K.J.Y.,Tresco, B.I.C.,Syroegin, E.A.,Killeavy, E.E.,Balasanyants, S.M.,Svetlov, M.S.,Gregory, S.T.,Atkinson, G.C.,Myers, A.G.,Polikanov, Y.S. Structural basis of Cfr-mediated antimicrobial resistance and mechanisms to evade it. Nat.Chem.Biol. 2024 20 867 876 8UGC 38097544 FD15: Flat repeat helix-turn-helix-turn protein 2023-10-05 2023-12-27 Davila-Hernandez, F.A.,Jin, B.,Pyles, H.,Zhang, S.,Wang, Z.,Huddy, T.F.,Bera, A.K.,Kang, A.,Chen, C.L.,De Yoreo, J.J.,Baker, D. Directing polymorph specific calcium carbonate formation with de novo protein templates. Nat Commun 2023 14 8191 8191 8G6D 38227586 HSV-1 Nuclear Egress Complex (SUP; UL31-R229L) 2023-02-15 2024-01-10 Draganova, E.B.,Wang, H.,Wu, M.,Liao, S.,Vu, A.,Gonzalez-Del Pino, G.L.,Zhou, Z.H.,Roller, R.J.,Heldwein, E.E. The universal suppressor mutation restores membrane budding defects in the HSV-1 nuclear egress complex by stabilizing the oligomeric lattice. Plos Pathog. 2024 20 0 0 8GJG 38109936 De novo design of high-affinity protein binders to bioactive helical peptides 2023-03-15 2024-01-10 Vazquez Torres, S.,Leung, P.J.Y.,Venkatesh, P.,Lutz, I.D.,Hink, F.,Huynh, H.H.,Becker, J.,Yeh, A.H.,Juergens, D.,Bennett, N.R.,Hoofnagle, A.N.,Huang, E.,MacCoss, M.J.,Exposit, M.,Lee, G.R.,Bera, A.K.,Kang, A.,De La Cruz, J.,Levine, P.M.,Li, X.,Lamb, M.,Gerben, S.R.,Murray, A.,Heine, P.,Korkmaz, E.N.,Nivala, J.,Stewart, L.,Watson, J.L.,Rogers, J.M.,Baker, D. De novo design of high-affinity binders of bioactive helical peptides. Nature 2024 626 435 442 8GJI 38109936 De novo design of high-affinity protein binders to bioactive helical peptides 2023-03-15 2024-01-10 Vazquez Torres, S.,Leung, P.J.Y.,Venkatesh, P.,Lutz, I.D.,Hink, F.,Huynh, H.H.,Becker, J.,Yeh, A.H.,Juergens, D.,Bennett, N.R.,Hoofnagle, A.N.,Huang, E.,MacCoss, M.J.,Exposit, M.,Lee, G.R.,Bera, A.K.,Kang, A.,De La Cruz, J.,Levine, P.M.,Li, X.,Lamb, M.,Gerben, S.R.,Murray, A.,Heine, P.,Korkmaz, E.N.,Nivala, J.,Stewart, L.,Watson, J.L.,Rogers, J.M.,Baker, D. De novo design of high-affinity binders of bioactive helical peptides. Nature 2024 626 435 442 8T2B 38241435 Crystal structure of SCV PTE G18C mutant RNA in complex with Fab BL3-6 2023-06-05 2024-01-10 Ojha, M.,Vogt, J.,Das, N.K.,Redmond, E.,Singh, K.,Banna, H.A.,Sadat, T.,Koirala, D. Structure of saguaro cactus virus 3' translational enhancer mimics 5' cap for eIF4E binding. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8T5E 38109936 De novo design of high-affinity protein binders to bioactive helical peptides 2023-06-13 2024-01-10 Vazquez Torres, S.,Leung, P.J.Y.,Venkatesh, P.,Lutz, I.D.,Hink, F.,Huynh, H.H.,Becker, J.,Yeh, A.H.,Juergens, D.,Bennett, N.R.,Hoofnagle, A.N.,Huang, E.,MacCoss, M.J.,Exposit, M.,Lee, G.R.,Bera, A.K.,Kang, A.,De La Cruz, J.,Levine, P.M.,Li, X.,Lamb, M.,Gerben, S.R.,Murray, A.,Heine, P.,Korkmaz, E.N.,Nivala, J.,Stewart, L.,Watson, J.L.,Rogers, J.M.,Baker, D. De novo design of high-affinity binders of bioactive helical peptides. Nature 2024 626 435 442 8T5F 38109936 De novo design of high-affinity protein binders to bioactive helical peptides 2023-06-13 2024-01-10 Vazquez Torres, S.,Leung, P.J.Y.,Venkatesh, P.,Lutz, I.D.,Hink, F.,Huynh, H.H.,Becker, J.,Yeh, A.H.,Juergens, D.,Bennett, N.R.,Hoofnagle, A.N.,Huang, E.,MacCoss, M.J.,Exposit, M.,Lee, G.R.,Bera, A.K.,Kang, A.,De La Cruz, J.,Levine, P.M.,Li, X.,Lamb, M.,Gerben, S.R.,Murray, A.,Heine, P.,Korkmaz, E.N.,Nivala, J.,Stewart, L.,Watson, J.L.,Rogers, J.M.,Baker, D. De novo design of high-affinity binders of bioactive helical peptides. Nature 2024 626 435 442 8FTY 38355721 Crystal structure of the carotenoid isomerooxygenase, NinaB 2023-01-14 2024-01-17 Solano, Y.J.,Everett, M.P.,Dang, K.S.,Abueg, J.,Kiser, P.D. Carotenoid cleavage enzymes evolved convergently to generate the visual chromophore. Nat.Chem.Biol. 2024 20 779 788 8FV4 38378740 EGFR(T790M/V948R) in complex with compound 2 (LN5993) 2023-01-18 2024-01-17 Wittlinger, F.,Ogboo, B.C.,Shevchenko, E.,Damghani, T.,Pham, C.D.,Schaeffner, I.K.,Oligny, B.T.,Chitnis, S.P.,Beyett, T.S.,Rasch, A.,Buckley, B.,Urul, D.A.,Shaurova, T.,May, E.W.,Schaefer, E.M.,Eck, M.J.,Hershberger, P.A.,Poso, A.,Laufer, S.A.,Heppner, D.E. Linking ATP and allosteric sites to achieve superadditive binding with bivalent EGFR kinase inhibitors. Commun Chem 2024 7 38 38 8T0B 38451205 Novel Domain of Unknown Function Solved with AlphaFold 2023-05-31 2024-01-17 Miller, J.E.,Agdanowski, M.P.,Dolinsky, J.L.,Sawaya, M.R.,Cascio, D.,Rodriguez, J.A.,Yeates, T.O. AlphaFold-assisted structure determination of a bacterial protein of unknown function using X-ray and electron crystallography. Acta Crystallogr D Struct Biol 2024 80 270 278 8GDU 38358135 Crystal structure of a mutant methyl transferase from Methanosarcina acetivorans, Northeast Structural Genomics Consortium (NESG) Target MvR53-11M 2023-03-06 2024-01-24 Banayan, N.E.,Loughlin, B.J.,Singh, S.,Forouhar, F.,Lu, G.,Wong, K.H.,Neky, M.,Hunt, H.S.,Bateman Jr., L.B.,Tamez, A.,Handelman, S.K.,Price, W.N.,Hunt, J.F. Systematic enhancement of protein crystallization efficiency by bulk lysine-to-arginine (KR) substitution. Protein Sci. 2024 33 0 0 8VL7 Co-crystal structure of human TREX1 in complex with an inhibitor 2024-01-11 2024-01-24 Dehghani-Tafti, S.,Dong, A.,Li, Y.,Ackloo, S.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L. Co-crystal structure of human TREX1 in complex with an inhibitor To be published 0 0 0 0 8UVK 38323832 CosR DNA bound form II 2023-11-03 2024-01-31 Zhang, Z.,Yan, Y.,Pang, J.,Dai, L.,Zhang, Q.,Yu, E.W. Structural basis of DNA recognition of the Campylobacter jejuni CosR regulator. Mbio 2024 15 0 0 8UVX 38323832 CosR DNA bound form I 2023-11-05 2024-01-31 Zhang, Z.,Yan, Y.,Pang, J.,Dai, L.,Zhang, Q.,Yu, E.W. Structural basis of DNA recognition of the Campylobacter jejuni CosR regulator. Mbio 2024 15 0 0 8V04 40973081 High resolution TMPRSS2 structure following acylation by nafamostat 2023-11-16 2024-01-31 Fraser, B.J.,Young, N.J.,Bender, B.J.,Gahbauer, S.,Ilyassov, O.,Wilson, R.P.,Li, Y.,Seitova, A.,Lourenco, A.L.,Chung, D.H.,Bardine, C.,Benard, F.,Shoichet, B.K.,Craik, C.S.,Arrowsmith, C.H. Large Library Docking and Biophysical Analysis of Small-Molecule TMPRSS2 Inhibitors. J.Med.Chem. 2025 68 19893 19907 8S9W 37769710 Murine S100A7/S100A15 in presence of calcium 2023-03-30 2024-02-07 Harrison, S.A.,Naretto, A.,Balakrishnan, S.,Perera, Y.R.,Chazin, W.J. Comparative analysis of the physical properties of murine and human S100A7: Insight into why zinc piracy is mediated by human but not murine S100A7. J.Biol.Chem. 2023 299 105292 105292 8V1F 40973081 TMPRSS2 complexed with the noncovalent inhibitor 6-amidino-2-napthol 2023-11-20 2024-02-07 Fraser, B.J.,Young, N.J.,Bender, B.J.,Gahbauer, S.,Ilyassov, O.,Wilson, R.P.,Li, Y.,Seitova, A.,Lourenco, A.L.,Chung, D.H.,Bardine, C.,Benard, F.,Shoichet, B.K.,Craik, C.S.,Arrowsmith, C.H. Large Library Docking and Biophysical Analysis of Small-Molecule TMPRSS2 Inhibitors. J.Med.Chem. 2025 68 19893 19907 8G1L Lectin domain of Aap (Staphylococcus epidermidis Accumulation Associated Protein) 2023-02-02 2024-02-14 Maciag, J.J.,Herr, A.B. Mechanistic basis of staphylococcal interspecies competition for skin colonization To Be Published 0 0 0 0 8RQU 38902262 Structure of TEM1 beta-lactamase variant 70.a 2024-01-19 2024-02-14 Fram, B.,Su, Y.,Truebridge, I.,Riesselman, A.J.,Ingraham, J.B.,Passera, A.,Napier, E.,Thadani, N.N.,Lim, S.,Roberts, K.,Kaur, G.,Stiffler, M.A.,Marks, D.S.,Bahl, C.D.,Khan, A.R.,Sander, C.,Gauthier, N.P. Simultaneous enhancement of multiple functional properties using evolution-informed protein design. Nat Commun 2024 15 5141 5141 8T71 38354232 Crystal Structure of WT KRAS4a with bound GDP and Mg ion 2023-06-19 2024-02-14 Whitley, M.J.,Tran, T.H.,Rigby, M.,Yi, M.,Dharmaiah, S.,Waybright, T.J.,Ramakrishnan, N.,Perkins, S.,Taylor, T.,Messing, S.,Esposito, D.,Nissley, D.V.,McCormick, F.,Stephen, A.G.,Turbyville, T.,Cornilescu, G.,Simanshu, D.K. Comparative analysis of KRAS4a and KRAS4b splice variants reveals distinctive structural and functional properties. Sci Adv 2024 10 0 0 8T72 38354232 Crystal structure of WT KRAS4a with bound GMPPNP and Mg ion 2023-06-19 2024-02-14 Whitley, M.J.,Tran, T.H.,Rigby, M.,Yi, M.,Dharmaiah, S.,Waybright, T.J.,Ramakrishnan, N.,Perkins, S.,Taylor, T.,Messing, S.,Esposito, D.,Nissley, D.V.,McCormick, F.,Stephen, A.G.,Turbyville, T.,Cornilescu, G.,Simanshu, D.K. Comparative analysis of KRAS4a and KRAS4b splice variants reveals distinctive structural and functional properties. Sci Adv 2024 10 0 0 8T75 38354232 Crystal Structure of KRAS4a (GMPPNP) in complex with RAF1 (RBD-CRD) 2023-06-19 2024-02-14 Whitley, M.J.,Tran, T.H.,Rigby, M.,Yi, M.,Dharmaiah, S.,Waybright, T.J.,Ramakrishnan, N.,Perkins, S.,Taylor, T.,Messing, S.,Esposito, D.,Nissley, D.V.,McCormick, F.,Stephen, A.G.,Turbyville, T.,Cornilescu, G.,Simanshu, D.K. Comparative analysis of KRAS4a and KRAS4b splice variants reveals distinctive structural and functional properties. Sci Adv 2024 10 0 0 8BW8 38388830 Crystal structure of the dCNK-SAM-CRIC-PDZ/dHYP-SAM complex 2022-12-06 2024-02-21 Maisonneuve, P.,Sahmi, M.,Bergeron-Labrecque, F.,Ma, X.I.,Queguiner, J.,Arseneault, G.,Lefrancois, M.,Kurinov, I.,Fronzes, R.,Sicheri, F.,Therrien, M. The CNK-HYP scaffolding complex promotes RAF activation by enhancing KSR-MEK interaction. Nat.Struct.Mol.Biol. 2024 31 1028 1038 8UD6 38359125 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with cresomycin, mRNA, deacylated A-site tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.70A resolution 2023-09-28 2024-02-21 Wu, K.J.Y.,Tresco, B.I.C.,Ramkissoon, A.,Aleksandrova, E.V.,Syroegin, E.A.,See, D.N.Y.,Liow, P.,Dittemore, G.A.,Yu, M.,Testolin, G.,Mitcheltree, M.J.,Liu, R.Y.,Svetlov, M.S.,Polikanov, Y.S.,Myers, A.G. An antibiotic preorganized for ribosomal binding overcomes antimicrobial resistance. Science 2024 383 721 726 8UD7 38359125 Crystal structure of the A2058-N6-dimethylated Thermus thermophilus 70S ribosome in complex with cresomycin, mRNA, deacylated A-site tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.70A resolution 2023-09-28 2024-02-21 Wu, K.J.Y.,Tresco, B.I.C.,Ramkissoon, A.,Aleksandrova, E.V.,Syroegin, E.A.,See, D.N.Y.,Liow, P.,Dittemore, G.A.,Yu, M.,Testolin, G.,Mitcheltree, M.J.,Liu, R.Y.,Svetlov, M.S.,Polikanov, Y.S.,Myers, A.G. An antibiotic preorganized for ribosomal binding overcomes antimicrobial resistance. Science 2024 383 721 726 8UD8 38359125 Crystal structure of the A2503-C2,C8-dimethylated Thermus thermophilus 70S ribosome in complex with cresomycin, mRNA, deacylated A-site tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.70A resolution 2023-09-28 2024-02-21 Wu, K.J.Y.,Tresco, B.I.C.,Ramkissoon, A.,Aleksandrova, E.V.,Syroegin, E.A.,See, D.N.Y.,Liow, P.,Dittemore, G.A.,Yu, M.,Testolin, G.,Mitcheltree, M.J.,Liu, R.Y.,Svetlov, M.S.,Polikanov, Y.S.,Myers, A.G. An antibiotic preorganized for ribosomal binding overcomes antimicrobial resistance. Science 2024 383 721 726 8UIQ 38104959 H47Q NicC with 2-mercaptopyridine ligand 2023-10-10 2024-02-21 Turlington, Z.R.,Vaz Ferreira de Macedo, S.,Perry, K.,Belsky, S.L.,Faust, J.A.,Snider, M.J.,Hicks, K.A. Ligand bound structure of a 6-hydroxynicotinic acid 3-monooxygenase provides mechanistic insights. Arch.Biochem.Biophys. 2024 752 109859 109859 8UIQ 38104959 H47Q NicC with 2-mercaptopyridine ligand 2023-10-10 2024-02-21 Turlington, Z.R.,Vaz Ferreira de Macedo, S.,Perry, K.,Belsky, S.L.,Faust, J.A.,Snider, M.J.,Hicks, K.A. Ligand bound structure of a 6-hydroxynicotinic acid 3-monooxygenase provides mechanistic insights. Arch.Biochem.Biophys. 2024 752 109859 109859 8SNI 40864494 Hydroxynitrile Lyase from Hevea brasiliensis with Forty Mutations 2023-04-27 2024-02-28 Pierce, C.T.,Tan, P.,Greenberg, L.R.,Walsh, M.E.,Shi, K.,Nguyen, A.H.,Meixner, E.L.,Sarak, S.,Aihara, H.,Evans 3rd, R.L.,Kazlauskas, R.J. Crystal structures of 40- and 71-substitution variants of hydroxynitrile lyase from rubber tree. Acta Crystallogr D Struct Biol 2025 81 511 523 8TCU 38411104 Structure of PYCR1 complexed with 2-chloro-5-(2-oxoimidazolidin-1-yl)benzoic acid 2023-07-02 2024-03-06 Meeks, K.R.,Ji, J.,Protopopov, M.V.,Tarkhanova, O.O.,Moroz, Y.S.,Tanner, J.J. Novel Fragment Inhibitors of PYCR1 from Docking-Guided X-ray Crystallography. J.Chem.Inf.Model. 2024 64 1704 1718 8TCV 38411104 Structure of PYCR1 complexed with 4-bromobenzene-1,3-dicarboxylic acid 2023-07-02 2024-03-06 Meeks, K.R.,Ji, J.,Protopopov, M.V.,Tarkhanova, O.O.,Moroz, Y.S.,Tanner, J.J. Novel Fragment Inhibitors of PYCR1 from Docking-Guided X-ray Crystallography. J.Chem.Inf.Model. 2024 64 1704 1718 8TCX 38411104 Structure of PYCR1 complexed with 2,4-dioxo-1,2,3,4-tetrahydroquinazoline-6-carboxylic acid 2023-07-02 2024-03-06 Meeks, K.R.,Ji, J.,Protopopov, M.V.,Tarkhanova, O.O.,Moroz, Y.S.,Tanner, J.J. Novel Fragment Inhibitors of PYCR1 from Docking-Guided X-ray Crystallography. J.Chem.Inf.Model. 2024 64 1704 1718 8TD0 38411104 Structure of PYCR1 complexed with 5-oxo-7a-phenyl-hexahydropyrrolo[2,1-b][1,3]thiazole-3-carboxylic acid 2023-07-02 2024-03-06 Meeks, K.R.,Ji, J.,Protopopov, M.V.,Tarkhanova, O.O.,Moroz, Y.S.,Tanner, J.J. Novel Fragment Inhibitors of PYCR1 from Docking-Guided X-ray Crystallography. J.Chem.Inf.Model. 2024 64 1704 1718 8TD1 38411104 Structure of PYCR1 complexed with 3-(6-Oxa-9-azaspiro(4.5)decane-9-carbonyl)benzoic acid 2023-07-02 2024-03-06 Meeks, K.R.,Ji, J.,Protopopov, M.V.,Tarkhanova, O.O.,Moroz, Y.S.,Tanner, J.J. Novel Fragment Inhibitors of PYCR1 from Docking-Guided X-ray Crystallography. J.Chem.Inf.Model. 2024 64 1704 1718 8TJG 39012146 Structure of Nei2 from Mycobacterium smegmatis in complex with Zn2+ 2023-07-21 2024-03-06 Warren, G.M.,Shuman, S. Structure and in vivo psoralen DNA crosslink repair activity of mycobacterial Nei2. Mbio 2024 15 0 0 8UJA 38513658 T33-fn10 - Designed Tetrahedral Protein Cage Using Fragment-based Hydrogen Bond Networks 2023-10-11 2024-03-06 Meador, K.,Castells-Graells, R.,Aguirre, R.,Sawaya, M.R.,Arbing, M.A.,Sherman, T.,Senarathne, C.,Yeates, T.O. A suite of designed protein cages using machine learning and protein fragment-based protocols. Structure 2024 32 751 0 8GB4 EGFR(T790M/V948R) kinase in complex with benzimidazole allosteric inhibitor 2023-02-24 2024-03-13 Beyett, T.S.,Eck, M.J. EGFR(T790M/V948R) kinase in complex with benzimidazole allosteric inhibitor To be published 0 0 0 0 8T48 38697117 The N4BP1 CUE-like domain in complex with linear di-Ubiquitin 2023-06-08 2024-03-13 Gitlin, A.D.,Maltzman, A.,Kanno, Y.,Heger, K.,Reja, R.,Schubert, A.F.,Wierciszewski, L.J.,Pantua, H.,Kapadia, S.B.,Harris, S.F.,Webster, J.D.,Newton, K.,Dixit, V.M. N4BP1 coordinates ubiquitin-dependent crosstalk within the I kappa B kinase family to limit Toll-like receptor signaling and inflammation. Immunity 2024 57 973 0 8FG6 38503834 Design of amyloidogenic peptide traps 2022-12-12 2024-03-20 Sahtoe, D.D.,Andrzejewska, E.A.,Han, H.L.,Rennella, E.,Schneider, M.M.,Meisl, G.,Ahlrichs, M.,Decarreau, J.,Nguyen, H.,Kang, A.,Levine, P.,Lamb, M.,Li, X.,Bera, A.K.,Kay, L.E.,Knowles, T.P.J.,Baker, D. Design of amyloidogenic peptide traps. Nat.Chem.Biol. 2024 20 981 990 8GKJ 38394685 Crystal Structure of the Murine MUC16 Specific Antibody AR9.6 2023-03-19 2024-03-20 Aguilar, E.N.,Sagar, S.,Murray, B.R.,Rajesh, C.,Lei, E.K.,Michaud, S.A.,Goodlett, D.R.,Caffrey, T.C.,Grandgenett, P.M.,Swanson, B.,Brooks, T.M.,Black, A.R.,van Faassen, H.,Hussack, G.,Henry, K.A.,Hollingsworth, M.A.,Brooks, C.L.,Radhakrishnan, P. Structural Basis for Multivalent MUC16 Recognition and Robust Anti-Pancreatic Cancer Activity of Humanized Antibody AR9.6. Mol.Cancer Ther. 2024 23 836 853 8S9L 38453899 Structure of monomeric FAM111A SPD V347D Mutant 2023-03-29 2024-03-20 Palani, S.,Machida, Y.,Alvey, J.R.,Mishra, V.,Welter, A.L.,Cui, G.,Bragantini, B.,Botuyan, M.V.,Cong, A.T.Q.,Mer, G.,Schellenberg, M.J.,Machida, Y.J. Dimerization-dependent serine protease activity of FAM111A prevents replication fork stalling at topoisomerase 1 cleavage complexes. Nat Commun 2024 15 2064 2064 8GM3 38814789 Vibrio harveyi Holo HphA 2023-03-24 2024-03-27 Shin, H.E.,Pan, C.,Curran, D.M.,Bateman, T.J.,Chong, D.H.Y.,Ng, D.,Shah, M.,Moraes, T.F. Prevalence of Slam-dependent hemophilins in Gram-negative bacteria. J.Bacteriol. 2024 206 0 0 8U5P 38945550 Structure of Mango II aptamer bound to T01-6A-B 2023-09-12 2024-03-27 Lu, X.,Passalacqua, L.F.M.,Nodwell, M.,Kong, K.Y.S.,Caballero-Garcia, G.,Dolgosheina, E.V.,Ferre-D'Amare, A.R.,Britton, R.,Unrau, P.J. Symmetry breaking of fluorophore binding to a G-quadruplex generates an RNA aptamer with picomolar KD. Nucleic Acids Res. 2024 52 8039 8051 8W3V Crystal structure of human WDR41 2024-02-22 2024-03-27 Hutchinson, A.,Dong, A.,Li, Y.,Seitova, A.,Bountra, C.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Crystal structure of human WDR41 To be published 0 0 0 0 8UIW 38565535 yjdF riboswitch from R. gauvreauii in complex with chelerythrine bound to Fab BL3-6 S97N 2023-10-10 2024-04-10 Krochmal, D.,Roman, C.,Lewicka, A.,Shao, Y.,Piccirilli, J.A. Structural basis for promiscuity in ligand recognition by yjdF riboswitch. Cell Discov 2024 10 37 37 8V52 38272035 Crystal structure of 2A10 Fab bound to Human TGF-beta3 2023-11-30 2024-04-10 Sun, T.,Vander Heiden, J.A.,Gao, X.,Yin, J.,Uttarwar, S.,Liang, W.C.,Jia, G.,Yadav, R.,Huang, Z.,Mitra, M.,Halpern, W.,Bender, H.S.,Brightbill, H.D.,Wu, Y.,Lupardus, P.,Ramalingam, T.,Arron, J.R. Isoform-selective TGF-beta 3 inhibition for systemic sclerosis. Med 2024 5 132 0 8SHR Crystal Structure of PRMT3 with Compound YD1-214 2023-04-14 2024-04-17 Song, X.,Dong, A.,Deng, Y.,Huang, R.,Arrowsmith, C.H.,Edwards, A.M.,Min, J.,Structural Genomics Consortium (SGC) Crystal Structure of PRMT3 with Compound YD1-214 To be published 0 0 0 0 8TWQ 38554102 Structure of bacteriophage lambda RexA protein 2023-08-21 2024-04-17 Adams, M.C.,Schiltz, C.J.,Sun, J.,Hosford, C.J.,Johnson, V.M.,Pan, H.,Borbat, P.P.,Freed, J.H.,Thomason, L.C.,Court, C.,Court, D.L.,Chappie, J.S. The crystal structure of bacteriophage lambda RexA provides novel insights into the DNA binding properties of Rex-like phage exclusion proteins. Nucleic Acids Res. 2024 52 4659 4675 8UDC 38565869 Crystal structure of TcPINK1 in complex with CYC116 2023-09-28 2024-04-17 Rasool, S.,Shomali, T.,Truong, L.,Croteau, N.,Veyron, S.,Bustillos, B.A.,Springer, W.,Fiesel, F.C.,Trempe, J.F. Identification and structural characterization of small molecule inhibitors of PINK1. Sci Rep 2024 14 7739 7739 8UWB 38582449 Crystal structure of PP2A PPP2R1A-PPP2CA-PPP2R5E phosphatase. 2023-11-06 2024-04-17 Wachter, F.,Nowak, R.P.,Ficarro, S.,Marto, J.,Fischer, E.S. Structural characterization of methylation-independent PP2A assembly guides alphafold2Multimer prediction of family-wide PP2A complexes. J.Biol.Chem. 2024 300 107268 107268 8V9I 38513073 1-deoxy-D-xylulose 5-phosphate synthase (DXPS) from Deinococcus radiodurans with D-phenylalanine-derived triazole acetylphosphonate (D-PheTrAP) bound 2023-12-08 2024-04-24 Coco, L.B.,Toci, E.M.,Chen, P.Y.,Drennan, C.L.,Freel Meyers, C.L. Potent Inhibition of E. coli DXP Synthase by a gem -Diaryl Bisubstrate Analog. Acs Infect Dis. 2024 10 1312 1326 8UCT 38565869 Crystal structure of TcPINK1 in complex with PRT 2023-09-27 2024-05-08 Rasool, S.,Shomali, T.,Truong, L.,Croteau, N.,Veyron, S.,Bustillos, B.A.,Springer, W.,Fiesel, F.C.,Trempe, J.F. Identification and structural characterization of small molecule inhibitors of PINK1. Sci Rep 2024 14 7739 7739 9AVA Co-crystal structure of human TREX1 in complex with an inhibitor 2024-03-01 2024-05-15 Dehghani-Tafti, S.,Dong, A.,Li, Y.,Xu, J.,Ackloo, S.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Co-crystal structure of human TREX1 in complex with an inhibitor To be published 0 0 0 0 8K70 38740643 Structural basis for the distinct roles of non-conserved Pro116 and conserved Tyr124 of BCH domain of yeast p50RhoGAP 2023-07-26 2024-05-29 Shankar, S.,Chew, T.W.,Chichili, V.P.R.,Low, B.C.,Sivaraman, J. Structural basis for the distinct roles of non-conserved Pro116 and conserved Tyr124 of BCH domain of yeast p50RhoGAP. Cell.Mol.Life Sci. 2024 81 216 216 9BBE Co-crystal structure of human DDB1 bound to fragment UB028668 2024-04-05 2024-06-12 Zeng, H.,Dong, A.,Frommlet, A.,Seitova, A.,Loppnau, P.,Ackloo, S.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Co-crystal structure of human DDB1 bound to fragment UB028668 To be published 0 0 0 0 9BBG Co-crystal structure of human DDB1 bound to fragment UB028671 2024-04-05 2024-06-12 Zeng, H.,Dong, A.,Frommlet, A.,Seitova, A.,Loppnau, P.,Ackloo, S.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Co-crystal structure of human DDB1 bound to fragment UB028671 To be published 0 0 0 0 9BBI Co-crystal structure of human DDB1 bound to fragment UB028669 2024-04-05 2024-06-12 Zeng, H.,Dong, A.,Frommlet, A.,Seitova, A.,Loppnau, P.,Ackloo, S.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Co-crystal structure of human DDB1 bound to fragment UB028669 To be published 0 0 0 0 8T51 39333507 Crystal structure of Fab 3.10C2 bound to TREM2 2023-06-12 2024-06-19 Hsiao, Y.C.,Wallweber, H.A.,Alberstein, R.G.,Lin, Z.,Du, C.,Etxeberria, A.,Aung, T.,Shang, Y.,Seshasayee, D.,Seeger, F.,Watkins, A.M.,Hansen, D.V.,Bohlen, C.J.,Hsu, P.L.,Hotzel, I. Rapid affinity optimization of an anti-TREM2 clinical lead antibody by cross-lineage immune repertoire mining. Nat Commun 2024 15 8382 8382 8TKB 40324821 tRNA 2-phosphotransferase (Tpt1) from Pyrococcus horikoshii in complex with 5'-AMP 2023-07-25 2024-06-19 Jacewicz, A.,Damha, M.J.,Shuman, S. Structures of RNA phosphotransferase Tpt1 reveal distinct binding modes for an RNA 2'-PO 4 splice junction versus a 5'-PO 4 mononucleotide. Rna 2025 31 916 922 9ARD 38917809 Structure of Pycsar EcPycC cyclase immunoglobulin-like AGS-C domain 2024-02-23 2024-06-19 Richmond-Buccola, D.,Hobbs, S.J.,Garcia, J.M.,Toyoda, H.,Gao, J.,Shao, S.,Lee, A.S.Y.,Kranzusch, P.J. A large-scale type I CBASS antiphage screen identifies the phage prohead protease as a key determinant of immune activation and evasion. Cell Host Microbe 2024 32 1074 0 8GK5 EGFR(T790M/V948R) kinase in complex with osimertinib and benzimidazole allosteric inhibitor 2023-03-17 2024-06-26 Beyett, T.S.,Eck, M.J. Development of benzimidazole allosteric EGFR kinase inhibitors To be published 0 0 0 0 8US1 38959031 P21 Crystal structure of TamA from Pseudomonas aeruginosa at 2.6 Ang 2023-10-27 2024-06-26 Mellouk, A.,Jaouen, P.,Ruel, L.J.,Le, M.,Martini, C.,Moraes, T.F.,El Bakkouri, M.,Lague, P.,Boisselier, E.,Calmettes, C. POTRA domains of the TamA insertase interact with the outer membrane and modulate membrane properties. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8US2 38959031 P22121 Crystal structure of TamA from Pseudomonas aeruginosa at 3.95 Ang 2023-10-27 2024-06-26 Mellouk, A.,Jaouen, P.,Ruel, L.J.,Le, M.,Martini, C.,Moraes, T.F.,El Bakkouri, M.,Lague, P.,Boisselier, E.,Calmettes, C. POTRA domains of the TamA insertase interact with the outer membrane and modulate membrane properties. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8US3 38959031 C2 Crystal structure of TamA from Pseudomonas aeruginosa at 3.1 Ang 2023-10-27 2024-06-26 Mellouk, A.,Jaouen, P.,Ruel, L.J.,Le, M.,Martini, C.,Moraes, T.F.,El Bakkouri, M.,Lague, P.,Boisselier, E.,Calmettes, C. POTRA domains of the TamA insertase interact with the outer membrane and modulate membrane properties. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8US4 38959031 C2221 Crystal structure of TamA (Barrel only) from Pseudomonas aeruginosa at 3.15 Ang 2023-10-27 2024-06-26 Mellouk, A.,Jaouen, P.,Ruel, L.J.,Le, M.,Martini, C.,Moraes, T.F.,El Bakkouri, M.,Lague, P.,Boisselier, E.,Calmettes, C. POTRA domains of the TamA insertase interact with the outer membrane and modulate membrane properties. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8EPC 38985762 Crystal structure of human coagulation factor IXa (S195A), apo-form 2022-10-05 2024-07-03 Kolyadko, V.N.,Layzer, J.M.,Perry, K.,Sullenger, B.A.,Krishnaswamy, S. An RNA aptamer exploits exosite-dependent allostery to achieve specific inhibition of coagulation factor IXa. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8EPH 38985762 Crystal structure of human coagulation factor IXa (S195A), apo-form, DES-GLA 2022-10-05 2024-07-03 Kolyadko, V.N.,Layzer, J.M.,Perry, K.,Sullenger, B.A.,Krishnaswamy, S. An RNA aptamer exploits exosite-dependent allostery to achieve specific inhibition of coagulation factor IXa. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8EPK 38985762 Complex of anticoagulant RNA aptamer and human coagulation factor IXa (S195A) 2022-10-05 2024-07-03 Kolyadko, V.N.,Layzer, J.M.,Perry, K.,Sullenger, B.A.,Krishnaswamy, S. An RNA aptamer exploits exosite-dependent allostery to achieve specific inhibition of coagulation factor IXa. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8SE8 38777835 HTRA-1 PD/SA bound to CKP 1G10 2023-04-08 2024-07-03 Li, Y.,Wei, Y.,Ultsch, M.,Li, W.,Tang, W.,Tombling, B.,Gao, X.,Dimitrova, Y.,Gampe, C.,Fuhrmann, J.,Zhang, Y.,Hannoush, R.N.,Kirchhofer, D. Cystine-knot peptide inhibitors of HTRA1 bind to a cryptic pocket within the active site region. Nat Commun 2024 15 4359 4359 8SJB Crystal structure of Zn2+ bound calprotectin variant H87C 2023-04-17 2024-07-03 Perera, Y.R.,Nassif, A.R.,Garcia, V.,Guillen, R.M.,Chazin, W.J. Crystal structure of Zn2+ bound calprotectin To Be Published 0 0 0 0 8TAA 39704129 Right-left hybrid parallel G-quadruplex in complex with N-methyl mesoporphyrin 2023-06-27 2024-07-03 Seth, P.,Xing, E.,Hendrickson, A.D.,Li, K.,Monsen, R.,Chaires, J.B.,Neidle, S.,Yatsunyk, L.A. Interaction of N-methylmesoporphyrin IX with a hybrid left-/right-handed G-quadruplex motif from the promoter of the SLC2A1 gene. Nucleic Acids Res. 2025 53 0 0 8TD3 39133178 Structure of PYCR1 complexed with NADH and (S)-Tetrahydro-2H-pyran-2-carboxylic acid 2023-07-02 2024-07-03 Meeks, K.R.,Bogner, A.N.,Tanner, J.J. Screening a knowledge-based library of low molecular weight compounds against the proline biosynthetic enzyme 1-pyrroline-5-carboxylate 1 (PYCR1). Protein Sci. 2024 33 0 0 8TD7 39133178 Structure of PYCR1 complexed with 2S-hydroxy-3-methylbutyric acid 2023-07-02 2024-07-03 Meeks, K.R.,Bogner, A.N.,Tanner, J.J. Screening a knowledge-based library of low molecular weight compounds against the proline biosynthetic enzyme 1-pyrroline-5-carboxylate 1 (PYCR1). Protein Sci. 2024 33 0 0 8TD9 39133178 Structure of PYCR1 complexed with NADH and L-pipecolic acid 2023-07-02 2024-07-03 Meeks, K.R.,Bogner, A.N.,Tanner, J.J. Screening a knowledge-based library of low molecular weight compounds against the proline biosynthetic enzyme 1-pyrroline-5-carboxylate 1 (PYCR1). Protein Sci. 2024 33 0 0 8TDB 39133178 Structure of PYCR1 complexed with NADH and 1-hydroxyethane-1-sulfonate 2023-07-02 2024-07-03 Meeks, K.R.,Bogner, A.N.,Tanner, J.J. Screening a knowledge-based library of low molecular weight compounds against the proline biosynthetic enzyme 1-pyrroline-5-carboxylate 1 (PYCR1). Protein Sci. 2024 33 0 0 8UTK 38936360 IL-23R minibinder - 23R-B04dslf02IB 2023-10-31 2024-07-10 Berger, S.,Seeger, F.,Yu, T.Y.,Aydin, M.,Yang, H.,Rosenblum, D.,Guenin-Mace, L.,Glassman, C.,Arguinchona, L.,Sniezek, C.,Blackstone, A.,Carter, L.,Ravichandran, R.,Ahlrichs, M.,Murphy, M.,Pultz, I.S.,Kang, A.,Bera, A.K.,Stewart, L.,Garcia, K.C.,Naik, S.,Spangler, J.B.,Beigel, F.,Siebeck, M.,Gropp, R.,Baker, D. Preclinical proof of principle for orally delivered Th17 antagonist miniproteins. Cell 2024 187 4305 0 8VEI 39024436 De novo designed colic acid binder CHD_r1 2023-12-19 2024-07-17 An, L.,Said, M.,Tran, L.,Majumder, S.,Goreshnik, I.,Lee, G.R.,Juergens, D.,Dauparas, J.,Anishchenko, I.,Coventry, B.,Bera, A.K.,Kang, A.,Levine, P.M.,Alvarez, V.,Pillai, A.,Norn, C.,Feldman, D.,Zorine, D.,Hicks, D.R.,Li, X.,Sanchez, M.G.,Vafeados, D.K.,Salveson, P.J.,Vorobieva, A.A.,Baker, D. Binding and sensing diverse small molecules using shape-complementary pseudocycles. Science 2024 385 276 282 8FUT 39510183 Crystal structure of Xenopus laevis arrestin 1 - P3121 crystal form 2023-01-18 2024-07-24 Barnes, C.L.,Salom, D.,Namitz, K.E.W.,Smith, W.C.,Knutson, B.A.,Cosgrove, M.S.,Kiser, P.D.,Calvert, P.D. Mechanisms of amphibian arrestin 1 self-association and dynamic distribution in retinal photoreceptors. J.Biol.Chem. 2024 300 107966 107966 9B7C 41337576 high-resolution ambient temperature structure of lysozyme soaked with sodium iodide 2024-03-27 2024-07-31 Hekstra, D.R.,Wang, H.K.,Klureza, M.A.,Greisman, J.B.,Dalton, K.M. Sensitive detection of structural dynamics using a statistical framework for comparative crystallography. Sci Adv 2025 11 0 0 9B8U 39084215 Crystal structure of CRX-Ret4 oligonucleotide complex 2024-04-01 2024-07-31 Srivastava, D.,Gowribidanur-Chinnaswamy, P.,Gaur, P.,Spies, M.,Swaroop, A.,Artemyev, N.O. Molecular basis of CRX/DNA recognition and stoichiometry at the Ret4 response element. Structure 2024 32 1751 0 9BKR Crystal structure of the Human TRIP12 WWE domain (isoform 2) in complex with ATP 2024-04-29 2024-07-31 Kimani, S.,Dong, A.,Li, Y.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L.,Structural Genomics Consortium (SGC) Crystal structure of the Human TRIP12 WWE domain (isoform 2) in complex with ATP To be published 0 0 0 0 8KB8 39426373 Structure of the WDR91 WD40 domain complexed with Rab7 2023-08-04 2024-08-07 Ma, X.,Li, J.,Liu, N.,Banerjee, S.,Hu, X.,Wang, X.,Dong, J.,Liu, K.,Yang, C.,Dong, Z. Insights into the distinct membrane targeting mechanisms of WDR91 family proteins. Structure 2024 32 2287 0 8KB9 39426373 Structure of the WDR91 WD40 domain 2023-08-04 2024-08-07 Ma, X.,Li, J.,Liu, N.,Banerjee, S.,Hu, X.,Wang, X.,Dong, J.,Liu, K.,Yang, C.,Dong, Z. Insights into the distinct membrane targeting mechanisms of WDR91 family proteins. Structure 2024 32 2287 0 8UVR 38165935 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with spectinomycin, mRNA, deacylated A- and E-site tRNAphe, and deacylated P-site tRNAmet at 2.60A resolution 2023-11-03 2024-08-07 Phelps, G.A.,Cheramie, M.N.,Fernando, D.M.,Selchow, P.,Meyer, C.J.,Waidyarachchi, S.L.,Dharuman, S.,Liu, J.,Meuli, M.,Molin, M.D.,Killam, B.Y.,Murphy, P.A.,Reeve, S.M.,Wilt, L.A.,Anderson, S.M.,Yang, L.,Lee, R.B.,Temrikar, Z.H.,Lukka, P.B.,Meibohm, B.,Polikanov, Y.S.,Hobbie, S.N.,Bottger, E.C.,Sander, P.,Lee, R.E. Development of 2nd generation aminomethyl spectinomycins that overcome native efflux in Mycobacterium abscessus. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8UVS 38165935 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with spectinomycin derivative 2694, mRNA, deacylated A- and E-site tRNAphe, and deacylated P-site tRNAmet at 2.75A resolution 2023-11-03 2024-08-07 Phelps, G.A.,Cheramie, M.N.,Fernando, D.M.,Selchow, P.,Meyer, C.J.,Waidyarachchi, S.L.,Dharuman, S.,Liu, J.,Meuli, M.,Molin, M.D.,Killam, B.Y.,Murphy, P.A.,Reeve, S.M.,Wilt, L.A.,Anderson, S.M.,Yang, L.,Lee, R.B.,Temrikar, Z.H.,Lukka, P.B.,Meibohm, B.,Polikanov, Y.S.,Hobbie, S.N.,Bottger, E.C.,Sander, P.,Lee, R.E. Development of 2nd generation aminomethyl spectinomycins that overcome native efflux in Mycobacterium abscessus. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8V9W 38945452 X-ray crystal structure of JGFN4 complexed with fentanyl 2023-12-10 2024-08-07 Gallant, J.P.,Hicks, D.,Shi, K.,Moeller, N.H.,Hoppe, B.,Lake, E.W.,Baehr, C.,Pravetoni, M.,Aihara, H.,LeBeau, A.M. Identification and biophysical characterization of a novel domain-swapped camelid antibody specific for fentanyl. J.Biol.Chem. 2024 300 107502 107502 8V9X 38945452 X-ray crystal structure of JGFN4 complex with fentanyl 2023-12-10 2024-08-07 Gallant, J.P.,Hicks, D.,Shi, K.,Moeller, N.H.,Hoppe, B.,Lake, E.W.,Baehr, C.,Pravetoni, M.,Aihara, H.,LeBeau, A.M. Identification and biophysical characterization of a novel domain-swapped camelid antibody specific for fentanyl. J.Biol.Chem. 2024 300 107502 107502 8VTU 39039256 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with macrolone MCX-66, mRNA, aminoacylated A-site Phe-tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.40A resolution 2024-01-27 2024-08-07 Aleksandrova, E.V.,Ma, C.X.,Klepacki, D.,Alizadeh, F.,Vazquez-Laslop, N.,Liang, J.H.,Polikanov, Y.S.,Mankin, A.S. Macrolones target bacterial ribosomes and DNA gyrase and can evade resistance mechanisms. Nat.Chem.Biol. 2024 20 1680 1690 8VTV 39039256 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with macrolone MCX-91, mRNA, aminoacylated A-site Phe-tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.55A resolution 2024-01-27 2024-08-07 Aleksandrova, E.V.,Ma, C.X.,Klepacki, D.,Alizadeh, F.,Vazquez-Laslop, N.,Liang, J.H.,Polikanov, Y.S.,Mankin, A.S. Macrolones target bacterial ribosomes and DNA gyrase and can evade resistance mechanisms. Nat.Chem.Biol. 2024 20 1680 1690 8VTW 39039256 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with macrolone MCX-128 and protein Y at 2.35A resolution 2024-01-27 2024-08-07 Aleksandrova, E.V.,Ma, C.X.,Klepacki, D.,Alizadeh, F.,Vazquez-Laslop, N.,Liang, J.H.,Polikanov, Y.S.,Mankin, A.S. Macrolones target bacterial ribosomes and DNA gyrase and can evade resistance mechanisms. Nat.Chem.Biol. 2024 20 1680 1690 8VTX 39039256 Crystal structure of the A2058-N6-dimethylated Thermus thermophilus 70S ribosome in complex with macrolone MCX-128, mRNA, aminoacylated A-site Phe-tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.40A resolution 2024-01-27 2024-08-07 Aleksandrova, E.V.,Ma, C.X.,Klepacki, D.,Alizadeh, F.,Vazquez-Laslop, N.,Liang, J.H.,Polikanov, Y.S.,Mankin, A.S. Macrolones target bacterial ribosomes and DNA gyrase and can evade resistance mechanisms. Nat.Chem.Biol. 2024 20 1680 1690 8VTY 39039256 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with ciprofloxacin and protein Y at 2.60A resolution 2024-01-27 2024-08-07 Aleksandrova, E.V.,Ma, C.X.,Klepacki, D.,Alizadeh, F.,Vazquez-Laslop, N.,Liang, J.H.,Polikanov, Y.S.,Mankin, A.S. Macrolones target bacterial ribosomes and DNA gyrase and can evade resistance mechanisms. Nat.Chem.Biol. 2024 20 1680 1690 9B00 39019034 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with berberine analog of chloramphenicol CAM-BER, mRNA, deacylated A- and E-site tRNAphe, and deacylated P-site tRNAmet at 2.80A resolution 2024-03-11 2024-08-07 Batool, Z.,Pavlova, J.A.,Paranjpe, M.N.,Tereshchenkov, A.G.,Lukianov, D.A.,Osterman, I.A.,Bogdanov, A.A.,Sumbatyan, N.V.,Polikanov, Y.S. Berberine analog of chloramphenicol exhibits a distinct mode of action and unveils ribosome plasticity. Structure 2024 32 1429 0 8UFY 39149041 High Resolution structure of A. viridans Lactate Oxidase 2023-10-05 2024-08-14 He, Q.,Wang, C.,Jain, R.,Byrnes, J.,Farquhar, E.R.,Reed, E.,Berezovsky, E.,Chance, M.R.,Lodowski, D.,An, R. An engineered lactate oxidase based electrochemical sensor for continuous detection of biomarker lactic acid in human sweat and serum. Heliyon 2024 10 0 0 8VJU 39117724 Structure of Human Neurolysin in complex with dynorphin A13 peptide 2024-01-08 2024-08-21 Shi, K.,Bagchi, S.,Bickel, J.,Esfahani, S.H.,Yin, L.,Cheng, T.,Karamyan, V.T.,Aihara, H. Structural basis of divergent substrate recognition and inhibition of human neurolysin. Sci Rep 2024 14 18420 18420 8TRI Crystal Structure of Mouse Cadherin-23 EC25-MAD28 F2894A 2023-08-09 2024-08-28 Ashraf, Q.,Sotomayor, M. Crystal Structure of Mouse Cadherin-23 EC25-MAD28 F2894A To be published 0 0 0 0 8TWN 39285206 Crystal structure of nitrile synthase AetD with substrate bound 2023-08-21 2024-08-28 Adak, S.,Ye, N.,Calderone, L.A.,Duan, M.,Lubeck, W.,Schafer, R.J.B.,Lukowski, A.L.,Houk, K.N.,Pandelia, M.E.,Drennan, C.L.,Moore, B.S. A single diiron enzyme catalyses the oxidative rearrangement of tryptophan to indole nitrile. Nat.Chem. 2024 16 1989 1998 8TWW 39285206 Crystal structure of nitrile synthase AetD with substrate bound and cofactor fully assembled 2023-08-21 2024-08-28 Adak, S.,Ye, N.,Calderone, L.A.,Duan, M.,Lubeck, W.,Schafer, R.J.B.,Lukowski, A.L.,Houk, K.N.,Pandelia, M.E.,Drennan, C.L.,Moore, B.S. A single diiron enzyme catalyses the oxidative rearrangement of tryptophan to indole nitrile. Nat.Chem. 2024 16 1989 1998 8TZI 39737929 Human equilibrative nucleoside transporter-1, JH-ENT-01 bound 2023-08-26 2024-08-28 Wright, N.J.,Matsuoka, Y.,Park, H.,He, W.,Webster, C.G.,Furutani, K.,Fedor, J.G.,McGinnis, A.,Zhao, Y.,Chen, O.,Bang, S.,Fan, P.,Spasojevic, I.,Hong, J.,Ji, R.R.,Lee, S.Y. Design of an equilibrative nucleoside transporter subtype 1 inhibitor for pain relief. Nat Commun 2024 15 10738 10738 8T8T 40403170 Crystal structure of TET25 in complex with PyDH2 ligand in P212121 space group 2023-06-23 2024-09-04 Martin, K.N.,Lam, G.,Reznichenko, O.,Brunner, K.E.,Zdilla, M.J.,McCarthy, S.E.,Granzhan, A.,Yatsunyk, L.A. Conformational Change in a Four-Tetrad DNA G-Quadruplex upon Intercalation of a Small-Molecule Ligand PyDH2. Angew.Chem.Int.Ed.Engl. 2025 64 0 0 8VHN 39164005 Crystal Structure of E. coli class Ia ribonucleotide reductase alpha subunit bound to two ATP molecules 2024-01-02 2024-09-04 Funk, M.A.,Zimanyi, C.M.,Andree, G.A.,Hamilos, A.E.,Drennan, C.L. How ATP and dATP Act as Molecular Switches to Regulate Enzymatic Activity in the Prototypical Bacterial Class Ia Ribonucleotide Reductase. Biochemistry 2024 63 2517 2531 8VHO 39164005 Crystal Structure of E. coli class Ia ribonucleotide reductase alpha subunit bound to dATP 2024-01-02 2024-09-04 Funk, M.A.,Zimanyi, C.M.,Andree, G.A.,Hamilos, A.E.,Drennan, C.L. How ATP and dATP Act as Molecular Switches to Regulate Enzymatic Activity in the Prototypical Bacterial Class Ia Ribonucleotide Reductase. Biochemistry 2024 63 2517 2531 8VHP 39164005 Crystal structure of E. coli class Ia ribonucleotide reductase alpha subunit W28A variant bound to CDP and two molecules of ATP 2024-01-02 2024-09-04 Funk, M.A.,Zimanyi, C.M.,Andree, G.A.,Hamilos, A.E.,Drennan, C.L. How ATP and dATP Act as Molecular Switches to Regulate Enzymatic Activity in the Prototypical Bacterial Class Ia Ribonucleotide Reductase. Biochemistry 2024 63 2517 2531 8VHQ 39164005 Crystal structure of E. coli class Ia ribonucleotide reductase alpha subunit W28A variant bound to dATP and ATP 2024-01-02 2024-09-04 Funk, M.A.,Zimanyi, C.M.,Andree, G.A.,Hamilos, A.E.,Drennan, C.L. How ATP and dATP Act as Molecular Switches to Regulate Enzymatic Activity in the Prototypical Bacterial Class Ia Ribonucleotide Reductase. Biochemistry 2024 63 2517 2531 8VHR 39164005 Crystal structure of E. coli class Ia ribonucleotide reductase alpha subunit W28A variant bound to dATP and GTP 2024-01-02 2024-09-04 Funk, M.A.,Zimanyi, C.M.,Andree, G.A.,Hamilos, A.E.,Drennan, C.L. How ATP and dATP Act as Molecular Switches to Regulate Enzymatic Activity in the Prototypical Bacterial Class Ia Ribonucleotide Reductase. Biochemistry 2024 63 2517 2531 8VHU 39164005 Crystal structure of dATP bound E. coli class Ia ribonucleotide reductase alpha construct fused with the C-terminal tail of E. coli class Ia beta subunit 2024-01-02 2024-09-04 Funk, M.A.,Zimanyi, C.M.,Andree, G.A.,Hamilos, A.E.,Drennan, C.L. How ATP and dATP Act as Molecular Switches to Regulate Enzymatic Activity in the Prototypical Bacterial Class Ia Ribonucleotide Reductase. Biochemistry 2024 63 2517 2531 9AUR 39178230 Crystal structure of loop-closed A21 2'-OMe dumbbell RNA bridged by glycine 2024-02-29 2024-09-04 Radakovic, A.,Lewicka, A.,Todisco, M.,Aitken, H.R.M.,Weiss, Z.,Kim, S.,Bannan, A.,Piccirilli, J.A.,Szostak, J.W. A potential role for RNA aminoacylation prior to its role in peptide synthesis. Proc.Natl.Acad.Sci.USA 2024 121 0 0 9AUS 39178230 Crystal structure of loop-closed dumbbell RNA bridged by glycine 2024-02-29 2024-09-04 Radakovic, A.,Lewicka, A.,Todisco, M.,Aitken, H.R.M.,Weiss, Z.,Kim, S.,Bannan, A.,Piccirilli, J.A.,Szostak, J.W. A potential role for RNA aminoacylation prior to its role in peptide synthesis. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8U1A De novo Design of Near Infrared Fluorescent Proteins 2023-08-31 2024-09-11 Xu, C.,Liu, Y.,Baker, D. De novo Design of Near Infrared Fluorescent Proteins To Be Published 0 0 0 0 9DQS 40193706 Structure of Tudor domain from Mycobacterium smegmatis UvrD1 2024-09-24 2024-10-16 Warren, G.M.,Shuman, S. In vivo nucleotide excision repair by mycobacterial UvrD1 requires ATP hydrolysis but does not depend on cysteine disulfide-mediated dimerization and DNA unwinding. Nucleic Acids Res. 2025 53 0 0 8US0 38168412 Human antibody S8V1-157 in complex with the A/American black duck/New Brunswick/00464/2010(H4N6) HA head domain 2023-10-27 2024-10-30 Simmons, H.C.,Finney, J.,Kotaki, R.,Adachi, Y.,Park Moseman, A.,Watanabe, A.,Song, S.,Robinson-McCarthy, L.R.,Le Sage, V.,Kuraoka, M.,Moseman, E.A.,Kelsoe, G.,Takahashi, Y.,McCarthy, K.R. A protective and broadly binding antibody class engages the influenza virus hemagglutinin head at its stem interface. Biorxiv 2024 0 0 0 9C8C 39437336 Structure of proline utilization A with the FAD covalently-modified by propanal resulting from inactivation with N-allylglycine 2024-06-12 2024-10-30 Tanner, J.J.,Ji, J.,Bogner, A.N.,Scott, G.K.,Patel, S.M.,Seravalli, J.,Gates, K.S.,Benz, C.C.,Becker, D.F. Noncovalent Inhibition and Covalent Inactivation of Proline Dehydrogenase by Analogs of N -Propargylglycine. Biochemistry 2024 63 2855 2867 9CKJ Co-crystal structure of 53BP1 tandem Tudor domains in complex with UNC9512 2024-07-09 2024-10-30 Zeng, H.,Dong, A.,Shell, D.J.,Foley, C.,Arrowsmith, C.H.,Edwards, A.M.,Halabelian, L. Co-crystal structure of 53BP1 tandem Tudor domains in complex with UNC9512 To be published 0 0 0 0 8TFD 39380503 Crystal structure of a stem-loop DNA aptamer complexed with SARS-CoV-2 nucleocapsid protein RNA-binding domain 2023-07-10 2024-11-13 Esler, M.A.,Belica, C.A.,Rollie, J.A.,Brown, W.L.,Moghadasi, S.A.,Shi, K.,Harki, D.A.,Harris, R.S.,Aihara, H. A compact stem-loop DNA aptamer targets a uracil-binding pocket in the SARS-CoV-2 nucleocapsid RNA-binding domain. Nucleic Acids Res. 2024 52 13138 13151 9D7T 39415050 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with Api137 antimicrobial peptide, mRNA, A-site release factor 1, and deacylated P-site and E-site tRNAphe at 2.70A resolution 2024-08-17 2024-11-13 Huang, W.,Baliga, C.,Aleksandrova, E.V.,Atkinson, G.,Polikanov, Y.S.,Vazquez-Laslop, N.,Mankin, A.S. Activity, structure, and diversity of Type II proline-rich antimicrobial peptides from insects. Embo Rep. 2024 25 5194 5211 8UQF Crystal structure of designed cortisol-binding protein hcy129_mpnn5 2023-10-23 2024-11-20 Lee, G.R.,Pellock, S.J.,Norn, C.,Tischer, D.,Dauparas, J.,Anischenko, I.,Mercer, J.A.M.,Kang, A.,Bera, A.,Nguyen, H.,Goreshnik, I.,Vafeados, D.,Roullier, N.,Han, H.L.,Coventry, B.,Liu, D.R.,Yeh, A.H.W. Small molecule binding and sensing with a designed protein family To Be Published 0 0 0 0 9D0J 40055575 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with BT-33, mRNA, deacylated A-site tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.50A resolution 2024-08-07 2024-11-20 Tresco, B.I.C.,Wu, K.J.Y.,Ramkissoon, A.,Aleksandrova, E.V.,Purdy, M.,See, D.N.Y.,Liu, R.Y.,Polikanov, Y.S.,Myers, A.G. Discovery of a fluorinated macrobicyclic antibiotic through chemical synthesis. Nat.Chem. 2025 17 582 589 8GM8 Crystal structure of shark nonclassical MHC CLASS I, UFA 2023-03-24 2024-11-27 Castro, C.D.,Adams, E.J. Characterization of Shark CD1 Establishes Its Presence in the Primordial MHC To Be Published 0 0 0 0 8T0W 39531498 Crystal structure of dimethylsulfone (DMSO2) monooxygenase SfnG from Pseudomonas fluorescens with DMSO2 and oxidized FMN bound 2023-06-01 2024-11-27 Gonzalez, R.,Soule, J.,Phan, N.,Wicht, D.K.,Dowling, D.P. Structural, biophysical, and biochemical insights into C-S bond cleavage by dimethylsulfone monooxygenase. Proc.Natl.Acad.Sci.USA 2024 121 0 0 8V0D 39121852 Ubch5B-RING3 of MIB1 fusion structure 2023-11-17 2024-11-27 Cao, R.,Gozlan, O.,Airich, A.,Tveriakhina, L.,Zhou, H.,Jiang, H.,Cole, P.A.,Aster, J.C.,Klein, T.,Sprinzak, D.,Blacklow, S.C. Structural requirements for activity of Mind bomb1 in Notch signaling. Structure 2024 32 1667 0 9AV0 39207111 Crystal structure of S. aureus GuaB dCBS with inhibitor GNE2011 2024-03-01 2024-11-27 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9BZC Cocrystal structure of Clostridium beijerinckii ZTP riboswitch with ZMP and Cs 2024-05-24 2024-11-27 Jones, C.P.,Tran, B.,Ferre-D'Amare, A.R. Cocrystal structure of Clostridium beijerinckii ZTP riboswitch with ZMP and Cs To Be Published 0 0 0 0 9D28 39527408 Crystal structure of (+)-sabinene synthase from Thuja plicata 2024-08-08 2024-11-27 Gaynes, M.N.,Osika, K.R.,Christianson, D.W. Structure and Function of Sabinene Synthase, a Monoterpene Cyclase That Generates a Highly Strained [3.1.0] Bicyclic Product. Biochemistry 2024 63 3147 3159 9ASG 39833157 Crystal structure of HLA-A*03:01 in complex with a mutant PIK3CA peptide analogue (Trp-6 Bta) 2024-02-25 2024-12-11 Ma, J.,Ayres, C.M.,Brambley, C.A.,Chandran, S.S.,Rosales, T.J.,Perera, W.W.J.G.,Eldaly, B.,Murray, W.T.,Corcelli, S.A.,Kovrigin, E.L.,Klebanoff, C.A.,Baker, B.M. Dynamic allostery in the peptide/MHC complex enables TCR neoantigen selectivity. Nat Commun 2025 16 849 849 8V39 39642212 Crystal structure of active KRAS-G12C (GMPPNP-bound) in complex with BBO-8520 2023-11-27 2024-12-18 Maciag, A.E.,Stice, J.P.,Wang, B.,Sharma, A.K.,Chan, A.H.,Lin, K.,Singh, D.,Dyba, M.,Yang, Y.,Setoodeh, S.,Smith, B.P.,Ju, J.H.,Jeknic, S.,Rabara, D.,Zhang, Z.,Larsen, E.K.,Esposito, D.,Denson, J.P.,Ranieri, M.,Meynardie, M.,Mehdizadeh, S.,Alexander, P.A.,Abreu Blanco, M.,Turner, D.M.,Xu, R.,Lightstone, F.C.,Wong, K.K.,Stephen, A.G.,Wang, K.,Simanshu, D.K.,Sinkevicius, K.W.,Nissley, D.V.,Wallace, E.,McCormick, F.,Beltran, P.J. Discovery of BBO-8520, a First-In-Class Direct and Covalent Dual Inhibitor of GTP-Bound (ON) and GDP-Bound (OFF) KRASG12C. Cancer Discov 2025 15 578 594 8V3A 39642212 Crystal structure of KRAS-G12C (GDP-bound) in complex with BBO-8520 2023-11-27 2024-12-18 Maciag, A.E.,Stice, J.P.,Wang, B.,Sharma, A.K.,Chan, A.H.,Lin, K.,Singh, D.,Dyba, M.,Yang, Y.,Setoodeh, S.,Smith, B.P.,Ju, J.H.,Jeknic, S.,Rabara, D.,Zhang, Z.,Larsen, E.K.,Esposito, D.,Denson, J.P.,Ranieri, M.,Meynardie, M.,Mehdizadeh, S.,Alexander, P.A.,Abreu Blanco, M.,Turner, D.M.,Xu, R.,Lightstone, F.C.,Wong, K.K.,Stephen, A.G.,Wang, K.,Simanshu, D.K.,Sinkevicius, K.W.,Nissley, D.V.,Wallace, E.,McCormick, F.,Beltran, P.J. Discovery of BBO-8520, a First-In-Class Direct and Covalent Dual Inhibitor of GTP-Bound (ON) and GDP-Bound (OFF) KRASG12C. Cancer Discov 2025 15 578 594 8UDQ 39747827 Crystal structure of SARS-CoV-2 3CL protease with inhibitor 1 2023-09-28 2024-12-25 Liu, H.,Zask, A.,Forouhar, F.,Iketani, S.,Williams, A.,Vaz, D.R.,Habashi, D.,Choi, K.,Resnick, S.J.,Hong, S.J.,Lovett, D.H.,Bai, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of small molecule non-covalent coronavirus 3CL protease inhibitors from DNA-encoded chemical library screening. Nat Commun 2025 16 152 152 8UDW 39747827 Crystal structure of SARS-CoV-2 3CL protease with inhibitor 2 2023-09-29 2024-12-25 Liu, H.,Zask, A.,Forouhar, F.,Iketani, S.,Williams, A.,Vaz, D.R.,Habashi, D.,Choi, K.,Resnick, S.J.,Hong, S.J.,Lovett, D.H.,Bai, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of small molecule non-covalent coronavirus 3CL protease inhibitors from DNA-encoded chemical library screening. Nat Commun 2025 16 152 152 9E83 40973081 TMPRSS2 crystal structure following acylation by UCSF_157 2024-11-04 2024-12-25 Fraser, B.J.,Young, N.J.,Bender, B.J.,Gahbauer, S.,Ilyassov, O.,Wilson, R.P.,Li, Y.,Seitova, A.,Lourenco, A.L.,Chung, D.H.,Bardine, C.,Benard, F.,Shoichet, B.K.,Craik, C.S.,Arrowsmith, C.H. Large Library Docking and Biophysical Analysis of Small-Molecule TMPRSS2 Inhibitors. J.Med.Chem. 2025 68 19893 19907 8UDO 39747827 Crystal structure of SARS-CoV-2 3CL protease with inhibitor 15 2023-09-28 2025-01-01 Liu, H.,Zask, A.,Forouhar, F.,Iketani, S.,Williams, A.,Vaz, D.R.,Habashi, D.,Choi, K.,Resnick, S.J.,Hong, S.J.,Lovett, D.H.,Bai, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of small molecule non-covalent coronavirus 3CL protease inhibitors from DNA-encoded chemical library screening. Nat Commun 2025 16 152 152 8UDP 39747827 Crystal structure of SARS-CoV-2 3CL protease with inhibitor 14 2023-09-28 2025-01-01 Liu, H.,Zask, A.,Forouhar, F.,Iketani, S.,Williams, A.,Vaz, D.R.,Habashi, D.,Choi, K.,Resnick, S.J.,Hong, S.J.,Lovett, D.H.,Bai, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of small molecule non-covalent coronavirus 3CL protease inhibitors from DNA-encoded chemical library screening. Nat Commun 2025 16 152 152 8UDX 39747827 Crystal structure of SARS-CoV-2 3CL protease with C145 sulfinic acid in complex with inhibitor 17 2023-09-29 2025-01-01 Liu, H.,Zask, A.,Forouhar, F.,Iketani, S.,Williams, A.,Vaz, D.R.,Habashi, D.,Choi, K.,Resnick, S.J.,Hong, S.J.,Lovett, D.H.,Bai, T.,Chavez, A.,Ho, D.D.,Stockwell, B.R. Development of small molecule non-covalent coronavirus 3CL protease inhibitors from DNA-encoded chemical library screening. Nat Commun 2025 16 152 152 9BCJ 39739808 Crystal structure of human hemoglobin in complex with the HbpA receptor from Corynebacterium diphtheriae 2024-04-09 2025-01-08 Mahoney, B.J.,Lyman, L.R.,Ford, J.,Soule, J.,Cheung, N.A.,Goring, A.K.,Ellis-Guardiola, K.,Collazo, M.J.,Cascio, D.,Ton-That, H.,Schmitt, M.P.,Clubb, R.T. Molecular basis of hemoglobin binding and heme removal in Corynebacterium diphtheriae. Proc.Natl.Acad.Sci.USA 2025 122 0 0 8VGU Crystal structure of BcTSPO/Hematin complex 2023-12-28 2025-01-15 Qiu, W.,Guo, Y.,Hendrickson, W.A. Crystal structure of BcTSPO complexed with hematin PNAS 0 0 0 0 9AUW 39207111 Crystal structure of A. baumannii GuaB dCBS with inhibitor GNE9979 2024-03-01 2025-01-15 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9AUX 39207111 Crystal structure of A. baumannii GuaB dCBS with inhibitor GNE2011 2024-03-01 2025-01-15 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9AUY 39207111 Crystal structure of S. aureus GuaB dCBS with inhibitor GNE9123 2024-03-01 2025-01-15 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9AUZ 39207111 Crystal structure of S. aureus GuaB dCBS with inhibitor GNE9979 2024-03-01 2025-01-15 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9AV1 39207111 Crystal structure of E. coli GuaB dCBS with inhibitor GNE9123 2024-03-01 2025-01-15 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9AV2 39207111 Crystal structure of E. coli GuaB dCBS with inhibitor GNE9979 2024-03-01 2025-01-15 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9AV3 39207111 Crystal structure of E. coli GuaB dCBS with inhibitor GNE2011 2024-03-01 2025-01-15 Kofoed, E.M.,Aliagas, I.,Crawford, T.,Mao, J.,Harris, S.F.,Xu, M.,Wang, S.,Wu, P.,Ma, F.,Clark, K.,Sims, J.,Xu, Y.,Peng, Y.,Skippington, E.,Yang, Y.,Reeder, J.,Ubhayakar, S.,Baumgardner, M.,Yan, Z.,Chen, J.,Park, S.,Zhang, H.,Yen, C.-W.,Lorenzo, M.,Skelton, N.,Liang, X.,Chen, L.,Hoag, B.,Li, C.S.,Liu, Z.,Wai, J.,Liu, X.,Liang, J.,Tan, M.W. Discovery of GuaB inhibitors with efficacy against Acinetobacter baumannii infection. Mbio 2024 15 0 0 9CO2 39379361 Crystal structure of BamA in complex with the PTB2 open-state inhibitor (anisotropic data set) 2024-07-16 2025-01-15 Sun, D.,Storek, K.M.,Tegunov, D.,Yang, Y.,Arthur, C.P.,Johnson, M.,Quinn, J.G.,Liu, W.,Han, G.,Girgis, H.S.,Alexander, M.K.,Murchison, A.K.,Shriver, S.,Tam, C.,Ijiri, H.,Inaba, H.,Sano, T.,Yanagida, H.,Nishikawa, J.,Heise, C.E.,Fairbrother, W.J.,Tan, M.W.,Skelton, N.,Sandoval, W.,Sellers, B.D.,Ciferri, C.,Smith, P.A.,Reid, P.C.,Cunningham, C.N.,Rutherford, S.T.,Payandeh, J. The discovery and structural basis of two distinct state-dependent inhibitors of BamA. Nat Commun 2024 15 8718 8718 9B4S 39788953 Crystal structure of the RRAS2-p110alpha complex 2024-03-21 2025-01-22 Czyzyk, D.,Yan, W.,Messing, S.,Gillette, W.,Tsuji, T.,Yamaguchi, M.,Furuzono, S.,Turner, D.M.,Esposito, D.,Nissley, D.V.,McCormick, F.,Simanshu, D.K. Structural insights into isoform-specific RAS-PI3K alpha interactions and the role of RAS in PI3K alpha activation. Nat Commun 2025 16 525 525 9BZ4 39899710 Crystal structure of the C2 and GAP domains of human p120RasGAP 2024-05-24 2025-01-22 Paul, M.E.,Chen, D.,Vish, K.J.,Lartey, N.L.,Hughes, E.,Freeman, Z.T.,Saunders, T.L.,Stiegler, A.L.,King, P.D.,Boggon, T.J. The C2 domain augments Ras GTPase-activating protein catalytic activity. Proc.Natl.Acad.Sci.USA 2025 122 0 0 9CS7 39880956 Structure of Azospirillum bacterial CARD crystal form 1 2024-07-23 2025-01-29 Wein, T.,Millman, A.,Lange, K.,Yirmiya, E.,Hadary, R.,Garb, J.,Melamed, S.,Amitai, G.,Dym, O.,Steinruecke, F.,Hill, A.B.,Kranzusch, P.J.,Sorek, R. CARD domains mediate anti-phage defence in bacterial gasdermin systems. Nature 2025 639 727 734 9CS8 39880956 Structure of Azospirillum bacterial CARD crystal form 2 2024-07-23 2025-01-29 Wein, T.,Millman, A.,Lange, K.,Yirmiya, E.,Hadary, R.,Garb, J.,Melamed, S.,Amitai, G.,Dym, O.,Steinruecke, F.,Hill, A.B.,Kranzusch, P.J.,Sorek, R. CARD domains mediate anti-phage defence in bacterial gasdermin systems. Nature 2025 639 727 734 8VUO 40220753 Crystal structure of SARS-CoV-2 nsp16/nsp10 in complex with Cap-1 RNA 2024-01-29 2025-02-05 Misra, A.,Rahisuddin, R.,Parihar, M.,Arya, S.,Viswanathan, T.,Jackson, N.,Qi, S.,Chan, S.H.,Harris, R.S.,Martinez-Sobrido, L.,Gupta, Y.K. Structural insights into the assembly and regulation of 2'-O RNA methylation by SARS-CoV-2 nsp16/nsp10. Structure 2025 33 1027 0 9AWE 39865354 The crystal structure of an engineered Protein GF with Human Kappa Fab 2024-03-05 2025-02-05 Slezak, T.,O'Leary, K.M.,Li, J.,Rohaim, A.,Davydova, E.K.,Kossiakoff, A.A. Engineered protein G variants for multifunctional antibody-based assemblies. Protein Sci. 2025 34 0 0 9CCK 39823305 Multi-copper oxidase with a C-terminal cupredoxin domain from Nitrosopumilus maritimus 2024-06-21 2025-02-05 Voland, R.W.,Wang, H.,Abruna, H.D.,Lancaster, K.M. Nitrous oxide production via enzymatic nitroxyl from the nitrifying archaeon Nitrosopumilus maritimus. Proc.Natl.Acad.Sci.USA 2025 122 0 0 9CQ5 39094246 Mn-bound RuBisCO from spinach with CABP inhibitor 2024-07-19 2025-02-05 Voland, R.W.,Coleman, R.E.,Lancaster, K.M. The structure of Mn(II)-bound Rubisco from Spinacia oleracea. J.Inorg.Biochem. 2024 260 112682 112682 9DM6 39946728 Crystal Structure of Danio rerio histone deacetylase 6 catalytic domain 2 complexed with an ethylhydrazide inhibitor 2024-09-12 2025-02-26 Stopper, D.,Biermann, L.,Watson, P.R.,Li, J.,Konig, B.,Gaynes, M.N.,Pessanha de Carvalho, L.,Klose, J.,Hanl, M.,Hamacher, A.,Schaker-Hubner, L.,Ramsbeck, D.,Held, J.,Christianson, D.W.,Kassack, M.U.,Hansen, F.K. Exploring Alternative Zinc-Binding Groups in Histone Deacetylase (HDAC) Inhibitors Uncovers DS-103 as a Potent Ethylhydrazide-Based HDAC Inhibitor with Chemosensitizing Properties. J.Med.Chem. 2025 68 4426 4452 9DEL 39983720 USP7 in complex with macrocycle MC03 2024-08-29 2025-03-05 Miranda, R.,Anson, F.,Smith, S.T.,Ultsch, M.,Tenorio, C.A.,Rouge, L.,Farrell, B.,Adaligil, E.,Holden, J.K.,Harris, S.F.,Dueber, E.C. Discovery and characterization of potent macrocycle inhibitors of ubiquitin-specific protease-7. Structure 2025 33 705 0 9B9F 40011426 Zebrafish Betaglycan Orphan Domain (zfBGo) in complex with TGF-B3 and extracellular domains of TGFBRI and TGFBRII 2024-04-02 2025-03-12 Wieteska, L.,Taylor, A.B.,Punch, E.,Coleman, J.A.,Conway, I.O.,Lin, Y.F.,Byeon, C.H.,Hinck, C.S.,Krzysiak, T.,Ishima, R.,Lopez-Casillas, F.,Cherepanov, P.,Bernard, D.J.,Hill, C.S.,Hinck, A.P. Structures of TGF-beta with betaglycan and signaling receptors reveal mechanisms of complex assembly and signaling. Nat Commun 2025 16 1778 1778 8U38 40250427 Structure of a bacterial multi-ubiquitin domain protein 2023-09-07 2025-04-09 Gong, M.,Ye, Q.,Gu, Y.,Chambers, L.R.,Bobkov, A.A.,Arakawa, N.K.,Matyszewski, M.,Corbett, K.D. Structural diversity and oligomerization of bacterial ubiquitin-like proteins. Structure 2025 33 1016 0 9DTD Crystal Structure of C2-01018 2024-09-30 2025-04-23 Schlichthaerle, T.,Baker, D. De novo design of TrkA specific agonists To Be Published 0 0 0 0 9DTE Crystal Structure of C2-02802 2024-09-30 2025-04-23 Schlichthaerle, T.,Baker, D. De novo design of TrkA specific agonists To Be Published 0 0 0 0 8V3E 40307559 Structure of Myroides odoratus phage Tad2 in apo state 2023-11-27 2025-04-30 Sabonis, D.,Avraham, C.,Chang, R.B.,Lu, A.,Herbst, E.,Silanskas, A.,Vilutis, D.,Leavitt, A.,Yirmiya, E.,Toyoda, H.C.,Ruksenaite, A.,Zaremba, M.,Osterman, I.,Amitai, G.,Kranzusch, P.J.,Sorek, R.,Tamulaitiene, G. TIR domains produce histidine-ADPR as an immune signal in bacteria. Nature 2025 642 467 473 9C7Z 40450691 Hallucinated C3 protein assembly HALC3_919 2024-06-11 2025-05-21 Ragotte, R.J.,Tortorici, M.A.,Catanzaro, N.J.,Addetia, A.,Coventry, B.,Froggatt, H.M.,Lee, J.,Stewart, C.,Brown, J.T.,Goreshnik, I.,Sims, J.N.,Milles, L.F.,Wicky, B.I.M.,Glogl, M.,Gerben, S.,Kang, A.,Bera, A.K.,Sharkey, W.,Schafer, A.,Harkema, J.R.,Baric, R.S.,Baker, D.,Veesler, D. Designed miniproteins potently inhibit and protect against MERS-CoV. Cell Rep 2025 44 115760 115760 9MFG 40434646 Complex of IL23 receptor and VHH 2024-12-09 2025-05-21 Ota, N.,Davies, C.W.,Kang, J.,Yan, D.,Scherl, A.,Wong, A.,Cook, R.,Tao, X.,Dunlap, D.,Klabunde, S.,Mantik, P.,Mohanan, V.,Lin, W.,McBride, J.,Sadekar, S.,Storek, K.M.,Lupardus, P.,Ye, Z.,Ackerly Wallweber, H.,Kiefer, J.R.,Xu, M.,Chan, P.,Nagapudi, K.,Yi, T.,Koerber, J.T. Engineering a protease-stable, oral single-domain antibody to inhibit IL-23 signaling. Proc.Natl.Acad.Sci.USA 2025 122 0 0 9C35 40738191 Proline utilization A with the covalent acyl-enzyme intermediate in the aldehyde dehydrogenase active site 2024-05-31 2025-06-04 Buckley, D.P.,Becker, D.F.,Tanner, J.J. Visualization of covalent intermediates and conformational states of proline utilization A by X-ray crystallography and molecular dynamics simulations. J.Biol.Chem. 2025 301 110532 110532 9JGM 40252020 The Escherichia coli yybp riboswitch as a tandem riboswitch regulated by Mn2+ and pH 2024-09-08 2025-06-04 Xiao, W.,Liu, G.,Chen, T.,Zhang, Y.,Ke, A.,Cai, R.,Lu, C. Escherichia coli yybP-ykoY Riboswitch as a Tandem Riboswitch Regulated by Mn 2+ and pH. Acs Chem.Biol. 2025 20 1010 1019 8VQV 40310613 Structure of S. odontolytica ZTP riboswitch bound to m-1-pyridinyl-AICA 2024-01-19 2025-06-11 Fullenkamp, C.R.,Mehdi, S.,Jones, C.P.,Tenney, L.,Pichling, P.,Prestwood, P.R.,Ferre-D'Amare, A.R.,Tiwary, P.,Schneekloth, J.S. Machine Learning-Augmented Molecular Dynamics Simulations (MD) Reveal Insights Into the Disconnect Between Affinity and Activation of ZTP Riboswitch Ligands. Angew.Chem.Int.Ed.Engl. 2025 64 0 0 8VVJ 40310613 Structure of S. odontolytica ZTP riboswitch bound to m-1-pyridinyl-AICA 2024-01-31 2025-06-11 Fullenkamp, C.R.,Mehdi, S.,Jones, C.P.,Tenney, L.,Pichling, P.,Prestwood, P.R.,Ferre-D'Amare, A.R.,Tiwary, P.,Schneekloth, J.S. Machine Learning-Augmented Molecular Dynamics Simulations (MD) Reveal Insights Into the Disconnect Between Affinity and Activation of ZTP Riboswitch Ligands. Angew.Chem.Int.Ed.Engl. 2025 64 0 0 9MTP 40536958 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with mRNA, A-site Q230-N5-methylated Release Factor 1, and P-site fMEAAAKC-peptidyl-tRNAcys at 2.40A resolution 2025-01-12 2025-06-18 Aleksandrova, E.V.,Syroegin, E.A.,Basu, R.S.,Vassilevski, A.A.,Gagnon, M.G.,Polikanov, Y.S. Mechanism of release factor-mediated peptidyl-tRNA hydrolysis on the ribosome. Science 2025 388 0 0 9MTQ 40536958 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with mRNA, A-site GGD-mutant Release Factor 1, and P-site fMEAAAKC-peptidyl-tRNAcys at 2.55A resolution 2025-01-12 2025-06-18 Aleksandrova, E.V.,Syroegin, E.A.,Basu, R.S.,Vassilevski, A.A.,Gagnon, M.G.,Polikanov, Y.S. Mechanism of release factor-mediated peptidyl-tRNA hydrolysis on the ribosome. Science 2025 388 0 0 9MTT 40536958 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with mRNA, A-site Q230-N5-methylated Release Factor 1, and P-site deacylated-tRNAcys at 2.60A resolution 2025-01-12 2025-06-18 Aleksandrova, E.V.,Syroegin, E.A.,Basu, R.S.,Vassilevski, A.A.,Gagnon, M.G.,Polikanov, Y.S. Mechanism of release factor-mediated peptidyl-tRNA hydrolysis on the ribosome. Science 2025 388 0 0 9O3H 40502108 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with macrolide erythromycin, mRNA, aminoacylated A-site Lys-tRNAlys, P-site fMRC-peptidyl-tRNAmet, and deacylated E-site tRNAlys at 2.65A resolution 2025-04-07 2025-06-25 Syroegin, E.A.,Aleksandrova, E.V.,Kruglov, A.A.,Paranjpe, M.N.,Svetlov, M.S.,Polikanov, Y.S. Structural insights into context-specific inhibition of bacterial translation by macrolides. Biorxiv 2025 0 0 0 9O3I 40502108 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with ketolide telithromycin, mRNA, aminoacylated A-site Lys-tRNAlys, P-site fMRC-peptidyl-tRNAmet, and deacylated E-site tRNAlys at 2.80A resolution 2025-04-07 2025-06-25 Syroegin, E.A.,Aleksandrova, E.V.,Kruglov, A.A.,Paranjpe, M.N.,Svetlov, M.S.,Polikanov, Y.S. Structural insights into context-specific inhibition of bacterial translation by macrolides. Biorxiv 2025 0 0 0 9O3J 40502108 Crystal structure of the wild-type drug-free Thermus thermophilus 70S ribosome in complex with mRNA, aminoacylated A-site Lys-tRNAlys, P-site fMRC-peptidyl-tRNAmet, and deacylated E-site tRNAlys at 2.60A resolution 2025-04-07 2025-06-25 Syroegin, E.A.,Aleksandrova, E.V.,Kruglov, A.A.,Paranjpe, M.N.,Svetlov, M.S.,Polikanov, Y.S. Structural insights into context-specific inhibition of bacterial translation by macrolides. Biorxiv 2025 0 0 0 9O3K 40502108 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with macrolide erythromycin, mRNA, aminoacylated A-site Lys-tRNAlys, P-site fMAC-peptidyl-tRNAmet, and deacylated E-site tRNAlys at 2.70A resolution 2025-04-07 2025-06-25 Syroegin, E.A.,Aleksandrova, E.V.,Kruglov, A.A.,Paranjpe, M.N.,Svetlov, M.S.,Polikanov, Y.S. Structural insights into context-specific inhibition of bacterial translation by macrolides. Biorxiv 2025 0 0 0 9O3L 40502108 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with macrolide erythromycin, mRNA, deacylated A-site tRNAphe, P-site fMRC-peptidyl-tRNAmet, and deacylated E-site tRNAphe at 2.75A resolution 2025-04-07 2025-06-25 Syroegin, E.A.,Aleksandrova, E.V.,Kruglov, A.A.,Paranjpe, M.N.,Svetlov, M.S.,Polikanov, Y.S. Structural insights into context-specific inhibition of bacterial translation by macrolides. Biorxiv 2025 0 0 0 9CHL 40671524 P. vulgaris tetrameric HigBA- operator 2 DNA 2024-07-01 2025-07-02 Pavelich, I.J.,Schureck, M.A.,Srinivas, P.,Blackburn, T.M.,Wang, D.,Hoffer, E.D.,Boamah, M.,Zaldana, K.,Onuoha, N.,Miles, S.J.,Grabowicz, M.,Okafor, C.D.,Dunham, C.M. Antitoxin control of optimal transcriptional repression in the atypical HigB-HigA toxin-antitoxin system from Proteus vulgaris. Nucleic Acids Res. 2025 53 0 0 9CJO 40454888 X-ray crystal structure of SARS-CoV-2 main protease quadruple mutants 2024-07-07 2025-07-09 Esler, M.A.,Shi, K.,Rollie, J.A.,Delgado, R.,Vishwakarma, J.,Dabrowska, A.,Prahlad, J.,Moghadasi, S.A.,Harris, R.S.,Aihara, H. Structural basis for varying drug resistance of SARS-CoV-2 M pro E166 variants. Mbio 2025 16 0 0 9CJP 40454888 X-ray crystal structure of SARS-CoV-2 main protease quadruple mutants in complex with Nirmatrelvir 2024-07-07 2025-07-09 Esler, M.A.,Shi, K.,Rollie, J.A.,Delgado, R.,Vishwakarma, J.,Dabrowska, A.,Prahlad, J.,Moghadasi, S.A.,Harris, R.S.,Aihara, H. Structural basis for varying drug resistance of SARS-CoV-2 M pro E166 variants. Mbio 2025 16 0 0 9CJQ 40454888 X-ray crystal structure of SARS-CoV-2 main protease quadruple mutants in complex with Ensitrelvir 2024-07-07 2025-07-09 Esler, M.A.,Shi, K.,Rollie, J.A.,Delgado, R.,Vishwakarma, J.,Dabrowska, A.,Prahlad, J.,Moghadasi, S.A.,Harris, R.S.,Aihara, H. Structural basis for varying drug resistance of SARS-CoV-2 M pro E166 variants. Mbio 2025 16 0 0 9E9Q 40527531 SARS-CoV-2 SL5 crystal structure native 2024-11-08 2025-07-09 Jones, C.P.,Ferre-D'Amare, A.R. Crystallographic and cryoEM analyses reveal SARS-CoV-2 SL5 is a mobile T-shaped four-way junction with deep pockets. Rna 2025 31 949 960 8V9S 41312769 Distinct Quaternary States, Intermediates, and Autoinhibition During Loading of the DnaB-Replicative Helicase by the Phage Lambda P Helicase Loader 2023-12-09 2025-07-16 Shatarupa, A.,Brown, D.,Olinares, P.D.B.,Chase, J.,Isiorho, E.,Chait, B.T.,Jeruzalmi, D. Distinct quaternary states, intermediates, and autoinhibition during loading of the DnaB-replicative helicase by the phage lambda P helicase loader. Nucleic Acids Res. 2025 53 0 0 9CS5 E. Coli AMTB with bound Xe ions 2024-07-23 2025-07-30 Vahedi-Faridi, A.,Kowatz, T.,Lodowski, D.T. E. Coli AMTB with bound Xe ions To Be Published 0 0 0 0 9MUG 40829932 Structure of Schistosoma mansoni Hop1 chromatin binding region 2025-01-13 2025-08-13 Rodriguez, A.A.,Cirulli, A.E.,Chau, K.,Nguyen, J.,Ye, Q.,Corbett, K.D. Bipartite chromatin recognition by Hop1 from two diverged Holozoa. Life Sci Alliance 2025 8 0 0 9MYP 40829932 Structure of Patiria miniata Hop1 chromatin binding region 2025-01-22 2025-08-13 Rodriguez, A.A.,Cirulli, A.E.,Chau, K.,Nguyen, J.,Ye, Q.,Corbett, K.D. Bipartite chromatin recognition by Hop1 from two diverged Holozoa. Life Sci Alliance 2025 8 0 0 9N6G 40665765 EGFR(T790M/V948R) in complex with LN2827 2025-02-05 2025-08-13 Chitnis, S.P.,Wittlinger, F.,Mollers, M.,Hartman, T.J.,Gunther, M.,Eck, M.J.,Laufer, S.A.,Heppner, D.E. Structure-Activity Relationships of Inactive-Conformation Binding EGFR Inhibitors: Linking the ATP and Allosteric Pockets. Arch Pharm 2025 358 0 0 8SE1 Structure of Full-length Human Protein Kinase C Beta 2 (PKCBII) in the Inactive Conformation 2023-04-07 2025-08-20 Cong, A.T.Q.,Witter, T.L.,Bruinsma, E.S.,Bhattacharya, S.S.,Jayaraman, S.,Dugan, M.B.,Paluncic, J.,Kuffel, M.J.,Farmakes, J.,Alvey, J.,Wu, X.,Fields, A.P.,Pandey, A.,Hawse, J.R.,Goetz, M.P.,Schellenberg, M.J. Molecular Basis of Allosteric Regulation and Pharmaceutical Targeting of Protein Kinase C b To Be Published 0 0 0 0 8SE3 Structure of Full-length Human Protein Kinase C Beta 1 (PKCBI) in the Active Conformation 2023-04-07 2025-08-20 Cong, A.T.Q.,Witter, T.L.,Bruinsma, E.S.,Bhattacharya, S.S.,Jayaraman, S.,Dugan, M.B.,Paluncic, J.,Kuffel, M.J.,Farmakes, J.,Alvey, J.,Wu, X.,Fields, A.P.,Pandey, A.,Hawse, J.R.,Goetz, M.P.,Schellenberg, M.J. Molecular Basis of Allosteric Regulation and Pharmaceutical Targeting of Protein Kinase C b To Be Published 0 0 0 0 9DD4 40993395 Crystal Structure of Designed facilitated dissociation target LHD101An1: LHD101A with an N-terminal extension 2024-08-27 2025-08-20 Broerman, A.J.,Pollmann, C.,Zhao, Y.,Lichtenstein, M.A.,Jackson, M.D.,Tessmer, M.H.,Ryu, W.H.,Ogishi, M.,Abedi, M.H.,Sahtoe, D.D.,Allen, A.,Kang, A.,De La Cruz, J.,Brackenbrough, E.,Sankaran, B.,Bera, A.K.,Zuckerman, D.M.,Stoll, S.,Garcia, K.C.,Praetorius, F.,Piehler, J.,Baker, D. Design of facilitated dissociation enables timing of cytokine signalling. Nature 2025 647 528 535 9D0G 40787583 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with O-cresomycin, mRNA, deacylated A-site tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.50A resolution 2024-08-07 2025-08-27 Wu, K.J.Y.,Aleksandrova, E.V.,Robinson, P.J.,Benedetto, A.E.,Yu, M.,Tresco, B.I.C.,See, D.N.Y.,Jiang, T.,Ramkissoon, A.,Dunand, C.F.,Svetlov, M.S.,Lee, J.,Polikanov, Y.S.,Myers, A.G. Why Sulfur is Important in Lincosamide Antibiotics. Chem 2025 11 0 0 9D0H 40787583 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with C-cresomycin, mRNA, deacylated A-site tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.50A resolution 2024-08-07 2025-08-27 Wu, K.J.Y.,Aleksandrova, E.V.,Robinson, P.J.,Benedetto, A.E.,Yu, M.,Tresco, B.I.C.,See, D.N.Y.,Jiang, T.,Ramkissoon, A.,Dunand, C.F.,Svetlov, M.S.,Lee, J.,Polikanov, Y.S.,Myers, A.G. Why Sulfur is Important in Lincosamide Antibiotics. Chem 2025 11 0 0 9D0I 40787583 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with Se-cresomycin, mRNA, deacylated A-site tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.45A resolution 2024-08-07 2025-08-27 Wu, K.J.Y.,Aleksandrova, E.V.,Robinson, P.J.,Benedetto, A.E.,Yu, M.,Tresco, B.I.C.,See, D.N.Y.,Jiang, T.,Ramkissoon, A.,Dunand, C.F.,Svetlov, M.S.,Lee, J.,Polikanov, Y.S.,Myers, A.G. Why Sulfur is Important in Lincosamide Antibiotics. Chem 2025 11 0 0 9OLZ 40789943 Crystal structure of E. coli ApaH in complex with Ap4A 2025-05-13 2025-09-03 Nuthanakanti, A.,Korn, M.,Levenson-Palmer, R.,Wu, Y.,Babu, N.R.,Huang, X.,Banh, R.S.,Belasco, J.G.,Serganov, A. ApaH decaps Np 4 N-capped RNAs in two alternative orientations. Nat.Chem.Biol. 2025 0 0 0 9ONG 40789943 Crystal structure of E. coli ApaH in complex with Ap4AG 2025-05-15 2025-09-03 Nuthanakanti, A.,Korn, M.,Levenson-Palmer, R.,Wu, Y.,Babu, N.R.,Huang, X.,Banh, R.S.,Belasco, J.G.,Serganov, A. ApaH decaps Np 4 N-capped RNAs in two alternative orientations. Nat.Chem.Biol. 2025 0 0 0 9MF1 40934300 Crystal structure of RIT1 in the GDP state 2024-12-09 2025-09-10 Dharmaiah, S.,Bonsor, D.A.,Mo, S.P.,Fernandez-Cabrera, A.,Chan, A.H.,Messing, S.,Drew, M.,Vega, M.,Nissley, D.V.,Esposito, D.,Castel, P.,Simanshu, D.K. Structural basis for LZTR1 recognition of RAS GTPases for degradation. Science 2025 389 1112 1117 9Y0I Crystal structure of designed switching homodimer CSD20f3A 2025-08-28 2025-09-10 Broerman, A.,Bera, A.K.,Baker, D. Design of facilitated dissociation enables temporal control over cytokine signaling To Be Published 0 0 0 0 9Y59 Crystal structure of CSD20f3B, a designed switching binder to CSD20f3A 2025-09-04 2025-09-17 Broerman, A.,Bera, A.K.,Kang, A.,Nguyen, H.,Baker, D. Design of CSD20f3B, a designed switching binder to CSD20f3A To Be Published 0 0 0 0 9V4M 41094128 Crystal structure of the T.thermophilus transcription initiation complex bound to Ap4G 2025-05-24 2025-10-22 Duan, W.,Kaushik, A.,Unarta, I.C.,Wu, Y.,Liu, M.M.J.,Weaver, J.W.,Wang, B.,Rice, W.J.,Luciano, D.J.,Belasco, J.G.,Huang, X.,Nudler, E.,Serganov, A. Molecular basis for noncanonical transcription initiation from Np 4 A alarmones. Nat.Chem.Biol. 2025 0 0 0 9BN7 X-ray crystal structure of TNFa-VNAR C4 complex 2024-05-02 2025-11-05 Ubah, O.C.,Shi, K.,Moller, N.,Aihara, H. X-ray crystal structure of TNFa VNAR complex To Be Published 0 0 0 0 9E6U Crystal structure of human Taspase1 in complex with ligand SMDC1041556 2024-10-31 2025-11-05 Doamekpor, S.K.,Hamilton, K.,Choi, P.H.,Tong, L.,Delker, S.,Waterson, A.,Neitz, J.,Sambucetti, L.,Arkin, M. Design and mechanism of potent inhibitors for the Mixed Lineage Leukemia (MLL) activating protease, Taspase-1 To Be Published 0 0 0 0 9E9O 40527531 SARS-CoV-2 SL5 crystal structure Cesium derivative 2024-11-08 2025-11-05 Jones, C.P.,Ferre-D'Amare, A.R. Crystallographic and cryoEM analyses reveal SARS-CoV-2 SL5 is a mobile T-shaped four-way junction with deep pockets. Rna 2025 31 949 960 9D3X 41313771 Crystal structure of S. thermophilus class III ribonucleotide reductase bound to dATP 2024-08-12 2025-12-17 Andree, G.A.,Miller-Brown, K.R.,Zhao, Z.,Smith, A.K.,Dawson, C.D.,Deredge, D.J.,Drennan, C.L. How ATP and dATP reposition class III ribonucleotide reductase cone domains to regulate enzyme activity. Sci Adv 2025 11 0 0 9O0N 41519889 Crystal structure of GDP-bound wild type KRAS in complex with MRTX1133 2025-04-03 2026-01-21 Bonsor, D.A.,Finci, L.I.,Potter, J.R.,Young, L.C.,Wall, V.E.,Goldstein de Salazar, R.,Geis, K.R.,Stephens, T.,Finney, J.,Nissley, D.V.,McCormick, F.,Simanshu, D.K. Structure of SHOC2-KRAS-PP1C complex reveals RAS isoform-specific determinants and insights into targeting complex assembly by RAS inhibitors. Nat Commun 2026 17 1614 1614 9O0O 41519889 Crystal structure of GMPPNP-bound wild type KRAS in complex with MRTX1133 2025-04-03 2026-01-21 Bonsor, D.A.,Finci, L.I.,Potter, J.R.,Young, L.C.,Wall, V.E.,Goldstein de Salazar, R.,Geis, K.R.,Stephens, T.,Finney, J.,Nissley, D.V.,McCormick, F.,Simanshu, D.K. Structure of SHOC2-KRAS-PP1C complex reveals RAS isoform-specific determinants and insights into targeting complex assembly by RAS inhibitors. Nat Commun 2026 17 1614 1614 9PR8 41628221 Crystal Structure of the Clostridiodes difficile CspC-CspA heterodimer. 2025-07-23 2026-01-21 McNellis, M.E.,Gonzalez-Del Pino, G.,Serrano-Jimenez, J.A.,Forster, E.R.,Stoica, A.I.,Heldwein, E.E.,Shen, A. The CspC:CspA heterodimer transduces germinant and co-germinant signals during Clostridioides difficile spore germination. Plos Biol. 2026 24 0 0 9PR9 41628221 Crystal structure of the Clostridiodes difficile CspA homodimer 2025-07-23 2026-01-21 McNellis, M.E.,Gonzalez-Del Pino, G.,Serrano-Jimenez, J.A.,Forster, E.R.,Stoica, A.I.,Heldwein, E.E.,Shen, A. The CspC:CspA heterodimer transduces germinant and co-germinant signals during Clostridioides difficile spore germination. Plos Biol. 2026 24 0 0 9CWY Crystal structure of HLA-A*03:02 in complex with a wild-type PIK3CA peptide 2024-07-30 2026-02-04 Ma, J.,Baker, B.M. Crystal structure of HLA-A*03:02 in complex with a wild-type PIK3CA peptide To Be Published 0 0 0 0 9CWZ Crystal structure of HLA-A*03:02 in complex with a mutant PIK3CA peptide 2024-07-30 2026-02-04 Perera, W.W.J.G.,Ma, J.,Baker, B.M. Crystal structure of HLA-A*03:02 in complex with a mutant PIK3CA peptide To Be Published 0 0 0 0 9CX0 Crystal structure of HLA-A*03:01 E152V mutant in complex with a mutant PIK3CA peptide 2024-07-30 2026-02-04 Ma, J.,Lazar, J.A.,Baker, B.M. Crystal structure of HLA-A*03:01 E152V mutant in complex with a mutant PIK3CA peptide To Be Published 0 0 0 0 9CX2 Crystal structure of HLA-A*03:01 L156Q mutant in complex with a mutant PIK3CA peptide 2024-07-30 2026-02-04 Ma, J.,Perera, W.W.J.G.,Baker, B.M. Crystal structure of HLA-A*03:01 L156Q mutant in complex with a mutant PIK3CA peptide To Be Published 0 0 0 0 10PX 41874376 Crystal structure of the wild-type Thermus thermophilus 70S ribosome in complex with benzoxaborole derivative of azithromycin (AZI-BB2), mRNA, aminoacylated A-site Phe-tRNAphe, aminoacylated P-site fMet-tRNAmet, and deacylated E-site tRNAphe at 2.45A resolution 2026-02-01 2026-03-11 Volynkina, I.A.,Bortyazh, M.O.,Chen, C.-W.,Tereshchenkov, A.G.,Karakchieva, A.O.,Lukianov, D.A.,Komarova, E.S.,Tupikin, A.E.,Skvortsov, D.A.,Tevyashova, A.N.,Tikhomirov, A.S.,Tashlitsky, V.N.,Kabilov, M.R.,Shchekotikhin, A.E.,Dontsova, O.A.,Polikanov, Y.S.,Sergiev, P.V. Benzoxaborole-modified azithromycins inhibit translation without inducing ermC expression. Antimicrob.Agents Chemother. 2026 0 0 0 9PIZ 41769711 Structure of KRAS-G12C bound to 1-[(4aR,10P,13R)-10-[5-amino-4-fluoro-3-methyl-2-(trifluoromethyl)phenyl]-11-chloro-9-fluoro-1,2,4a,5-tetrahydropyrazino[1',2':4,5][1,4]oxazino[2,3-c]quinolin-3(4H)-yl]prop-2-en-1-one (compound 15) 2025-07-11 2026-03-11 Landry, M.L.,Malhotra, S.,Beresini, M.,Chan, C.,Chan, E.,de la Cruz, C.C.,Endres, N.F.,Evangelista, M.,Gustafson, A.,Hu, D.,Hunsaker, T.,Hsu, P.,Izrayelit, Y.,La, H.,Saenz-Lopez Larrocha, P.,Lian, Q.,Merchant, M.,Mao, J.,Mroue, R.,Oh, A.,Plise, E.,Shao, C.,Siu, M.,Tran, J.C.,Wang, Y.,Wang, W.,Wei, B.,Wong, S.,Yen, C.W.,Zhou, Y.,Purkey, H.E.,Heffron, T.P.,Salphati, L. Discovery and Optimization of a Potent, Efficacious, and Brain-Penetrant Inhibitor of KRAS G12C. J.Med.Chem. 2026 69 5241 5258 8VZW 40663423 Structure of humanized MS-Hu6 Fab fragment 2024-02-12 2026-03-18 Pallapati, A.R.,Korkmaz, F.,Rojekar, S.,Sims, S.,Misra, A.,Gimenez-Roig, J.,Gangadhar, A.,Laurencin, V.,Gumerova, A.,Cheliadinova, U.,Sultana, F.,Vasilyeva, D.,Cullen, L.,Schuermann, J.,Munitz, J.,Kannangara, H.,Parte, S.,Pevnev, G.,Burganova, G.,Tumoglu, Z.,Witztum, R.,Wizman, S.,Kramskiy, N.,Igel, L.,Sen, F.,Ranzenigo, A.,Macdonald, A.,Hutchison, S.,Teunissen, A.J.,Burkart, H.,Saxena, M.,Ginsburg, Y.,Goosens, K.,Zhou, W.,Ryu, V.,Moldavski, O.,Barak, O.,Pazianas, M.,Caminis, J.,Bhasin, S.,Fitzgerald, R.,Kim, S.M.,Quinn, M.,Haider, S.,Appt, S.,Frolinger, T.,Rosen, C.J.,Lizneva, D.,Gupta, Y.K.,Yuen, T.,Zaidi, M. Efficacy and safety of a therapeutic humanized FSH-blocking antibody in obesity and Alzheimer's disease models. J.Clin.Invest. 2025 135 0 0 9PKQ 41386227 Structure of the cytoplasmic domain of unliganded human Tom70, open and closed conformations 2025-07-14 2026-03-18 Bachochin, M.J.,McGuire, K.L.,Cook, B.D.,Ye, Q.,Silletti, S.,Corbett, K.D.,Komives, E.A.,Herzik Jr., M.A. An allosteric network governs Tom70 conformational dynamics to coordinate mitochondrial import. Structure 2026 34 273 0 11QE 39484452 Crystal structure of GDP-bound KRAS G12D/I55E: Suppressing G12D oncogenicity via second-site I55E mutation 2026-03-10 2026-03-25 Kwon, J.J.,Dilly, J.,Liu, S.,Kim, E.,Bian, Y.,Dharmaiah, S.,Tran, T.H.,Kapner, K.S.,Ly, S.H.,Yang, X.,Rabara, D.,Waybright, T.J.,Giacomelli, A.O.,Hong, A.L.,Misek, S.,Wang, B.,Ravi, A.,Doench, J.G.,Beroukhim, R.,Lemke, C.T.,Haigis, K.M.,Esposito, D.,Root, D.E.,Nissley, D.V.,Stephen, A.G.,McCormick, F.,Simanshu, D.K.,Hahn, W.C.,Aguirre, A.J. Comprehensive structure-function analysis reveals gain- and loss-of-function mechanisms impacting oncogenic KRAS activity. Biorxiv 2024 0 0 0 9YR9 Structure of human MARK3 in complex with inhibitor 2025-10-16 2026-04-08 Mao, D.Y.L.,Ogunjimi, A.A.,Pau, V.,Chini, F.D.,Sicheri, F. Structure of human MARK3 in complex with inhibitor To Be Published 0 0 0 0 9ZZW Structure of human MARK3 in complex with inhibitor 2026-01-08 2026-04-08 Mao, D.Y.L.,Ogunjimi, A.A.,Sicheri, F. Structure of human MARK3 in complex with inhibitor To Be Published 0 0 0 0 9EEJ 41862478 Crystal structure of E. coli aspartate transcarbamoylase in the R-state complexed with CP, succinate, ATP, and Mg2+ 2024-11-19 2026-04-15 Miller, R.C.,Patterson, M.G.,Bhatt, N.,Pei, X.,Ando, N. Cooperativity in E. coli aspartate transcarbamoylase is tuned by allosteric breathing. Nat Commun 2026 0 0 0 9NZ7 Crystal structure of human DYNLL1-S64A/S88A mutant dimer 2025-03-31 2026-04-15 Syed, A.,Arvai, A.S.,Chowdhury, D.,Tainer, J.A. Crystal structure of human DYNLL1-S64A/S88A mutant dimer To Be Published 0 0 0 0